Animals
Transgenic mdx mice expressing exon 45-55-deleted human dystrophin (Tg/mdx) were obtained as previously described [14]. C57BL/6J (BL6), mdx, and iNOS KO mice with a C57BL/6J background were purchased from Nihon CREA (Tokyo, Japan) and Jackson Laboratory (Bar Harbor, ME). mdx iNOS KO-double mutant mice were generated by crossing iNOS KO and mdx mice (Fig. 1A). The genotype of mdx mice was determined by primer competition PCR as reported by Shin et al. [15]. The genotype of iNOS KO was determined as described by Li et al. [13] (Fig. 1B). Tg/mdx-iNOS KO mice were generated by crossing Tg/mdx mice and mdx iNOS KO mice (Fig. 1A). The experimental mice were 3-4 months old. Only male mice were used in the study. Mice were bred at the specific pathogen-free (SPF) animal facility in the National Institute of Neuroscience, NCNP, and were allowed free access to food and drinking water. The Experimental Animal Care and Use Committee of the National Institute of Neuroscience of the NCNP approved all experimental protocols in this study (Approval ID: 2018041).
Antibodies
Rabbit polyclonal antibody against dystrophin (#ab15277), nNOS (#61-7000), and iNOS (#482728) were purchased from Abcam (Tokyo, Japan), Invitrogen (Carlsbad, CA) and Sigma-Aldrich (St. Louis, MO), respectively. Rat monoclonal antibody against F4/80 (#T2028) was purchased from BMA Biomedicals (Augst, Switzerland). Mouse monoclonal antibody against RyR1 (R129) was purchased from Sigma-Aldrich (St. Louis, MO). Goat polyclonal antibody against GAPDH (V-18) was purchased from Santa Cruz (Santa Cruz, CA, USA). Rabbit polyclonal antibody against α1-syntrophin [16] was a kind gift from Dr. Michihiro Imamura (National Center of Neurology and Psychiatry).
Tissue preparation
Mice were sacrificed by cervical dislocation. The tibialis anterior (TA) and gastrocnemius (GC) and diaphragm (DIA) muscles were collected using standard dissection methods. Muscles were frozen in isopentane cooled by liquid nitrogen for histological analysis, RNA, or protein isolation. All samples were stored at -80°C.
Immunohistochemistry, histology
Cryosections were cut from TA and DIA muscles at 8 µm and stained with hematoxylin and eosin (H&E). Immunohistochemistry was performed as described previously [17]. In brief, sections were fixed in cold acetone and incubated in TBS containing 0.1% Triton-100 for 1 min at room temperature. The sections were washed and stained with primary antibodies in TBS containing 2% casein overnight at 4 ℃, followed by incubation with Alexa 488-conjugated goat anti-rabbit IgG antibody or Alexa 594-conjugated goat anti-rat IgG antibody (Invitrogen). Fluorescence images were obtained using a BZ-X810 fluorescence microscope (Keyence, Osaka, Japan).
RNA isolation and qRT-PCR analysis
RNA isolation from TA muscles and cDNA synthesis were performed as previously described [18]. Expression levels of mRNA were measured by quantitative RT-PCR (qRT-PCR) using the SYBR Premix Ex TaqII (Takara). Primer sequences for qRT-PCR were as follows: iNOS forward, 5′- TGACCATCATGGACCACCAC-3′, reverse, 5′- ACCAGCCAAATCCAGTCTGC-3′; nNOS forward, 5′- ACCAGCACCTTTGGCAATGGAG-3′, reverse, 5′- GAGACGCTGTTGAATCGGACCT -3′; GAPDH forward, 5′- GTGAAGGTCGGTGTGAACG -3′, reverse, 5′- CAATCTCCACTTTGCCACTG -3′. The expression levels of these genes were normalized to those of GAPDH.
