Melatonin reverted apoptosis induced by chicken house PM2.5 in A549 cell via oxidation resistance

doi:10.21203/rs.3.rs-1722882/v1

Download PDF

Research Article

Melatonin reverted apoptosis induced by chicken house PM_2.5 in A549 cell via oxidation resistance

https://doi.org/10.21203/rs.3.rs-1722882/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

The particulate matter 2.5 (PM_2.5) from the chicken production system attaching large amounts of harmful substances and microbes, can cause lung injury and reduce productivity through prolonged breath. Here, the basal epithelial cell of human lung adenocarcinoma (A549 cell) were subjected to PM_2.5 from the broiler breeding house to investigate the apoptosis induced by PM_2.5 as well as the anti-apoptotic effect of melatonin. The data showed that PM_2.5 (6.25, 12.5, and 25 μg/ml) increased the number of apoptotic cells substantially. The relative mRNA expression of Bcl-2, Bad, Bax, PERK and CHOP increased dramatically in PM_2.5 treated groups. Furthermore, PM_2.5 exposure upregulated the level of cleaved caspase-9 and cleaved caspase-3 as well as the endoplasmic reticulum stress (ERS) related protein including ATF6 and CHOP. Melatonin increased the viability of A549 cells and declined the relative mRNA expression of Bcl-2, Bax, Bad, cleaved caspase-3, cleaved caspase-9 in comparison with that exposed to PM_2.5. Importantly, melatonin decreased the level of Nrf2, MDA, and enhanced the intracellular content of T-SOD and CAT after treatment by PM_2.5. Collectively, our study proved that PM_2.5 from chicken house induced A549 cell apoptosis, and melatonin exerted an anti-apoptotic role on A549 cells by enhancing their antioxidative ability.

Particulate matter 2.5

Broiler breeding house

Cell survival

Endoplasmic reticulum stress

Oxidative stress

During animal production, a large scale of particulate matters (PM) was generated, the source of which included feed, feces, animal dander, skin feathers, urine, and padding (Honey and McQuitty, 1979, Liu et al., 2015, Qi, Manbeck and Maghirang, 1992). The components of PM from the animal houses included organic compounds, elements, and ions including NH₄⁺, NO₃⁻, SO₄²⁻ etc. (Cambra-Lopez et al., 2011, Shen et al., 2018). Moreover, bacteria, fungi, viruses as well as endotoxin, ammonia, and hydrogen sulfide were also attached to the surface of PM (Dai et al., 2020, Donham et al., 1986, Mostafa et al., 2016). The exposure in poultry houses with high PM concentration for a long time was prone to suffer from respiratory diseases, asthma, and chronic obstructive pulmonary diseases, and seriously affected the health of animals and people as well as reduced the production efficiency of poultry (Al Homidan and Robertson, 2003, Cambra-Lopez et al., 2010, Sabino et al., 2012). Our latest research highlighted the systemic exposure of PM induced lung inflammation, microbial and metabolic disorder in broilers(Shen et al., 2022).

Studies have demonstrated that the particle size less than 2.5 µm (PM_2.5) can cause oxidative stress, inflammatory response as well as genotoxicity in the lung (Cho et al., 2018). Epidemiological investigations have shown that particle size less than 2.5 µm (PM_2.5) increased the susceptibility to pulmonary infection, chronic obstructive pulmonary disease, and bronchial asthma (Atkinson et al., 2015, Davidson, Phalen and Solomon, 2005). Researches have investigated the concentration proportion of PM_2.5 in the chicken house. Kilmont and Amann estimated that the proportion of particle size less than 10 µm (PM₁₀) and PM_2.5 from poultry production systems are 57% and 50% of emissions to the atmosphere from animal housing in the UK, which indirectly confirmed that more inhalable particles were released from poultry house compare with other animal house (Klimont and Amann, 2002). Our previous study also indicated that the proportion of PM_2.5/total suspended particles (TSP) and PM_2.5/PM₁₀ were 20% and 50% respectively (Shen, et al., 2018). The accumulated evidence indicated that PM_2.5 accounted for a certain proportion of particulate matter in the chicken house, and its potential impact on the respiratory tract caused by long-term exposure cannot be ignored.

Excessive apoptosis can be caused by mechanical force, ray, ischemia, hypoxia, cholesterol, drugs, biological toxins such as endotoxin(MacFarlane and Williams, 2004). The accumulated evidence indicated that abnormal apoptosis was related to lung diseases closely. The patients with diffuse alveolar damage exhibited upregulation of Bax and Bcl-2 in alveolar pneumocytes(Matute-Bello and Martin, 2016). Another study indicated that the apoptosis of type II pneumocytes is partly responsible for the disappearance of these cells in patients with acute lung injury in the early phase(Li et al., 2004). Basal epithelial cells of human lung adenocarcinoma (A549 cell) widely served as the model of type II alveolar epithelial cell which mainly functioned in maintaining alveolar integrity and resisting the invasion of pathogens (Barkauskas et al., 2013). Our previous research has demonstrated that PM_2.5 from chicken house induced inflammation in A549 cells. Furthermore, few studies have shown that PM_2.5 from the atmosphere triggered apoptosis in A549 cells, importantly, the sources and the composition of PM_2.5 in the chicken houses were different from that in the atmosphere, therefore, the discrepant biological effects imposed by PM_2.5 was indicated.

