Chemicals
MPP+, MPTP, Vanillin, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT), L-DOPA, 2-7-diacetyl dichlorofluorescein (DCFH-DA), Dulbecco's modified Eagle's medium (DMEM), EDTA, and Trypsin-EDTA were procured from Sigma Chemicals Co. (St. Louis, USA). Antibiotic/antimycotic purchase from Hi-media. Fetal bovine serum (FBS) was obtained from Gibco. Acridine orange was obtained from SRL and Propidium was iodide obtained from life technologies. Mitochondrial Membrane Potential Assay Kit (JC-1) was obtained from Abbkine. Anti-TH was obtained from Novus biologicals and Anti-NeuN antibody from Abcam. Goat anti-rabbit Alexa fluor-488 conjugated antibody (1:1000 dilution, ab150077, Abcam, USA).
In-vitro study
Cell Culture and Maintenance
Human neuroblastoma SH-SY5Y cells were obtained from American Type Culture Collection (ATCC # CRL-2266). The cells of passage number 9-10 were maintained in Dulbecco's Modified Eagle Medium (DMEM) (Sigma Chemicals Co., USA) supplemented with 10% fetal bovine serum (FBS) (Gibco Life Technologies, USA) and 1% antibiotic/antimycotic solution (HIMEDIA). Cultures were kept at 37 °C in a humidified incubator in an atmosphere of 5% CO2 and 95% air. Every two days, the cell culture media was replaced and the cells were sub-cultured when they reached 80-90 percent confluency. A maximum number of 14 passages were used in the present study.
Analysis of cellular morphology
SH-SY5Y cells were seeded in 6-well plates at a density of 1x105 cells per well. The cells were incubated for 24h and then differentiated by adding 10µM all-trans-retinoic acid (RA), dissolved in DMEM supplemented with 1% heat-inactivated FBS and incubated in the dark for 7 days at 37 ºC with 5% CO2 in an incubator. The RA-treated media were replaced every 2 day for 7 days, and morphological changes were visualized under a phase-contrast microscope (Eclipse Ti-E, Nikon) to monitor the differentiation and to measure the neurite length of undifferentiated and differentiated SH-SY5Y cells. Those cells whose cell body diameters were longer than twice the cell body diameter were considered neurite-bearing cells.
Cell viability assay
Cell viability was measured by the MTT assay as previously described by (Kumar et al., 2017). Cells were seeded in 96-well plates (1 x 104cells/well) and cultured in a complete tissue culture medium for 24h. Cells were treated with the graded concentrations of MPP+ (100μm-1.5mM) and Van (10μm-350μm) for 24h. Following treatment, 20μl MTT stock solution (5mg/ml) was added to the cells and incubated for 4h. MTT solution was removed from the cells and the remaining MTT formazan crystals were dissolved by adding 100μl DMSO to each well. The intensity of colour was measured in a microtiter plate reader at 570 nm and 650 nm. Values were expressed as a percentage of control. 1mM of MPP+ were selected for the in-vitro experiments based on our MTT results and previous studies (de Oliveira et al., 2017) and 250μm of Van was selected for further experiments based on our MTT results. A similar procedure was followed to determine the effect of Van against MPP+-induced cellular toxicity. Cells were incubated to MPP+ (1mM), Van (250μm) and MPP+ (1mM) +Van (250μm).
