Adiponectin inhibits palmitic acid-induced NLRP3 inflammasome activation in hepatocytes through AMPK-JNK/ErK1/2-NFκB/ROS signaling pathways

doi:10.21203/rs.3.rs-16972/v1

Download PDF

Research

Adiponectin inhibits palmitic acid-induced NLRP3 inflammasome activation in hepatocytes through AMPK-JNK/ErK1/2-NFκB/ROS signaling pathways

https://doi.org/10.21203/rs.3.rs-16972/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background

Adiponectin, an adipose-derived adipokine, possesses a hepatoprotective role in various liver disorders. Inflammasome activation has been recognized to play a major role during the progression of non-alcoholic fatty liver diseases (NAFLD). However, the effect of adiponectin on NLRP3 inflammasome activation in liver and the exact mechanism remains largely unclear. Here, we assessed the effect of adiponectin on NLRP3 inflammasome activation and its potential molecular mechanisms through both in vivo and in vitro experiments.

Methods

Male adiponectin-knockout (adiponectin-KO) mice and C57BL/6 (wild-type) mice were fed a high-fat-diet (HFD) for 12 weeks as an in vivo model of non-alcoholic steatohepatitis (NASH). Serum biochemical markers, liver histology and inflammasome-related gene and protein expression were determined. In addition, the hepatocytes isolated from SD rats were exposed to palmitic acid(PA) in the absence or presence of adiponectin and/or AMPK inhibitor. The activation of NLRP3 inflammasome was assessed by mRNA and protein expression. Furthermore, ROS production and related signaling pathways were also evaluated.

Results

In the in vivo experiments, we found that adiponectin deficiency mice fed with HFD presented excessive hepatic steatosis with increased NLRP3 inflammasome activation compared to wild-type mice. Moreover, the expression levels of NLRP3 inflammasome activation pathway molecules (NFκB and ROS) were upregulated, while the phosphorylation levels of AMPK, JNK and Erk1/2 were downregulated in adiponectin-knockout mice compared with wild-type mice. In the in vitro study, PA significantly promoted NLRP3 inflammasome activation in hepatocytes. Additionally, PA increased lipid droplet deposition, NF-kB signaling and ROS production, while adiponectin could abolish PA-mediated NLRP3 inflammasome activation and decrease ROS production, which was reversed by AMPK inhibitor (compound C). The results indicated that the inhibitory effect of adiponectin on PA-mediated NLRP3 inflammasome activation was regulated by AMPK-JNK/ErK1/2-NFκB/ROS signaling pathway.

Conclusion

Adiponectin inhibited PA-mediated NLRP3 inflammasome activation in hepatocytes. Adiponectin analogs or AMPK agonists could serve as a potential novel agent for preventing or delaying the progression of NASH and NAFLD.

Translational Medicine

adiponectin

NLRP3 inflammasome

AMPK

hepatocytes

NAFLD

Non-alcoholic fatty liver diseases (NAFLD) contains a broad histopathological spectrum ranging from steatosis alone to non-alcoholic steatohepatitis (NASH), which can result in hepatic cirrhosis and even liver cancer [1, 2]. NASH is highly associated with obesity, insulin resistance, hypertension and diabetes mellitus [3]. In recent years, with the changes in human diet and lifestyle, the incidence rates of NAFLD and NASH are increased at an alarming rate, which has become the leading cause of chronic hepatic diseases [4, 5]. At present, there is no effective therapeutic drug for NAFLD treatment. Thus, it is of great significance to understand the pathogenesis of NAFLD. The “two-hit” hypothesis on NASH development has been widely spread and well recognized [6]. Recently, new insights into the molecular mechanism of NASH have been provided. Numerous studies have suggested the involvement of inflammasome activation in the pathogenesis of NASH [7–10].

Inflammasomes are large cytoplasmic multi-protein complexes that response to both exogenous and endogenous alerting signals through intracellular NOD-like receptor (NLR) [11, 12]. NLR family pyrin domain-containing 3 (NLRP3) inflammasome, composing of NLRP3, the adaptor protein ASC and the effector molecule pro-caspase1, is well characterized [13, 14]. The activation of NLRP3 inflammasome usually requires two signals [15]: the prime signal that promotes the transcription of inflammasome components through NFκB signaling activation [16], and the second signal is initiated to activate NLRP3 for recruiting and interacting with caspase1 precursor (pro-caspase1) through the adaptor molecule ASC [17]. Pro-caspase1 is cleaved into active caspase1, which in turn promotes the secretion of mature IL-18 and IL-1β and triggers inflammatory responses.