N-acetyl-5-methoxytryptamine (melatonin) functioned as a regulator in the sleep/wake cycle and other circadian and seasonal rhythms (Siah, Wong and Ho, 2014). Additionally, melatonin played a role in anti-oxidation, anti-inflammation, and anti-apoptosis (Chen et al., 2015, Li et al., 2014, Zhang and Zhang, 2014). Melatonin resisted oxidation not only by scavenging reactive oxygen species (ROS) directly but also upregulating several antioxidant enzymes (Carmen et al., 2010). Melatonin inhibited cell apoptosis primarily through activating the expression of genes related to anti-apoptosis, as well as PI3K/AKT and ERK1/2 signal pathway, and declining cellular ROS content (Luchetti et al., 2009, Vriend and Reiter, 2015, Wang, 2009). In addition, some studies listed as follows have shown that melatonin contributed to animal production. Melatonin can promote ewe in estrus earlier(Sawalha et al., 2011); increase the laying quantity of layers (Jia et al., 2016); improve the daily gain of broilers and pigs (Akbarian et al., 2014, Ayles et al., 1999) and facilitate cashmere growth via Wnt signaling pathways(Zhang et al., 2021). However, the issue on whether melatonin relieves lung damage in animal production remains elusive. Our earlier research indicated the concentration of PM_2.5 from chicken houses exceeded the annual average concentration of PM_2.5 from the atmosphere. The composition of PM_2.5 in the chicken houses included organic carbons, ions, and endotoxin, as well as a large number of harmful bacteria and fungi (Dai, et al., 2020). In this study, we focused on the apoptosis induced by chicken house PM_2.5 in A549 cells and further investigated the alleviating effect of melatonin on apoptosis in A549 cells.

PM_2.5 sampling and extraction

The chicken house for PM_2.5 sampling, the season, the chicken ages in house, and the PM_2.5 extraction methods were consistent with our previous studies (Dai, et al., 2020, Dai et al., 2019). Briefly, the PM_2.5 in the chicken house was collected on filter membrane (Whatman USA), by BTPM-HS1 atmosphere particles sampler (Dandong Baxter Co., Ltd. Dandong Liaoning China). The PM_2.5 on filter membranes were oscillated into deionized water and then filtered with six layers of gauze before centrifugation. After drying, the PM_2.5 was dissolved into saline and then sterilized before being stocked at − 20℃.

Cell culture and treatment

A549 cell line (ATCC, USA) was employed in this experiment and was cultured in F12 medium (Gibco, USA) supplemented with 10% fetal serum (BI, Israel) and 0.5% penicillin-streptomycin-amphotericin B solution (Sigma, USA). Cells were kept at 37 ℃ constantly with 5% CO₂ and the humidity of the incubator was maintained by the water tray in the bottom. The primary components of PM_2.5 included organic carbon, element carbon, NO₃⁻, NH₄⁺, SO₄²⁻, Cl⁻, Ca²⁺, K⁺, Na⁺, F⁻ and endotoxin (Dai, et al., 2020). The PM_2.5 (1mg/ml) and the stocked melatonin (10mmol/ml) (MedchemExpress, NJ, USA) were diluted by the medium at different concentrations (6.25 µg/ml, 12.5 µg/ml, 25 µg/ml for PM_2.5, and 0, 12.5 µmol, 25 µmol, 50 µmol, 100 µmol, 200 µmol, 400 µmol, 800 µmol, 1600 µmol, and 3200 µmol for melatonin) and the cells were treated after the confluence reached 80%. In cell cycle, cell apoptosis, transmission electron microscope (TEM), RT-PCR, and Western blot assays, the cells were cultured into a 6-cell plate, and then exposed to PM_2.5 or melatonin; as for MTT assay, the cells were detached into a 96-cell plate and then treated by PM_2.5 or melatonin.

The detection of cell cycle and cell apoptosis

For cell cycle, A549 cells were washed by ice-cold PBS three times after being digested by trypsin (Gibco, USA). Then the cells were fixed with 70% ethanol for 8 hours and stained with PI (Vazyme Biotech) for 10 min in dark. In cell apoptosis, cells were detached with trypsin excluded EDTA (Gibco, USA), and washed with ice-cold PBS for three times. Cells were centrifuged at 300 g, 4 ℃ for 5 min, and then stained with 5 µl Annexin V-FITC and 5 µl PI (Vazyme Biotech Co. Ltd., Nanjing, China) for 10 min in dark. Each sample was added with 400 µl 1 × binding buffer before detection. Cell cycle and cell apoptosis were determined by flow cytometry (BD, USA).

Transmission electron microscopy (TEM)

The cells were collected and then washed by PBS three times. A549 cells were fixed with 4% glutaraldehyde at 4°C for 72 h, then the cells were rinsed again by PBS and refixed with 1% osmium tetroxide for 30 min at room temperature. The following steps proceeding based on the procedure described by Winey et al(Winey et al., 2014).