Measurement of Intracellular ROS
The levels of endogenous ROS production in control and treated cells were determined by using the fluorescent dye DCFH-DA (Sigma Aldrich, USA). When it enters the cells, DCFH-DA is deacetylated by cellular esterase to non-fluorescent 2', 7'-dichlorodihydrofluorescin (DCFH), which intracellular ROS rapidly oxidises into the fluorescent 2',7'- dichlorofluorescein (DCF). The intensity of the DCF was used as a proxy for overall ROS production. Briefly, SH-SY5Y cells were seeded (5 x 105 cells/well) in 24-well tissue culture plates and incubated for 24h in a 5% CO2 incubator maintained at 37 °C. Cells were exposed to MPP+ (1mM) Van (250μM) and MPP++Van concentrations at 37 °C for 24h. The cells were treated with 10μM DCFH-DA and incubated in the dark for 30 minutes after the treatment. After incubation, cells were washed twice with PBS to remove excess probe before being suspended in Phosphate-buffered saline (PBS) and examined under a fluorescent microscope (Eclipse Ti-E, Nikon) at 20X magnification. The values are represented as the mean fluorescence intensity relative to the control wells.
Measurement of mitochondrial membrane potential (ΔΨm)
The fluorescence intensity of cells stained with the JC-1 dye was used to evaluate ΔΨm as per the instructions given in the kit. Briefly, SH-SY5Y cells were seeded in 24-well plates (0.05 x 106) incubated in a CO2 incubator at 37 °C for 24h before treatment. Cells were exposed to MPP+ (1mM), Van (250μM) and MPP++Van. Following treatment, JC-1 staining solution was added to each well and incubated at 37 °C for 15-30 minutes in the dark. After incubation, cells were washed twice with PBS and resuspended in a pre-warm DMEM medium. Cells were visualized under a fluorescent microscope (Eclipse Ti-E, Nikon) at 10X magnification. ΔΨm was calculated by the ratio of the aggregated red JC-1 dimers and the green JC-1 monomers.
Acridine orange/propidium iodide (AO/PI) double staining for assessment of cellular morphology
Approximately 2 × 105 cells/mL of SH-SY5Y were seeded into a 6-well plate and allowed to attach. Then, 24h after seeding, the cells were differentiated with RA (10μM) for 7 days before the treatment. The differentiated cells were treated with MPP+ (1mM), Van (250μM) and MPP++Van for 24h. The cells were then trypsinized, 10μL of the cell suspension was mixed with 10μL of AO (50μg/mL) and PI (50μg/mL) and placed on a glass slide. Cells were visualized under a fluorescent microscope (Eclipse Ti-E, Nikon) at 20X magnification for morphological analysis.
Analysis of mRNA through qRT-PCR
The mRNA expressions were determined according to our previously adopted procedure 22. According to the manufacturer's instructions, total mRNA was extracted from SH-SY5Y cells using the GeneJET RNA Purification kit (ThermoFisher Scientific). Optical density measurements determined the quantity and purity of RNA at A260/A280 ratio with 1.8 or above using Nanodrop 2000 spectrophotometer (Thermo Fisher Scientific Inc., Wilmington, DE, USA). According to the manufacturer's instructions, the cDNA was synthesized from 1 μg of RNA using Verso cDNA synthesis kit (ThermoFisher Scientific) and stored at −20°C until assay. PowerUp™ SYBR™ Green Master Mix (Thermo Fisher Scientific) was used for real-time PCR quantification. The 20 μL real-time PCR reaction mixture contained 20 ng cDNA template, 10μL of SYBER GREEN master mix, 0.5 μL of forward and reverse primers and PCR-grade water. GAPDH was used as a reference gene. The sequences of the primers for the RT-PCR were as follows:
Gsk-3β FP- GCTTCAACCCCCACAAATGC
RP- CCAAAACGTGACCAGTGTTGC
PARP-1: FP - GGCGATCTTGGACCGAGTAG
RP - CCTTTGGGGTTACCCACTCC
P53: FP -TGACACGCTTCCCTGGATTG
RP – GCTCGACGCTAGGATCTGAC
Bax: FP - GCCCTTTTGCTTCAGGGTTT
RP- CATCCTCTGCAGCTCCATGT
Bcl-2: FP - CTTTGAGTTCGGTGGGGTCA
RP – GGGCCGTACAGTTCCACAAA
Caspase 3: FP - TGGAACCAAAGATCATACATGGAA
RP - TTCCCTGAGGTTTGCTGCAT
GAPDH: FP - AATGGGCAGCCGTTAGGAAA
RP – GCGCCCAATACGACCAAATC
Gene expression analysis was performed with 7500 Fast Real-time system (Applied Biosystems) and conditions for the reaction involved 40 cycles in a fixed sequence of 95 °C for 30 s, 62 °C for 15 s and 72 °C for 15 s. Gene expression was normalized using GAPDH as a reference control gene. Software used for analysis was 7500 Software v2.0.5 (Applied Biosystems).