Adiponectin is an adipose-derived adipokine [18]. Much attention has been attracted by adiponectin because of its insulin-sensitizing [19], anti-inflammatory and hepatoprotective properties [20, 21]. Previous studies have demonstrated that the plasma level of adiponectin is negatively correlated with NAFLD [18], and hypoadiponectinemia is independently associated with hepatic steatosis and inflammation in NASH patients [22]. Adiponectin deficiency can accelerate the progression of steatohepatitis in NASH mouse model and induce severe liver fibrosis [20, 23]. However, the potential mechanism underlying the hepatoprotective effect of adiponectin has not been has yet to be fully elucidated. Therefore, this research aimed to explore the effects of adiponectin on palmitic acid (PA)-mediated NLRP3 inflammasome activation in hepatocytes and its potential molecular mechanisms.

Experimental animal model

The ethical approval for this study was obtained from the Animal Ethics Committee of our institution. All animals were maintained and used in accordance with the guidelines and policies approved by the Animal Care and Use Committee of Shanghai Jiao Tong University School of Medicine. To induce the animal model of non-alcoholic steatohepatitis, 4-week-old male C57BL/6 and adiponectin-knockout (adiponectin-KO) mice were randomly assigned to two groups: normal diet feeding group and high-fat-diet (HFD) feeding (D12492, Research Diets) group. All animals were given unlimited access to water and food, and kept under a controlled temperature of 22–24 °C with a 12-h light/12-h dark cycle. The mice were then euthanized, and their liver tissue and plasma samples were collected at 0, 4, 8 and 12 weeks for further analyses.

Cell Isolation And Treatment

Hepatocytes were isolated from male C57BL/6 mice by a two-step (collagenase B and pronase E) perfusion method under ketamine/xylazine anesthesia as described previously [24]. The isolated hepatocytes were seeded in collagen-coated culture dishes at a density of 2*10^5 cells/ml and cultured in Dulbecco's modified Eagle's medium (HyClone, Logan, UT, USA) supplemented with 10% fetal bovine serum (Gibco, Carlsbad, CA, USA) and 1% (v/v) penicillin-streptomycin at 37 °C in 5% CO2 incubator for 48 h. The hepatocytes were then serum-starved for 6 h, followed by treatment with adiponectin (APN; 10 ug/ml, Biovendor, Nycodenz) for 2 h prior to 300 umol/ml palmitic acid (PA; Sigma, St. Louis, MO) exposure for 24 h. For the inhibition experiment, the hepatocytes were treated with AMPK inhibitor (compound C, 10 um/M; Sigma) 2 h prior to adiponectin treatment. The treated hepatocytes and culture supernatant were collected for subsequent analyses.

Real Time PCR Analysis

Total RNA was extracted from the cultured hepatocytes or liver tissue by using TRIzol reagent (Invitorgen, Carlsbad, California, USA) based on the manufacturer’s protocols. cDNA synthesis was performed using SuperScriptIII reverse transcriptase, random primers and 1 ug RNA (Invitrogen, Carlsbad, CA, USA). qPCR was conducted using Power SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA, USA). The expression level of each gene was normalized to the corresponding housekeeping gene β actin value, and presented as fold changes relative to controls. All primers sequences are shown in Table 1.

Table 1

Sequences of primers for quantitative real-time PCR
	Gene name	Forward primer sequence (5’-3’)	Reverse primer sequence (5’-3’)
mouse	NLRP3	AAGGCTTGTGTGGGACCAA	GCGCTTCTAAGGCACGTTTT
	IL1β	TGCCACCTTTTGACAGTGATG	TGCCACCTTTTGACAGTGATG
	IL18	ACGTGTTCCAGGACACAACA	ACAGGCGAGGTCATCACAAG
	Caspase1	CGCGGTTGAATCCTTTTCAGAC	CCTTTCCAACAGGGCGTGAA
	ASC	TCCACAGACCCAAGTTATGGC	GGTGCCTTTCTAAGCCCCAT
	TNFa	GATCGGTCCCCAAAGGGATG	ACAAGGTACAACCCATCGGC
	IL6	GGGACTGATGCTGGTGACAA	TCTGCAAGTGCATCATCGTT
	β-actin	TTCGTTGCCGGTCCACACCC	GCTTTGCACATGCCGGAGCC