The total RNA extraction and real-time PCR

A549 cells were lysed with TRIzol® reagent (Takara, Japan). RNA was extracted by chloroform (Jian Cheng) and isopropanol (Jian Cheng), and the RNA was washed with 75% ethanol (Jian Cheng) two times. The purity and concentration of RNA were detected by NanoDrop® ND-1000 (Thermo). RNA integrity was detected by 0.4% agarose gel electrophoresis. The reverse transcription was performed by the SuperScript (SS) First-Strand Synthesis System (Takara). The real-time PCR (RT-PCR) was conducted on the Applied Biosystem StepOneM Real-Time PCR system (ABI, USA) using SYBR Green Master Mix (Takara). The RT-PCR procedure was as follows: 95 °C for 30 s, 95 °C for 5 s and 34 s at 60°C for 40 cycles, and then 95°C for 15 s, 60°C for 1min, and 95°C for 15 s. The product specificity was determined by melting curve analysis. Every gene in each sample was detected three times. The data processing was performed by the ΔΔCt method (Pfaffl, 2001). The gene primers are shown in Table 1.

Table 1

The sequences of gene primers
Gene	The Sequence of Primers	Gene	The Sequence of Primers
Bad	F: GATCGGGCTTGGGGTGAGAC R: TCATCTGTCTGCCGGGTCTG	CHOP	F: TTCACCACTCTTGACCCTGC R: TTCCTGCTTGAGCCGTTCAT
Bax	F: AGAAGCTGAGCGAGTGTCTC R: CGGAAAAAGACCTCTCGGGG	β-actin	F: GATCTTCATTGTGCTGGGTG R: GGGAAATCGTGCGTGACATT
Bcl-2	F: CTTTGAGTTCGGTGGGGTCA R: GGGCCGTACAGTTCCACAAA
PERK	F: GCCAATGAGAGAGCAAACGC R: ATCTCGGACATCGCCCATTG

Western blot assays

Cells were lysed with cell lysis buffer containing 1% PMSF (Solarbio, Co., Ltd, Beijing, China). The protein concentration was detected by the BCA protein concentration detection commercial kit (Sigma). The protein was degenerated by boiling for 5 min after mixing with loading buffer (Beyotime Biotech, Co., Ltd, Shanghai, China). 12% agarose gels were used for protein electrophoresis at 140 V for 55 min, and then the transferring process was performed at 90 v for 70 min. The protein was blocked by 5% bovine serum albumin for 2 h, then incubated with antibody overnight at 4°C. The primary antibody included glucose regulating protein (GRP78) (CST, MA, Danvers, USA), C/EBP-homologous protein (CHOP) (CST), activating transcription factor 6 (ATF6) (CST), cleaved caspase-3 (CST), cleaved caspase-9 (CST) and NF-E2-related factor 2 (Nrf2) (CST). The second antibody includes HRP-conjugated anti-rabbit or mouse IgG (Biosharp, Suzhou, China). β-actin (CST) was used as the internal control.

The detection of cell viability

The A549 cells were cultured in the 96-cell plate for 24 h and then treated with melatonin at different concentrations (0, 12.5 µmol, 25 µmol, 50 µmol, 100 µmol, 200 µmol, 400 µmol, 800 µmol, 1600 µmol, and 3200 µmol). After 12 h, the supernatant was discarded and added 100 µl methyl thiazolyl tetrazolium (MTT) (Jian Cheng Co., Ltd, Nanjing, China) for another 4 h. Then, discarding MTT, the cells were incubated with 150 µl dimethyl sulfoxide (DMSO) per well for 15 min at room temperature. The absorbance was detected by microplate reader (Thermo Scientific, USA).

The detection of T- SOD, CAT, and MDA

The cellular supernatant was collected and centrifuged at 3000 rpm for 10 min to detect the oxidative stress indicators. The activity of total superoxide dismutase (T-SOD), catalase (CAT), and malondialdehyde (MDA) were detected by the xanthine oxidase method, ammonium molybdate colorimetry method, and thiobarbituric acid method respectively, using the commercial kit (Jian Cheng) and basing on the manufacturer guidelines.

Statistical analysis

The data were analyzed by GraphPad Prism 7.0 (GraphPad Software, CA, USA), and the data were shown as means ± standard deviation (SD) depending on at least three independent experiments. The difference between the two groups was performed by t-test (in Fig. 5B, 6B and 7B. One-way ANOVA performed with Tukey test was adopted in comparisons more than two groups either between the control group and treated group or between any two column means. p < 0.05 represents a significant difference between the two groups.

The effects of PM_2.5 on the cell cycle distribution and cell apoptosis of A549 cell

In cell cycle and cell apoptosis, A549 cells were treated with PM_2.5 at concentrations of 6.25 µg/ml, 12.5 µg/ml, and 25 µg/ml for 12 h. The treatment concentration and time of PM_2.5 were based on our previous study (Dai, et al., 2019). The results showed that the proportion of G0/G1 phase cells gradually increased while the S phase cells decreased after treatment by PM_2.5. The proportion of A549 cell in G0/G1 phase cells were 50.2% ± 5.3, 52.4% ± 3.8, 53.9% ± 3.2 and 55.0% ± 2.8, and cells in S phase is 27.1% ± 4.9, 24.4% ± 2.6, 24.1% ± 3.2 and 22.3% ± 4.0, in control group, 6.25 µg/ml, 12.5 µg/ml and 25 µg/ml treated groups respectively (Fig. 1A and B). The results indicated that the cell cycle was disrupted after PM_2.5 exposure. As shown in Fig. 1C and D, the apoptotic cells increased significantly after exposure to PM_2.5 at 6.25 µg/ml, 12.5 µg/ml, and 25 µg/ml (Fig. 1D). The results indicated that PM_2.5 from chicken house induced apoptosis in A549 cells.