Western blot
Protein expression was done as per our previous procedure 23. Following SDS-PAGE on 12% acrylamide gel, 50 µg proteins were resolved and transferred onto the PVDF membrane. Blots were then placed into the blocking solution (5% non-fat milk powder (w/v) in wash buffer) for 1h at room temperature rinsed briefly with wash buffer. Blot was incubated with the primary antibody (TH, 1:1000 dilutions, Novus Biologicals) diluted in the wash buffer at 4 °C for overnight. Blot was washed extensively in wash buffer (3 × 5 minutes) with gentle agitation. Anti-rabbit HRP-conjugated secondary antibody (CST) diluted (1:1000) in wash buffer was added and incubated for 1h at room temperature with gentle agitation. The membrane was washed with gentle agitation for 3-5 minutes in wash buffer. Protein bands were visualized by ECL methods and developed in X-ray film to detect protein signals. Target protein expression was quantified by densitometry using ImageJ software and was normalized using β-actin as an internal control. Data are represented as relative expression of target protein in MPP+, Van and MPP++Van treated group to the control group.
In-vivo study
Animals and diet:
C57BL/6 mice (25-30 g; 10-12 weeks old) were under the standard laboratory conditions at an ambient temperature at 21±2°C and 55% humidity, under a constant l2h light/dark cycle and free access to a standard rodent pellet diet and filtered water ad libitum. All the animal experiments were approved by the Central Laboratory Animal Resource (CLAR), JNU, New Delhi, India. Animals were acclimatized for 1 week before initiating the experimental protocol. Before the experiment, mice were trained on all behavioural equipment to attain ceiling performance. Fig. 8A shows the timeline of the treatments and experimentations.
Induction of experimental parkinsonism in mice
Parkinsonism was induced by i.p. injection of MPTP (20 mg/kg) once a day for 5 consecutive days. Pharmacological treatment started after the last MPTP injection for 21days.
Experimental protocol
Adult male C57BL/6 mice were randomized and divided into five groups of 12 animals each. Group 1(Control): Received normal saline (i.p.) used as a vehicle. Group 2 (MPTP): MPTP was administered i.p. injection once a day for 5 consecutive days 24. Group 3 (Van): Received Van (60 mg/kg body weight, p.o.) dissolved in normal saline daily for 21 days. Group 4 (MPTP +Van): Received i.p. injection once a day for 5 consecutive days, followed by Van (60 mg/kg body weight, p.o.) daily for 21 days. Group 5 (MPTP+L-DOPA): Received i.p. injection once a day for 5 consecutive days, followed by L-DOPA (5 mg/kg body weight, p.o.) daily for 21 days.
Assessment of Motor Behaviour
Motor functions were examined at the end of the experiment.
Pole test
The pole test is a valuable method for identifying the degree of bradykinesia in the PD mouse model (Ogawa et al., 1985). To prevent mice from slipping, they were placed head down on a vertical wooden pole wrapped in gauze (diameter 8 mm, height 50 cm). The time was calculated as they climbed down with all four feet on the floor.
Narrow beam test
Pre-trained animals were allowed to walk on a narrow, flat, fixed wooden beam (length 100 cm, width 1 cm) set at the height of 100 cm from the ground as per our previous protocol 25. The average time taken to cross the beam from one end to the platform, along with foot slip errors was measured.