Western Blotting

Equivalent amounts of total protein extracted from the hepatocytes or liver tissue were loaded onto 10% sodium dodecyl sulphate poly-acrylamide gel, and subsequently transferred onto polyvinylidene fluoride membranes (Millipore, Bedford, MA, USA). After blocking with 5% non-fat milk, the membranes were incubated overnight with primary antibodies at 4℃, followed by washing with 0.05% Tween-20/TBS. Following incubation with secondary antibodies, the resulting blots were visualized by an enhanced chemiluminescence kit (Pierce Perbio, Rochford, IL) based on the manufacturer’s instructions. Finally, the protein bands were digitally scanned and quantitated using ImageJ software. NLRP3 (bs-10021R), AMPK (bs-10344R), p-AMPK (bs-12972R), NFκBp65 (bs-20355R) and NFκB p-p65 (bs-5663R) antibodies were purchased from Abcam, Inc. Caspase-1 (sc-56036), c-Jun terminal kinase (JNK; sc-1648), p-JNK (sc-6254), extracellular signal-regulated kinase1/2 (Erk1/2; sc-514302) and p-Erk1/2 (sc-136521) antibodies were obtained from Santa Cruz Biotechnology, Inc. IL1β antibody (#2022) were supplied by Cell Signalling Technology, Inc..

Immunofluorescence Staining

The expression levels of NLRP3 in hepatocytes exposure to PA were analyzed by immunofluorescence. All images were obtained using a fluorescence microscope (IX51, Olympus, Japan).

Determination Of Reactive Oxygen Species

The level of reactive oxygen species (ROS) in hepatocytes was measured using 2',7'-dichlorofluorescein diacetate (DCFH-DA, ROS probe; D6883, Sigma). All images were acquired using a fluorescence microscope (IX51, Olympus, Japan). The excitation and emission wavelengths were fixed at 488 and 525 nm, respectively.

Detection Of Lipid Droplet Deposition

Hepatocytes were treated as described above and then fixed with 10% formalin. Lipid droplet deposition in cells was detected with BODIPY 493/503 (790389, Sigma), and then observed using a fluorescence microscope (IX51, Olympus, Japan).

Biochemical Analysis And Cytokine Assay

The levels of aspartate aminotransferase (AST), alanine aminotransferase (ALT), cholesterol (CHOL) and total triglyceride (TG) were detected with the commercial kits (Nanjing Jiancheng Bioengineering Institute). Cytokines in the supernatant or liver tissue were assessed using the commercially available enzyme-linked immunoassay (ELISA) kits. The ELISA kits for IL1β, IL18, TNFα and IL-6 were obtained from Elabscience (Wuhan, China).

Histological Analysis Of Liver Tissue

The liver tissue sections were subjected to hematoxylin and eosin (H&E) staining, oil red O (ORO) staining and immunohistochemistry dye by following the standard protocols as previously described. Briefly, the paraffin-embedded liver sections were deparaffinized, rehydrated. stained with H&E or ORO, and then observed under a microscope. For immunohistochemical staining, the liver sections were incubated with freshly prepared 3% hydrogen peroxide for 20 min. After washing with PBS, antigen retrieval was conducted in 0.01 M citric acid. The sections were submerged in 5% normal blocking serum for 30 min, and subsequently incubated with NLRP3, caspase1 or IL1b overnight at 4 °C. Following that, the sections were incubated with the corresponding secondary antibody for 1 h at room temperature. Lastly, all sections were examined using the microscope.

Statistical analysis

All data were presented as mean ± SEM. Student’s t test or two-way ANOVA was employed to compare the statistical differences using SPSS statistics software (version 12.0 for Windows; SPSS, Inc., Chicago, IL, USA). A p-value of < 0.05 was deemed as statistically significant. All experiments were repeated at least 3 times.