The subcellular structure of A549 cells was observed by transmission electron microscope (TEM). As shown in Fig. 2, PM_2.5 exposure induced nuclear enlargement, chromatin condensation, cytoplasm shrinkage, and cell surface microvilli fracture (the arrows in the bottom left panel of Fig. 2 indicated) which suggested that cells were going to be apoptosis. Notably, many organelles in the cytoplasm were swelled into vacuoles, including mitochondria and endoplasmic reticulum (the arrows in the bottom right panel of Fig. 2 indicated). We speculated that PM_2.5 not only induced cell apoptosis but also caused endoplasmic reticulum stress (ERS) in A549 cells. Moreover, the expression of Bcl-2, Bax, and Bad increased significantly at 25 µg/ml in A549 cell (p < 0.05) (Fig. 3A). Consistently, the level of cleaved caspase-3 and cleaved caspase-9 increased at 12.5 µg/ml, while showed a declining level at 25 µg/ml after exposure to PM_2.5 (Fig. 3B).

PM_2.5 caused ERS in A549 cell

The protein kinase R-like ER kinase (PERK) increased considerably in 12.5 µg/ml and 25 µg/ml of PM_2.5 treated group (p < 0.01). The expression of CHOP increased significantly in all exposed groups in the A549 cell (p < 0.05). There was no change in the expression of GRP78 among all groups. The level of ATF6 and CHOP expressed in an accordant way, which rose gradually while declined at 25 µg/ml of PM_2.5 in A549 cells (Fig. 4B).

Melatonin alleviated apoptosis of A549 cell caused by PM_2.5 from chicken house

In this assay, the A549 cells were exposed to melatonin at the concentration of 12.5 µmol, 25 µmol, 50 µmol, 100 µmol, 200 µmol, 400 µmol, 800 µmol, 1600 µmol and 3200 µmol for 12 h. As shown in Fig. 5A, melatonin at 50 µmol and 100 µmol resulted in an increasing tendency on A549 cell viability. Further assays showed that melatonin at 100 µmol improved the proliferation of A549 cells (p < 0.01) (Fig. 5B). Consistent with the above results, the melatonin at 100 µmol prevented A549 cell from apoptosis significantly after exposure by PM_2.5 as shown in Fig. 5C and D. The further results indicated that the release of cytochrome C in the PM_2.5 treated group presented an upward trend, and melatonin declined the cytochrome C level although there were no substantial changes (data not shown).

Figure 6 showed that melatonin reduced the expression of Bcl-2, Bad, and Bax dramatically in comparison with that in PM_2.5 exposed group. There were a lower expression of cleaved caspase-9 and cleaved caspase-3 upon the combined treatment of melatonin with PM_2.5 compared to that in PM_2.5 treated group.

The effect of melatonin on antioxidant capacity in A549 cell exposed to PM_2.5

Our earlier research has indicated that PM_2.5 from chicken house induced oxidative stress proved by increasing the intracellular reactive oxygen species (ROS) content in A549 cell (Dai, et al., 2019). It's similar to what we had before, PM_2.5 stimulation increased MDA concentration and Nrf2 level in A549 cell (Fig. 7A and B). The melatonin stimulation reduced the level of MDA (p < 0.05) and Nrf2 after exposure to PM_2.5. Importantly, melatonin improved the release of T-SOD and CAT considerably in PM_2.5 treated cells (Fig. 7A and B).

The mitochondria plays a vital role in regulating apoptosis (Li and Dewson, 2015). Bad and Bid are activated after receiving intracellular death signals, and then changed the conformation of Bax. The Bax inserts into the outer membrane of mitochondria and changes the mitochondrial membrane permeability, leading to the release of apoptotic factors such as cytochrome C which can activate caspase-9 and caspase-3, triggering a series of downstream apoptotic reactions. Bcl-2 as an anti-apoptotic gene, acts on the outer membrane of mitochondrial to maintain its integrity(Hector and Prehn, 2009). Our earlier research has demonstrated that PM_2.5 from chicken houses contained endotoxin and a large number of organic compounds (Dai, et al., 2020). Emerged evidence has demonstrated endotoxin induced apoptosis in many cell lines (Han et al., 2018, Xie et al., 2019, Zhang et al., 2019). In this study, chicken house PM_2.5 induced A549 cell apoptosis through enhancing the expression of Bad, Bax, and activating cleaved caspase-9 and cleaved caspase-3. The current study is consistent with previous results showing that particles from the atmosphere and cooking oil fumes lead to human epithelial lung cell apoptosis (Che et al., 2014, Dagher et al., 2006).

Herein, PM_2.5 from the chicken house caused ERS in the A549 cell. ERS is well characterized by protein misfolding, accumulation of unfolded proteins, internal calcium loss, or calcium overload, during which many sensors could be activated, including PERK and ATF6 that are released by GRP78, aiming at recovering homeostasis (Xu, Bailly-Maitre and Reed, 2005). PERK and ATF6 can activate CHOP, the function of which promotes the expression Bad and Bax and suppresses Bcl-2 and Bcl-xl, further inducing apoptosis (Iurlaro and Munoz-Pinedo, 2016, Szegezdi et al., 2006). In this study, chicken house PM_2.5 caused ERS and promoted the expression of PERK and CHOP. Furthermore, immunoblotting assays indicated that ATF6 and CHOP levels increased after stimulation by PM_2.5 in A549 cells. In summary, PM_2.5 from chicken house induced ERS and then caused apoptosis through the PERK/ATF6-CHOP-caspase-3 signal pathway. It’s worth noting that the expression of ATF6 and CHOP decreased on the concentration of PM_2.5 at 25 µg/ml in A549 cell which was consistent with the expression pattern of cleaved-caspase3 and cleaved-caspase9, further demonstrating that the expression of them is in a dose-dependent way.