Tissue processing
After the functional assessment, experimental mice were anesthetized by i.p. thiopentone sodium (100 mg/kg body weight) and sacrificed by decapitation. The striatum and SNpc tissues were carefully dissected from mice brains using the bregma as a reference landmark26. The isolated samples were subjected to flash freezing in liquid nitrogen and stored at -80 °C until further analysis.
Histopathology of mice brain
Histopathology was performed as per the previously described method 27. The mice were anaesthetized. After fixation, tissues were cut into 10μm thick sections using a cryotome. Striatal sections of the brain were stained with Hematoxylin-Eosin (H&E) stain. The prepared slides were observed under the light microscope (Nikon 80i) for neuroanatomical details. Four animals were used in each group. Eight sections of the striatum in each mouse were considered for analysis (32 sections in each group; n = 4).
Biochemical estimations
Tissue homogenization and preparation of post mitochondrial supernatant:
All biochemical experiments were performed on six experimental mice in each group. Tissue homogenates were prepared by homogenizing tissue samples in ice-cold 0.1 M sodium phosphate buffer at pH 7.4 to make a 10% tissue homogenate. The procedure was carried out using a homogenizer with 8-10 strokes at a medium speed while the samples were always maintained on the ice. The homogenates were then centrifuged at 4 °C at 15,000 rpm for 20 min to yield 10% post mitochondrial supernatant (PMS), subsequently stored at -20 °C for further analysis.
Protein estimation
The Bradford et al. method was used to determine the amount of protein in the brain tissues. Bovine serum albumin (BSA) was used as a reference standard 28.
Estimation of superoxide dismutase (SOD) activity
SOD activity was estimated based on our previous method 29. In brief, a pre-mixture was created by mixing 15μl of 10% PMS with 3μl of 12.5% Triton-X-100. The pre-mixture was incubated at 4°C for 30 minutes. Following incubation, 15μl of the pre-mixture was dissolved in 750μl of 0.1 M phosphate buffer,593.5μl of double-distilled water, 49.5μl of 3 mM EDTA (pH 8) and 90μl of pyrogallol (1,2,3-trihydroxy benzene). The pyrogallol solution was made by dissolving 10.2 mg of pyrogallol in 10 ml of double-distilled water and adding 8.6μl of hydrochloric acid. The resultant solution was gently mixed, and absorbance was measured kinetically at 420 nm in a spectrophotometer (Agilent Technologies' Cary 60 UV–Vis) at 1-minute intervals for a total of 3 minutes. SOD activity in each sample was measured in millimoles of pyrogallol protected from oxidation per minute per milligram protein.
Estimation of catalase activity
Catalase (CAT) activity was measured based on the method described by Fatima et al 30. 500μl of 0.05 M hydrogen peroxide (H2O2) was dissolved in a mixture comprising 25μl of 10% PMS and 975μl of 0.1 M phosphate buffer (pH 7.4) to prepare the reaction mixture. The resultant reaction mixture was gently agitated and absorbance was kinetically measured at 240nm every 1 minute for a total of 3 minutes. CAT activity was calculated as millimoles of H2O2 used per minute per milligram of protein in each sample.
Estimation of Lipid Peroxidation (LPO)
LPO was determined by using our previously adopted method 31. Briefly, 88μl of 10% PMS was mixed with 10μl of 10mM butylated hydroxytoluene (BHT), and 350μl of 0.67 percent thiobarbituric acid (TBA). After vortexing, 1ml of 1% orthophosphoric acid (OPA) was added. The resultant mixture was incubated at 95 °C for 45min in boiling water. The boiling tubes were removed and cooled at room temperature. The absorbance of each aliquot was measured at 535nm. The rate of lipid peroxidation was expressed as nanomoles of thiobarbituric acid reactive substance (TBARS) produced per hour per gram tissue.