Adiponectin deficiency aggravates liver injury and steatosis as well as sensitizes to HFD-induced NLRP3 inflammasome activation

To figure out the effects of high-fat-diet (HFD) feeding on hepatic injury and steatosis in adiponectin-KO (APNKO)mice, several biochemical markers and liver histology were analyzed. The results indicated that the serum levels of AST, ALT, CHOL and TG were markedly increased with the prolongation of HFD feeding time, and appeared to be higher in APNKO mice than in wild-type mice (Fig. 1A). H&E and ORO staining revealed severe inflammation, ballooned hepatocytes and worse hepatic steatosis in HFD mice in a time-dependent manner. Moreover, liver injury and fat deposition were more obvious in APNKO mice than in wild-type mice (Fig. 1B). To investigate whether NLRP3 inflammasome is involved in HFD-induced liver injury and steatosis under the condition of adiponectin deficiency, the expression levels of NLRP3 inflammasome and related inflammatory markers were detected. As shown in Fig. 1C, adiponectin deficiency promoted the gene expression of NLRP3, ASC, caspase1 and IL1β, IL18, TNFα and IL6 in HFD-fed APNKO mice compared to wild-type mice. Additionally, the concentration of IL1β, IL18, TNFα and IL6 in liver tissue lysate were remarkably higher in adiponectin-KO mice than in wild-type mice (Fig. 1D). In accordance to the above findings, immunohistochemical staining of the liver tissue sections further confirmed that NLRP3, caspase1 and IL1β expression were remarkably upregulated in HFD-fed adiponectin-KO mice compared to wild-type mice(Fig. 1E). These data strongly indicate that adiponectin deficiency aggravates HFD-induced liver injury and steatosis as well as sensitizes to HFD-induced NLRP3 inflammasome activation and downstream cytokine production.

The effects of adiponectin deficiency on ROS production and NFκB/AMPK/MAPK signaling pathways

To further elucidate the possible regulatory mechanism by which adiponectin deficiency aggravates HFD-induced NLRP3 inflammasome activation, the levels of ROS production as well as NFκB, AMPK and MAPK(JNK and ErK1/2) signaling pathways were determined. As presented in Fig. 2A, ROS production was significantly elevated in the liver of HFD-fed adiponectin-KO mice compared to wild-type mice. Besides, NFκB expression was markedly upregulated in HFD-fed adiponectin-KO mice compared to wild-type mice (Fig. 2B). On the contrary, the phosphorylation levels of AMPK, JNK and ErK1/2 were markedly reduced in adiponectin deficiency mice, while there was no remarkable alteration in the protein levels of total AMPK, JNK and ErK1/2 (Fig. 2C-E). These results suggest that adiponectin deficiency promotes HFD-induced NLRP3 inflammasome activation pathways (NFκB and ROS) and attenuates AMPK/JNK/ErK1/2 signaling pathways.

Adiponectin Alleviates PA-mediated NLRP3 Inflammasome Expression In Hepatocytes

Taking into account that adiponectin deficiency aggravates HFD-mediated NLRP3 inflammasome expression, we further determine the effects of PA and adiponectin on NLRP3 inflammasome activation in hepatocytes. As presented in Fig. 3A, treatment with PA induced lipid droplet deposition and NLRP3 inflammasome expression in hepatocytes. To verify the roles of adiponectin in PA-mediated hepatic activation of NLRP3 inflammasome complexes, hepatocytes were pre-treated with adiponectin for 2 h and then exposed to PA for 24 h. It was found that PA induced the expression levels of NLRP3, caspase1, ASC, IL1β, IL18 and other inflammatory markers (e.g., TNFα and IL6) when compared to control group. However, treatment with adiponectin could alleviate PA-mediated NLRP3 inflammasome activation (Fig. 3B-H). These findings reveal that adiponectin exerts a protective effect on PA-stimulated NLRP3 inflammasome activation in hepatocytes.

AMPK inhibitor attenuates adiponectin-mediated hepatoprotective effects against PA-mediated NLRP3 inflammasome activation