The increase of the Bcl-2 and the decrease of Bax indicates the resistance of the cells to apoptosis (Pena-Blanco and Garcia-Saez, 2018). Studies shows melatonin had anti-apoptotic properties by improving the Bcl-2 expression and resisting the Bax level. In human monocytic U937 cells irradiated by ultraviolet, melatonin prevented apoptosis by improving Bcl-2 level and declining the release of cytochrome C (Luchetti, et al., 2009). Melatonin exerted protection on neurodegenerative diseases including experimental stroke, Parkinson disease, Alzheimer disease through resisting apoptosis by elevating the Bcl-2 and Bcl-xl expression and inhibiting Bax level (Culmsee and Landshamer, 2006, Lukiw and Bazan, 2006, Mattson, Culmsee and Yu, 2000, Seung-Yun and Seol-Heui, 2010). In this study, melatonin promoted cell proliferation by downregulating the expression of Bad and Bax, as well as the level of cleaved caspase-9 and cleaved caspase-3. Notably, the expression of Bcl-2 also declined in A549 cells by melatonin exposure. We speculated that melatonin stimulation increased other anti-apoptotic members of the Bcl-2 family such as Bcl-xl, Mcl-1. Moreover, Zhou et. al has demonstrated that melatonin in high concentrations can inhibit the viability and migration of A549 cell (Zhou et al., 2014). Another study indicated that melatonin showed anti-tumor action by resisting the expression of vascular endothelial growth factor (VEGF) which is involved in angiogenesis (Goradel et al., 2017). Herein, melatonin decreased the Bcl-2 levels, which may prevent the excessive proliferation of A549 cells.

Previous studies have well established that oxidative stress can induce signal transduction pathways involved in apoptosis initiated by mitochondrial (Kujoth et al., 2005, Siah, Wong and Ho, 2014). Melatonin, as an antioxidant, has been employed in many assays demonstrating its anti-oxidative capacity (Reiter et al., 2016, Rodriguez et al., 2004). Furthermore, the study indicated that melatonin as a targeting molecule to mitochondrial exerted a protecting role on mitochondrial by scavenging ROS and inhibiting the mitochondrial permeability transition pore (MPTP) (Tan et al., 2016). Currently, melatonin showed an anti-apoptotic effect by decreasing the expression of cleaved caspase-3 and cleaved caspase-9 as well as increasing the level of SOD and CAT in A549 cells. In addition, ERS can also be initiated by oxidative stress (Malhotra and Kaufman, 2007), therefore, melatonin alleviated the apoptosis of A549 cells induced by PM_2.5 by inhibiting oxidative stress and ERS. Nrf2, as the central regulator of cellular oxidative stress, initiated the expression of detoxifying enzymes and antioxidant enzyme genes and increased the cell resistance to electrophilic chemicals (Loboda et al., 2016). In our results, melatonin down-regulated the Nrf2 expression in A549 cells exposed to PM_2.5, which is a conflict with previous studies indicating that melatonin protected cells from oxidation by increasing Nrf2 level (Ding et al., 2014, Wang et al., 2012). Here, two hypotheses have been made as follows. Cancer cells, including the A549 cell, have a strong antioxidant capacity to maintain rapid division and proliferation (Harris et al., 2015). Moreover, melatonin has been shown an anticancer effect in some studies(Di Bella et al., 2013, Goradel, et al., 2017, Zhou, et al., 2014), which may lead to decrease the expression of Nrf2. In addition, our results indicated melatonin enhanced antioxidant enzyme expression, and other studies also revealed that melatonin can scavenge free radicals directly(Rodriguez, et al., 2004), which was contributed to maintain cell homeostasis and further inhibit the Nrf2 expression.

The PM concentration in poultry houses is higher in comparison with that from pig or cattle feeding systems, and imposed a heavier burden on animal respiratory health, further causing low productivity and rising mortality by the incurred lung injury(Cambra-Lopez, et al., 2010). Apoptosis is related to acute respiratory distress syndrome, pulmonary fibrosis and promoted emphysema development when apoptosis occurs in lung epithelial and endothelial cells (Lu, Harrington and Rounds, 2005). This study revealed that PM_2.5 from the chicken house led to the apoptosis of A549 cells, and melatonin played a positive action in preventing cell apoptosis. Our study provided new insight into melatonin in alleviating lung damage caused by chicken house PM_2.5, and the findings further expanded the potential applications of melatonin as feed additives in chicken production.

Conflict of Interest

All authors declared that they had no competing interest.

Acknowledgements

This work was supported by the National Natural Science Foundation of China (No.31772648 and No. 32072781).