Estimation of Reduced Glutathione (GSH) Levels
GSH levels determined by our previously adopted method 30 was used to assess tissue GSH levels; this approach uses Ellman's reagent [5,5′-dithiobis-(2-nitrobenzoic acid)] to colorimetrically estimate GSH levels as total 'acid soluble sulfhydryl' concentrations. Briefly, 10% PMS was precipitated with 4% sulphosalicylic acid in the ratio of 1:1. The samples were kept at 4°C for 1h and subjected to centrifugation at 5000 rpm for 15 minutes at 4°C. 200μl of the resulting supernatant was mixed with 1.1 ml of 0.1 M phosphate buffer (pH 7.4). Finally, 200μl Ellman's reagent (10mM) was added, and the reaction mixture was gently stirred. The optical density of the reaction product was read immediately at 412nm and results were expressed as micromoles of GSH per gram tissue in each sample.
Immunohistochemistry
Thiopentone sodium (150 mg/kg body weight, i.p.) was used to anaesthetize experimental mice in each group. The mice were then perfused transcardially with normal saline, followed by a fixative containing 4% paraformaldehyde (PFA) in PBS (0.1M, pH 7.4). After fixation, tissues were cut into 20μm thick sections using a cryotome, then mounted on 1% gelatin-coated glass slides and processed for immunostaining. Tissue sections were incubated with 5% BSA in PBS for 1h in a humid chamber, followed by overnight incubation with anti-TH antibody (Novus biological, Rabbit anti-TH, 1:1000 dilutions). The next day, tissue sections were washed in PBS 3x (5 min each), followed by incubation with secondary antibody (ab150077, Goat polyclonal Secondary Antibody to Rabbit IgG-H & L (1:1000, Alexa Fluor® 488 conjugated, Abcam, USA) for 2h at room temperature. The tissue sections were counterstained with DAPI for 30 minutes. Following this, the sections were mounted on rectangular glass slides and visualised under a fluorescent microscope (Eclipse Ti-E, Nikon) at 10X magnification. In each experimental group, four animals were used.
For 3,3‐diaminobenzidine‐4 HCL (DAB) staining, the sections were thawed at 60 °C in a hot air oven for 20 min and then incubated at room temperature for 1 hr. After incubation, tissue sections were washed in PBS 3x (5 min each) followed by blocking with endogenous peroxidase (3% H2O2 in 100% methanol) for 5-7 min. Tissues were rinsed again with PBS (3x, 5 min each) and blocked with 10% Normal Goat Serum (NGS). Sections were then incubated in the primary antibody (Novus biological, Rabbit anti-TH, 1:500dilution) in 5% NGS blocking buffer overnight at 4°C. After incubation with the primary antibody, sections were rinsed again, and placed in secondary antibody (Vector Laboratories anti‐rabbit biotinylated secondary antibody cat#PK‐4001 dilution 1:200) in 1% NGS blocking buffer for overnight at 4°C. After rinsing, sections were incubated in avidin‐biotinylated horseradish peroxidase (ABC Kit, Vector Laboratories) in PBS for 30 min, rinsed, and developed with DAB (DAB peroxidase substrate kit, SK‐4100, Vector Laboratories) in 0.05M tris buffer (pH7.6). Slides were allowed to dry for 1h at room temperature, dehydrated, and mounted with DPX mounting medium and visualised under a microscope (Nikon 80i).
Statistical analysis
An observer blinded to the study design and treatment condition throughout the experiment performed all behavioural scoring examinations of the histopathological characteristics. GraphPad Prism software version 7 was used to conduct the statistical analysis (GraphPad Software, USA). All of the data presented as a mean ± SEM. To assess the significant differences between the control, MPTP, Van, MPTP+Van and MPTP+L-DOPA groups, a one-way analysis of variance (ANOVA) were used, followed by a Tukey test that assumes the data has a normal distribution. *p<0.05, **p <0.01, and ***p <0.001 were used to signify significant differences when compared to the control, and #p <0.05, ##p <0.01, and ###p <0.001 when compared to the MPP+/MPTP groups.