A previous study has suggested that AMPK can play a vital role in the biological activities of adiponectin [25]. The results of in vivo experiments showed that the level of p-AMPK was reduced in adiponectin-KO mice fed a HFD. Thus, in the in vitro study, the effects of AMPK signaling pathway on NLRP3 inflammasome suppression by adiponectin were assessed with Compound C (10 um/ml, an AMPK inhibitor). It was found that the mRNA expression levels of NLRP3 (Fig. 4A), Caspase1 (Fig. 4B), ASC (Fig. 4C), IL1β (Fig. 4D), IL18 (Fig. 4E) TNFα (Fig. 4F) and IL6 (Fig. 4G) were markedly upregulated in Compound C + adiponectin + PA group compared to adiponectin + PA group (Fig. 4), suggesting that compound C can disrupt the protective role of adiponectin against PA-mediated NLRP3 inflammasome activation. To further confirm these findings, the protein expression levels of NLPR3, pro-capase1, caspase1 (P10), pro-IL1β and IL1β in hepatocytes were detected. Consistent with the above data, adiponectin abolished PA-mediated expression of NLRP3 inflammasome protein complexes. On the contrary, Compound C reversed the inhibitory effect of adiponectin on PA-mediated NLRP3 inflammasome activation in hepatocytes (Fig. 5A-D), In support of the above-mentioned data, similar results were also observed with regard to the concentrations of IL1β, IL18, TNFα and IL6 in cell culture supernatant (Fig. 5E-H).

Adiponectin plays a protective role against PA-mediated NLRP3 inflammasome activation via AMPK-JNK/Erk-NFkB/ROS signaling pathways

Based on the above data, we speculated that adiponectin may inhibit PA-mediated inflammasome activation through AMPK signaling pathway. Therefore, we next determined the expression levels of AMPK and other related signaling pathways. As presented in Fig. 6A, adiponectin increased the phosphorylation levels of AMPK, JNK and ErK1/2 in hepatocytes. Our previous work has indicated that AMPK can act as an upstream regulator of JNK and Erk1/2 in hepatic stellate cells [26].Thus, we also detected the activities of JNK and Erk1/2 following the exposure to AMPK inhibitor. Our results demonstrated that Compound C markedly decreased adiponectin-induced expression levels of p-AMPK, p-JNK and p-Erk1/2 (Fig. 6A-D), suggesting that AMPK can regulate p-JNK and p-Erk1/2 as upstream signaling pathways. Given that PA could induce NFκB phosphorylation and ROS production (Fig. 6A and Fig. 6E-F) that act as the regulators of NLRP3 inflammasome activation [12], we further assessed the effects of adiponectin and Compound C on PA-mediated NFκB and ROS expression, It was found that adiponectin inhibited PA-mediated NFκB phosphorylation and ROS production in hepatocytes, and Compound C reversed the suppressive effects of adiponectin on PA-mediated NFκB expression and ROS production (Fig. 6F). These findings reveal that adiponectin can suppress PA-mediated NLRP3 inflammasome activation in hepatocytes via AMPK-JNK/Erk1/2-NFκB/ROS signaling pathways.

Accumulating evidence has suggested that adiponectin exerts beneficial effects on hepatic disorders [20, 23], including steatohepatitis and liver fibrosis [26, 27]. However, the potential mechanism responsible for these effects has been not yet fully elucidated. Recently, several studies have shown that adiponectin and adiponectin receptor agonist (adipoRon) exhibit protective effects against diabetes-related vascular disorders or nephropathy by suppressing NLRP3 activation [28, 29]. However, it remains unclear whether adiponectin can affect NLRP3 inflammasome expression in hepatic diseases and its potential underlying mechanism. Therefore, in this study, we explored the effect and potential mechanism of adiponectin on PA-mediated NLRP3 inflammasome activation through both in vitro and in vivo experiments. The in vivo findings revealed that adiponectin deficiency aggravated HFD-induced liver injury and steatosis as well as stimulated NLRP3 inflammasome activation. Meanwhile, in in vitro study, adiponectin treatment suppressed PA-mediated NLRP3 inflammasome activation and ROS production in hepatocytes. To our knowledge, this work for the first time demonstrated that the protective effect of adiponectin against PA-mediated NLRP3 inflammasome activation in hepatocytes was attributed to AMPK-JNK/ErK1/2-NFκB/ROS signaling pathways.

Adiponectin plays important roles in the metabolic functions of adipose tissue, skeletal muscle and liver [30]. Previous studies have shown that the serum levels of adiponectin are reduced in NASH patients [31], and hypoadiponectinemia is negatively associated with steatosis and inflammation in NAFLD patients [32]. Adiponectin-deficient mice exist hepatic excessive steatosis and necroinflammation in a mouse model of nonalcoholic steatohepatitis [20, 23]. Consistent with these findings, our in vivo study also demonstrated that adiponectin deficiency aggravated HFD-induced liver injury, such as elevated serum ALT/AST levels, promoted lipid droplet accumulation and increased ROS production. In addition, it was found that adiponectin deficiency promoted HFD-induced NLRP3 inflammation activation and NFκB expression, and attenuated the phosphorylation levels of AMPK, JNK and Erk1/2. Several studies have indicated that NLRP3 inflammasome can be activated by endotoxin, ROS, uric acid, etc. [16, 33], and adiponectin may prevent the progression of steatohepatitis by regulating oxidative stress [23]. Therefore, we speculated that the aggravating effect of adiponectin deficiency on NLRP3 inflammasome activation was due to the increased ROS production and activated NFκB signaling pathway. The underlying molecular mechanisms were further explored in vitro.