Akbarian A, Kazerani HR, Mohri M, Raji AR, Jamshidi A, Golian A (2014) "Exogenous melatonin improves growth performance, intestinal microbiota, and morphology in temporarily feed restricted broilers". Livest Sci 167:400–407
Al Homidan A, Robertson JF (2003) "Effect of litter type and stocking density on ammonia, dust concentrations and broiler performance". Brit Poult Sci 44:S7–S8
Atkinson RW, Mills IC, Walton HA, Anderson HR (2015) "Fine particle components and health–a systematic review and meta-analysis of epidemiological time series studies of daily mortality and hospital admissions". J Expo Sci Environ Epidemiol 25:208–214
Ayles H, Friendship R, Bubenik G, Ball R (1999) "Effect of feed particle size and dietary melatonin supplementation on gastric ulcers in swine". Can J Anim Sci 79:179–185
Barkauskas CE, Cronce MJ, Rackley CR, Bowie EJ, Keene DR, Stripp BR, Randell SH, Noble PW, Hogan BL (2013) "Type 2 alveolar cells are stem cells in adult lung". J Clin Invest 123:3025–3036
Cambra-Lopez M, Torres AG, Aarnink AJA, Ogink NWM (2011) "Source analysis of fine and coarse particulate matter from livestock houses". Atmos Environ 45:694–707
Cambra-Lopez M, Aarnink AJ, Zhao Y, Calvet S, Torres AG (2010) "Airborne particulate matter from livestock production systems: a review of an air pollution problem". Environ Pollut 158:1–17
Carmen R, Mayo JC, Sainz RM, Isaac A, Federico H, Vanesa M, Reiter RJ (2010) "Regulation of antioxidant enzymes: a significant role for melatonin". J Pineal Res 36:1–9
Che Z, Liu Y, Chen Y, Cao J, Liang C, Wang L, Ding R (2014) "The apoptotic pathways effect of fine particulate from cooking oil fumes in primary fetal alveolar type II epithelial cells". Mutat Res Genet Toxicol Environ Mutagen 761:35–43
Chen JY, Chen G, Li JR, Qian C, Mo HB, Gu C, Yan F, Yan W, Wang L (2015) "Melatonin attenuates inflammatory response-induced brain edema in early brain injury following a subarachnoid hemorrhage: a possible role for the regulation of pro-inflammatory cytokines". J Pineal Res 57:340–347
Cho CC, Hsieh WY, Tsai CH, Chen CY, Chang HF, Lin CS (2018) "In Vitro and In Vivo Experimental Studies of PM2.5 on Disease Progression". Int J Env Res Pub He 15:1380
Culmsee C, Landshamer S (2006) "Molecular insights into mechanisms of the cell death program: role in the progression of neurodegenerative disorders". Curr Alzheimer Res 3:269–283
Dagher Z, Garcon G, Billet S, Gosset P, Ledoux F, Courcot D, Aboukais A, Shirali P (2006) "Activation of different pathways of apoptosis by air pollution particulate matter (PM2.5) in human epithelial lung cells (L132) in culture". Toxicology 225:12–24
Dai P, Shen D, Tang Q, Huang K, Li C (2020) "PM2.5 from a broiler breeding production system: The characteristics and microbial community analysis". Environ Pollut 256:113368
Dai P, Shen D, Shen J, Tang Q, Xi M, Li Y, Li C (2019) "The roles of Nrf2 and autophagy in modulating inflammation mediated by TLR4-NFκB in A549 cell exposed to layer house particulate matter 2.5 (PM2. 5)". Chemosphere 235:1134–1145
Davidson CI, Phalen RF, Solomon PA (2005) "Airborne particulate matter and human health: A review". Aerosol Sci Tech 39:737–749
Di Bella G, Mascia F, Gualano L, Di Bella L (2013) "Melatonin anticancer effects: review". Int J of Mol Sci 14:2410–2430
Ding K, Wang HD, Xu JG, Li T, Zhang L, Ding Y, Zhu L, He J, Zhou ML (2014) "Melatonin stimulates antioxidant enzymes and reduces oxidative stress in experimental traumatic brain injury: the Nrf2–ARE signaling pathway as a potential mechanism". Free Radic Biol Med 73:1–11
Donham KJ, Scallon LJ, Popendorf W, Treuhaft MW, Roberts RC (1986) "Characterization of dusts collected from swine confinement buildings". Am Ind Hyg Assoc J 47:404–410
Goradel NH, Asghari MH, Moloudizargari M, Negandari B, Haghi-Aminjan H, Abdollahi M (2017) "Melatonin as an angiogenesis inhibitor to combat cancer: Mechanistic evidence". Toxicol Appl Pharm 335:56–63
Han M, Li Y, Wen D, Liu M, Ma Y, Cong B (2018) "NGAL protects against endotoxin-induced renal tubular cell damage by suppressing apoptosis". BMC Nephrol 19:168
Harris IS, Treloar AE, Inoue S, Sasaki M, Gorrini C, Lee KC, Yung KY, Brenner D, Knobbe-Thomsen CB, Cox MA, Elia A, Berger T, Cescon DW, Adeoye A, Brustle A, Molyneux SD, Mason JM, Li WY, Yamamoto K, Wakeham A, Berman HK, Khokha R, Done SJ, Kavanagh TJ, Lam CW, Mak TW (2015) "Glutathione and thioredoxin antioxidant pathways synergize to drive cancer initiation and progression". Cancer Cell 27:211–222
Hector S, Prehn JHM (2009) "Apoptosis signaling proteins as prognostic biomarkers in colorectal cancer: A review". Bba-Rev Cancer 1795:117–129
Honey L, Mcquitty J (1979) "Some physical factors affecting dust concentrations in a pig facility". Can Agr Eng 21:9–14
Iurlaro R, Munoz-Pinedo C (2016) "Cell death induced by endoplasmic reticulum stress". FEBS J 283:2640–2652
Jia YX, Yang MH, Zhu KF, Wang L, Song YK, Wang J, Qin WX, Xu ZY, Chen Y, Liu GS (2016) "Melatonin implantation improved the egg-laying rate and quality in hens past their peak egg-laying age". Sci Rep 6:39799
Klimont Z, Amann M (2002) "European control strategy for fine particles: the potential role of agriculture". Landbauforschung Völkenrode 235:29–35
Kujoth GC, Hiona A, Pugh TD, Someya S, Panzer K, Wohlgemuth SE, Hofer T, Seo AY, Sullivan R, Jobling WA, Morrow JD, Van Remmen H, Sedivy JM, Yamasoba T, Tanokura M, Weindruch R, Leeuwenburgh C, Prolla TA (2005) "Mitochondrial DNA mutations, oxidative stress, and apoptosis in mammalian aging". Science 309:481–484
Li MX, Dewson G (2015) "Mitochondria and apoptosis: emerging concepts". F1000Prime Rep 7:42