Western blot analysis
Total protein from TA muscles was extracted by a sample buffer containing 15% glycerol, 1 mM dithiothreitol, 2% SDS, 125 mM Tris-HCl, and protease inhibitor cocktails cOmplete. Protein lysate was then incubated at 100°C for 5 min and centrifuged at 10,000 rpm for 5 min. The supernatant was used for SDS-polyacrylamide gel electrophoresis (SDS-PAGE). The protein concentration was determined using a protein assay (Bio-Rad Laboratories, Inc., Hercules, CA) with bovine serum albumin as a standard in an SDS concentration that does not affect the accuracy of the assay system. The samples were separated on an SDS-polyacrylamide gel and electrically transferred from the gel to a polyvinylidene difluoride membrane (Millipore, Darmstadt, Germany). The blot was incubated with primary antibodies. The signals were detected using the ECL Prime Western Blotting Detection Reagent (GE Healthcare, UK, Ltd; RPN2232) and a ChemiDoc MP Imaging System (Bio-Rad). Data were analyzed using Image Lab 6.0 (Bio-Rad).
Biotin switch assay
To detect the S-nitrosylation of RyR1, a biotin switch assay was carried out based on a modified procedure described previously [19]. Total protein from GC muscles was homogenized in HENS buffer containing 0.5% (w/v) CHAPS, 0.1% (w/v) SDS, 20 mM NEM, cOmplete protease inhibitor cocktail, and calpain inhibitor I and kept on ice for 30 min to block sulfhydryl groups. The supernatant was supplemented with SDS at a final concentration of 1% (w/v), and incubated for 30 min at RT. Excess NEM was removed by protein precipitation with acetone, and the pellet was resuspended and incubated for 1 h at RT in HENS buffer containing 1% (w/v) SDS, 10 mM sodium ascorbate, and S-Nitrosylation Labeling reagents in the kit as per manufacturer’s instructions (Cayman Chemical, Ann Arbor, MI, USA) for reduction of S-nitrosothiols and labeling with biotin. Extra labeling was removed by a second acetone precipitation. Proteins were resuspended in lysis buffer containing 25 mM Tris-HCl, pH 7.5, 100 mM NaCl, 2 uM EDTA, 1% (v/v) Triton-X-100, 0.1% (w/v) SDS, cOmplete protease inhibitor cocktail, and calpain inhibitor I. To pull down SNO proteins, streptavidin-conjugated magnetic beads (2.8 um, Dynal magnetic beads; Invitrogen Life Technologies Corp., Carlsbad, CA, USA) were used. The beads were washed 3 times with lysis buffer and added to the biotin-labeled samples. The mixture was rotated at room temperature for 1 h. After removing the supernatant by magnetic separation, SNO proteins were eluted in 50 µL of SDS-loading buffer. Protein was separated by SDS-PAGE and electroblotted onto a PVDF membrane. Membranes were blocked in TBST containing 3% bovine serum albumin for 1 h at RT. Protein was detected by immunoblotting using polyclonal antibody against RyR1 (Sigma-Aldrich; R129). S-nitrosylated RyR1 was normalized by the intensity of the RyR1 signal of whole muscle lysate.
NOS activity assay
NOS activity was determined by the citrulline assay as previously described [20] using the NOS assay kit (Cayman Chemical). Fresh quadriceps muscles were homogenized in 5 volumes of buffer containing 25 mM Tris-HCl (pH 7.4), 1 mM EDTA, and 1 mM EGTA. The homogenate was centrifuged at 1,0000 g for 15 min at 4℃. The Supernatant was mixed with a reaction mixture contained 25 mM Tris-HCl, pH 7.4, 3 µM tetrahydrobiopterin, 1 µM FAD, 1 µM FMN, 1 mM NADPH, 600 µM CaCl2, 0.1 µM calmodulin, and 1 µCi [3H] Arg (Amersham Biosciences, Bucks, UK). After incubation for 30 min at 37℃, the reaction was stopped by adding stop buffer (50 mM HEPES, pH 5.5, 5 mM EDTA). A resin slurry was added to the reaction mixture, and the resin was removed by centrifuging. The flow-through containing [3H]citrulline was added to the scintillation liquid, and radioactivity was counted. Particularly, iNOS activity was determined using a reaction mixture containing MgCl2 instead of CaCl2 and incubating 2 h at 37℃.
Statistical analysis
All values are expressed as means ± SEM. Statistical differences were assessed by a one-way ANOVA with Tukey-Kramer post-hoc analysis. Probabilities less than 5% (*P<0.05), 1% (**P<0.01), 0.1% (***P<0.001) or 0.01% (****P<0.0001) were considered to be statistically significant.