Palmitic acid, a saturated free fatty acid, could induce the expression of NLRP3 inflammasome in liver cells and favor inflammatory responses [7]. The results of in vitro experiments showed that PA stimulated NLRP3 inflammasome activation in hepatocytes, promoted lipid droplet accumulation, increased ROS production, and activated NF-κB signaling. Interestingly, we observed that adiponectin treatment could abolish PA-mediated NLRP3 inflammasome activation and promote the activation of AMPK, JNK and ErK1/2 signaling pathways in hepatocytes. In contrast, AMPK inhibitor reversed the inhibitory effects of adiponectin on NLRP3 inflammasome activation, and suppressed the activation of APMK, JNK and ErK1/2. These data indicate that AMPK activation is necessary for the protection of adiponectin against NLRP3 inflammasome activation. Furthermore, JNK/Erk1/2 are the downstream effectors of adiponectin. It was found that adiponectin decreased PA-mediated ROS generation and attenuated NF-kB signaling, and AMPK inhibitor reversed these effects of adiponectin. Based on our present results and previous findings showing that NLRP3 activation require two signals: the priming signal is mediated by NFκB pathway [16], while the activating signal is associated with ROS generation, K + efflux and the lysosome membrane permeabilization [33–35], we postulated that AMPK-JNK/Erk/-NFκB/ROS pathways are responsible for the inhibition of PA-mediated NLRP3 inflammasome by adiponectin. Although further research is needed to verify these molecular mechanisms, interestingly, in support of our data, similar signal transduction events (APN-AMPK-ROS pathways) were also involved in the therapeutic effects of adiponectin on monocytic THP-1 cells [36].

The findings of the current study revealed the effect of adiponectin on NLRP3 inflammasome and its molecular mechanisms, in which adiponectin inhibited PA-mediated NLRP3 inflammasome activation in hepatocytes. Adiponectin analogs or AMPK agonists could serve as a potential novel agent for preventing or delaying the progression of NASH and NAFLD

APN, adiponectin; APN KO, adiponectin knockout; WT, wild type; PA, palmitic acid; NAFLD, non-alcoholic fatty liver diseases; NASH, non-alcoholic steatohepatitis; AMPK, Adenosine monophosphate-activated protein kinase; Erk1/2, Extracellular signal-regulated kinase1/2; JNK, c-Jun terminal kinase; NF-κB, Nuclear factor kappa B; ROS, reactive oxygen species; AST, aspartate aminotransferase; ALT, alanine aminotransferase; CHOL, cholesterol; TG, total triglyceride; HFD ,high-fat-diet;

Acknowledgements：

The authors would like to express their gratitude to EditSprings (https://www.editsprings.com/) for the expert linguistic services provided.

Authors’ contributions

ZD, XW designed and performed experiments, analyzed data, and wrote the manuscript. ZD, QZ, MN, XY, SW and LL contributed to analysis and interpretation of data and assisted in the preparation of the manuscript. ZD, QZ performed experiments. XW supervised the project and contributed to manuscript development.

Funding

This study was supported by the National Natural Science Foundation of China (Nos. 81500437, 81470904).

Availability of data and materials

All data used to support the finding during this study have been presented in this article.

Ethics approval and consent to participate

This study was approved by Animal Experimentation Ethics Committee of Shanghai Jiao Tong University School of Medicine, and all procedures were performed in accordance with the Guide for the Care and Use of Laboratory Animals and the Regulation of Animal Protection Committee.