Li X, Shu R, Filippatos G, Uhal BD (2004) J.J.O.a.P. "Apoptosis in lung injury and remodeling" 97:1535–1542
Li Y, Yang Y, Feng YT, Yan JJ, Fan CX, Jiang SA, Qu Y (2014) "A review of melatonin in hepatic ischemia/reperfusion injury and clinical liver disease". Ann Med 46:503–511
Liu XL, Yan Z, Yan PP, Jing QC, Wei XF, Liu RT, Shi TH, Wu B (2015) "Effects of Different Padding on Air Quality in Broiler House and Growth Physiological Index of Broilers". J Agr Sci Tech-Iran 16:2764–2769
Loboda A, Damulewicz M, Pyza E, Jozkowicz A, Dulak J (2016) "Role of Nrf2/HO-1 system in development, oxidative stress response and diseases: an evolutionarily conserved mechanism". Cell Mol Life Sci 73:3221–3247
Lu Q, Harrington EO, Rounds S (2005) "Apoptosis and lung injury". Keijo J Med 54:184–189
Luchetti F, Betti M, Canonico B, Arcangeletti M, Ferri P, Galli F, Papa S (2009) "ERK MAPK activation mediates the antiapoptotic signaling of melatonin in UVB-stressed U937 cells". Free Radical Bio Med 46:339–351
Lukiw WJ, Bazan NG (2006) "Survival signalling in Alzheimer's disease". Biochem Soc T 34:1277–1282
Macfarlane M, Williams AC (2004) "Apoptosis and disease: a life or death decision - Conference and Workshop on Apoptosis and Disease". Embo Rep, 5: 674–678
Malhotra JD, Kaufman RJ (2007) "Endoplasmic reticulum stress and oxidative stress: a vicious cycle or a double-edged sword?". Antioxid Redox Sign 9:2277–2293
Mattson MP, Culmsee C, Yu ZF (2000) "Apoptotic and antiapoptotic mechanisms in stroke". Cell Tissue Res 301:173–187
Matute-Bello G, Martin TR, .S (2016) "Apoptosis in the pathogenesis and resolution of acute lung injury". 233:93
Mostafa E, Nannen C, Henseler J, Diekmann B, Gates R, Buescher W (2016) "Physical properties of particulate matter from animal houses-empirical studies to improve emission modelling". Environ Sci Pollut Res Int 23:12253–12263
Pena-Blanco A, Garcia-Saez AJ (2018) "Bax, Bak and beyond - mitochondrial performance in apoptosis". Febs J 285:416–431
Pfaffl MW (2001) "A new mathematical model for relative quantification in real-time RT–PCR". Nucleic Acids Res 29:e45–e45
Qi R, Manbeck HB, Maghirang RG (1992) "Dust Net Generation Rate in a Poultry Layer House". Trans Asae 35:1639–1645
Reiter RJ, Mayo JC, Tan DX, Sainz RM, Alatorre-Jimenez M, Qin LL (2016) "Melatonin as an antioxidant: under promises but over delivers". J Pineal Res 61:253–278
Rodriguez C, Mayo JC, Sainz RM, Antolin I, Herrera F, Martin V, Reiter RJ (2004) "Regulation of antioxidant enzymes: a significant role for melatonin". J Pineal Res 36:1–9
Sabino R, Faisca VM, Carolino E, Verissimo C, Viegas C (2012) "Occupational exposure to Aspergillus by swine and poultry farm workers in Portugal". J Toxicol Env Heal A 75:1381–1391
Sawalha MN, Kridli RT, Jawasreh KI, Meza-Herrera CA (2011) "The use of melatonin and progestagen-eCG to initiate reproductive activity in prepuberal Awassi ewe lambs". Trop Anim Health Prod 43:1345–1350
Seung-Yun C, Seol-Heui H (2010) "Melatonin attenuates kainic acid-induced hippocampal neurodegeneration and oxidative stress through microglial inhibition". J Pineal Res 34:95–102
Shen D, Wu S, Dai PY, Li YS, Li CM (2018) "Distribution of particulate matter and ammonia and physicochemical properties of fine particulate matter in a layer house". Poult Sci 97:4137–4149
Shen D, Guo Z, Huang K, Dai P, Jin X, Li Y, Li C (2022) "Inflammation-associated pulmonary microbiome and metabolome changes in broilers exposed to particulate matter in broiler houses". J Hazard Mater 421:126710
Siah KT, Wong RK, Ho KY (2014) "Melatonin for the treatment of irritable bowel syndrome". World J Gastroentero 20:2492–2498
Szegezdi E, Logue SE, Gorman AM, Samali A (2006) "Mediators of endoplasmic reticulum stress-induced apoptosis". Embo Rep 7:880–885
Tan DX, Manchester LC, Qin L, Reiter RJ (2016) "Melatonin: A Mitochondrial Targeting Molecule Involving Mitochondrial Protection and Dynamics". Int J Mol Sci 17:2124
Vriend J, Reiter RJ (2015) "The Keap1-Nrf2-antioxidant response element pathway: a review of its regulation by melatonin and the proteasome". Mol Cell Endocrinol 401:213–220
Wang X (2009) "The antiapoptotic activity of melatonin in neurodegenerative diseases". CNS Neurosci Ther 15:345–357
Wang Z, Ma C, Meng CJ, Zhu GQ, Sun XB, Huo L, Zhang J, Liu HX, He WC, Shen XM (2012) "Melatonin activates the Nrf2-ARE pathway when it protects against early brain injury in a subarachnoid hemorrhage model". J Pineal Res 53:129–137
Winey M, Meehl JB, O'toole ET, Giddings TH Jr J.M.B.O.T.C. 2014."Conventional transmission electron microscopy".25:319–323
Xie KH, Xie HM, Su GQ, Chen DW, Yu B, Mao XB, Huang ZQ, Yu J, Luo JQ, Zheng P (2019) "β-Defensin 129 Attenuates Bacterial Endotoxin-Induced Inflammation and Intestinal Epithelial Cell Apoptosis". Front Immunol 10:2333
Xu C, Bailly-Maitre B, Reed JC (2005) "Endoplasmic reticulum stress: cell life and death decisions". J Clin Invest 115:2656–2664
Zhang HM, Zhang Y (2014) "Melatonin: a well-documented antioxidant with conditional pro-oxidant actions". J Pineal Res 57:131–146
Zhang S, Li R, Dong W, Yang H, Zhang L, Chen Y, Wang W, Li C, Wu Y, Ye Z, Zhao X, Li Z, Zhang M, Liu S, Liang X (2019) "RIPK3 mediates renal tubular epithelial cell apoptosis in endotoxininduced acute kidney injury". Mol Med Rep 20:1613–1620
Zhang W, Wang N, Zhang T, Wang M, Ge W, Wang X (2021) "Roles of Melatonin in Goat Hair Follicle Stem Cell Proliferation and Pluripotency Through Regulating the Wnt Signaling Pathway". Front Cell Dev Biol 9:686805
Zhou Q, Gui S, Zhou Q, Wang Y (2014) "Melatonin inhibits the migration of human lung adenocarcinoma A549 cell lines involving JNK/MAPK pathway". PLoS ONE 9:e101132