Competing of Interest: The authors have no competing interests

Author details

¹Digestive Endoscopic Center, Shanghai JiaoTong University Affiliated Sixth People’s Hospital, Shanghai, China

²Department of Gastroenterology, Shanghai General Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, China

Angulo P: Nonalcoholic fatty liver disease. N Engl J Med 2002, 346:1221-1231.
Tiniakos DG, Vos MB, Brunt EM: Nonalcoholic fatty liver disease: pathology and pathogenesis. Annu Rev Pathol 2010, 5:145-171.
Pagano G, Pacini G, Musso G, Gambino R, Mecca F, Depetris N, Cassader M, David E, Cavallo-Perin P, Rizzetto M: Nonalcoholic steatohepatitis, insulin resistance, and metabolic syndrome: further evidence for an etiologic association. Hepatology 2002, 35:367-372.
Michelotti GA, Machado MV, Diehl AM: NAFLD, NASH and liver cancer. Nat Rev Gastroenterol Hepatol 2013, 10:656-665.
Wong RJ, Cheung R, Ahmed A: Nonalcoholic steatohepatitis is the most rapidly growing indication for liver transplantation in patients with hepatocellular carcinoma in the U.S. Hepatology 2014, 59:2188-2195.
Day CP, James OF: Steatohepatitis: a tale of two "hits"? Gastroenterology 1998, 114:842-845.
Csak T, Ganz M, Pespisa J, Kodys K, Dolganiuc A, Szabo G: Fatty acid and endotoxin activate inflammasomes in mouse hepatocytes that release danger signals to stimulate immune cells. Hepatology 2011, 54:133-144.
Dixon LJ, Berk M, Thapaliya S, Papouchado BG, Feldstein AE: Caspase-1-mediated regulation of fibrogenesis in diet-induced steatohepatitis. Lab Invest 2012, 92:713-723.
Henao-Mejia J, Elinav E, Jin C, Hao L, Mehal WZ, Strowig T, Thaiss CA, Kau AL, Eisenbarth SC, Jurczak MJ, et al: Inflammasome-mediated dysbiosis regulates progression of NAFLD and obesity. Nature 2012, 482:179-185.
Wree A, Eguchi A, McGeough MD, Pena CA, Johnson CD, Canbay A, Hoffman HM, Feldstein AE: NLRP3 inflammasome activation results in hepatocyte pyroptosis, liver inflammation, and fibrosis in mice. Hepatology 2014, 59:898-910.
Martinon F, Burns K, Tschopp J: The inflammasome: a molecular platform triggering activation of inflammatory caspases and processing of proIL-beta. Mol Cell 2002, 10:417-426.
Martinon F, Mayor A, Tschopp J: The inflammasomes: guardians of the body. Annu Rev Immunol 2009, 27:229-265.
van de Veerdonk FL, Netea MG, Dinarello CA, Joosten LA: Inflammasome activation and IL-1beta and IL-18 processing during infection. Trends Immunol 2011, 32:110-116.
Yu HB, Finlay BB: The caspase-1 inflammasome: a pilot of innate immune responses. Cell Host Microbe 2008, 4:198-208.
Rathinam VA, Fitzgerald KA: Inflammasome Complexes: Emerging Mechanisms and Effector Functions. Cell 2016, 165:792-800.
Guo H, Callaway JB, Ting JP: Inflammasomes: mechanism of action, role in disease, and therapeutics. Nat Med 2015, 21:677-687.
He Y, Hara H, Nunez G: Mechanism and Regulation of NLRP3 Inflammasome Activation. Trends Biochem Sci 2016, 41:1012-1021.
Galic S, Oakhill JS, Steinberg GR: Adipose tissue as an endocrine organ. Mol Cell Endocrinol 2010, 316:129-139.
Maeda N, Shimomura I, Kishida K, Nishizawa H, Matsuda M, Nagaretani H, Furuyama N, Kondo H, Takahashi M, Arita Y, et al: Diet-induced insulin resistance in mice lacking adiponectin/ACRP30. Nat Med 2002, 8:731-737.
Kamada Y, Tamura S, Kiso S, Matsumoto H, Saji Y, Yoshida Y, Fukui K, Maeda N, Nishizawa H, Nagaretani H, et al: Enhanced carbon tetrachloride-induced liver fibrosis in mice lacking adiponectin. Gastroenterology 2003, 125:1796-1807.
Masaki T, Chiba S, Tatsukawa H, Yasuda T, Noguchi H, Seike M, Yoshimatsu H: Adiponectin protects LPS-induced liver injury through modulation of TNF-alpha in KK-Ay obese mice. Hepatology 2004, 40:177-184.
Hui JM, Hodge A, Farrell GC, Kench JG, Kriketos A, George J: Beyond insulin resistance in NASH: TNF-alpha or adiponectin? Hepatology 2004, 40:46-54.
Fukushima J, Kamada Y, Matsumoto H, Yoshida Y, Ezaki H, Takemura T, Saji Y, Igura T, Tsutsui S, Kihara S, et al: Adiponectin prevents progression of steatohepatitis in mice by regulating oxidative stress and Kupffer cell phenotype polarization. Hepatol Res 2009, 39:724-738.
Alonso CR, George J, Pesce CG, Bissell DM, Kornblihtt AR: Fibronectin transcription in liver cells: promoter occupation and function in sinusoidal endothelial cells and hepatocytes. Biochem Biophys Res Commun 2002, 295:1077-1084.
Combs TP, Wagner JA, Berger J, Doebber T, Wang WJ, Zhang BB, Tanen M, Berg AH, O'Rahilly S, Savage DB, et al: Induction of adipocyte complement-related protein of 30 kilodaltons by PPARgamma agonists: a potential mechanism of insulin sensitization. Endocrinology 2002, 143:998-1007.
Dong Z, Su L, Esmaili S, Iseli TJ, Ramezani-Moghadam M, Hu L, Xu A, George J, Wang J: Adiponectin attenuates liver fibrosis by inducing nitric oxide production of hepatic stellate cells. J Mol Med (Berl) 2015, 93:1327-1339.
G DIM, Pastore M, Marra F: Liver fibrosis in the context of nonalcoholic steatohepatitis: the role of adipokines. Minerva Gastroenterol Dietol 2018, 64:39-50.
Zhang J, Xia L, Zhang F, Zhu D, Xin C, Wang H, Zhang F, Guo X, Lee Y, Zhang L, et al: A novel mechanism of diabetic vascular endothelial dysfunction: Hypoadiponectinemia-induced NLRP3 inflammasome activation. Biochim Biophys Acta Mol Basis Dis 2017, 1863:1556-1567.
Zhang YZ, Zhang YL, Huang Q, Huang C, Jiang ZL, Cai F, Shen JF: AdipoRon Alleviates Free Fatty Acid-Induced Myocardial Cell Injury Via Suppressing Nlrp3 Inflammasome Activation. Diabetes Metab Syndr Obes 2019, 12:2165-2179.
Lee B, Shao J: Adiponectin and energy homeostasis. Rev Endocr Metab Disord 2014, 15:149-156.
Lemoine M, Ratziu V, Kim M, Maachi M, Wendum D, Paye F, Bastard JP, Poupon R, Housset C, Capeau J, Serfaty L: Serum adipokine levels predictive of liver injury in non-alcoholic fatty liver disease. Liver Int 2009, 29:1431-1438.
Savvidou S, Hytiroglou P, Orfanou-Koumerkeridou H, Panderis A, Frantzoulis P, Goulis J: Low serum adiponectin levels are predictive of advanced hepatic fibrosis in patients with NAFLD. J Clin Gastroenterol 2009, 43:765-772.
Lamkanfi M: Emerging inflammasome effector mechanisms. Nat Rev Immunol 2011, 11:213-220.
Mariathasan S, Weiss DS, Newton K, McBride J, O'Rourke K, Roose-Girma M, Lee WP, Weinrauch Y, Monack DM, Dixit VM: Cryopyrin activates the inflammasome in response to toxins and ATP. Nature 2006, 440:228-232.
Zhou R, Yazdi AS, Menu P, Tschopp J: A role for mitochondria in NLRP3 inflammasome activation. Nature 2011, 469:221-225.
Wang F, Liu Y, Yang W, Yuan J, Mo Z: Adiponectin inhibits NLRP3 inflammasome by modulating the AMPK-ROS pathway. Int J Clin Exp Pathol 2018, 11:3338-3347.

Download PDF

Version 1

posted

You are reading this latest preprint version

Adiponectin inhibits palmitic acid-induced NLRP3 inflammasome activation in hepatocytes through AMPK-JNK/ErK1/2-NFκB/ROS signaling pathways

Status:

Version 1

Abstract

Figures

Background:

Materials And Methods

Results:

Discussion

Conclusion

Abbreviations

Declarations

References

Status:

Version 1