floatimage1.png
Graphical Abstract

Download PDF

Version 1

posted

You are reading this latest preprint version

Melatonin reverted apoptosis induced by chicken house PM_2.5 in A549 cell via oxidation resistance

Status:

Version 1

Abstract

Figures

Introduction

Materials And Methods

PM_2.5 sampling and extraction

Cell culture and treatment

The detection of cell cycle and cell apoptosis

Transmission electron microscopy (TEM)

The total RNA extraction and real-time PCR

Western blot assays

The detection of cell viability

The detection of T- SOD, CAT, and MDA

Statistical analysis

Results

The effects of PM_2.5 on the cell cycle distribution and cell apoptosis of A549 cell

PM_2.5 caused ERS in A549 cell

Melatonin alleviated apoptosis of A549 cell caused by PM_2.5 from chicken house

The effect of melatonin on antioxidant capacity in A549 cell exposed to PM_2.5

Discussion

Declarations

References

Supplementary Files

Status:

Version 1

Melatonin reverted apoptosis induced by chicken house PM2.5 in A549 cell via oxidation resistance

Status:

Version 1

Abstract

Figures

Introduction

Materials And Methods

PM2.5 sampling and extraction

Cell culture and treatment

The detection of cell cycle and cell apoptosis

Transmission electron microscopy (TEM)

The total RNA extraction and real-time PCR

Western blot assays

The detection of cell viability

The detection of T- SOD, CAT, and MDA

Statistical analysis

Results

The effects of PM2.5 on the cell cycle distribution and cell apoptosis of A549 cell

PM2.5 caused ERS in A549 cell

Melatonin alleviated apoptosis of A549 cell caused by PM2.5 from chicken house

The effect of melatonin on antioxidant capacity in A549 cell exposed to PM2.5

Discussion

Declarations

References

Supplementary Files

Status:

Version 1

Melatonin reverted apoptosis induced by chicken house PM_2.5 in A549 cell via oxidation resistance

PM_2.5 sampling and extraction

The effects of PM_2.5 on the cell cycle distribution and cell apoptosis of A549 cell

PM_2.5 caused ERS in A549 cell

Melatonin alleviated apoptosis of A549 cell caused by PM_2.5 from chicken house

The effect of melatonin on antioxidant capacity in A549 cell exposed to PM_2.5