CX3CR1 modulates cognitive dysfunction induced by sleep deprivation

doi:10.21203/rs.3.rs-17240/v1

Download PDF

Research

CX3CR1 modulates cognitive dysfunction induced by sleep deprivation

https://doi.org/10.21203/rs.3.rs-17240/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background Sleep disorder-associated cognitive impairments are often accompanied by impaired synaptic plasticity. In the pathological process of sleep deprivation, microglia, as an important innate immune cell in central nervous system, are involved and mediate the synaptic pruning, in which the CX3C-chemokine receptor 1 receptor (CX3CR1) plays an indispensable role. In this study, the potential role of CX3CR1 in modulating the cognition decline during sleep deprivation was evaluated in terms of microglial neuroinflammation and synaptic pruning.

Methods Middle-aged wild type C57BL/6 mice (WT) (13 months) and age-matched CX3CR1 -/- mice were either subjected to sleep deprivation (SD) or allowed normal sleep (S) for 8 h to mimic the pathophysiological changes of middle-aged people after staying up all night in real life. The hippocampus-dependent cognition was assessed by fear conditioning test. Mice brains were extracted for neuroinflammation and synaptic pruning studies. Data were analyzed by Student’s t-test and one-way analysis of variance (one-way ANOVA).

Results The CX3CR1 deficiency mice differed from WT mice in many measures. CX3CR1 deficiency prevented SD-induced cognitive impairments, in which the levels of brain-derived neurotrophic factor (BDNF) and phosphorylated cAMP-responsive element binding protein (p-CREB) were markedly increased in the hippocampus. Compared with the CX3CR1 -/- -S group, the CX3CR1 -/- -SD mice reported a markedly decreased microglial density in the dentate gyrus, notably-decreased levels of cellular oncogene fos (c-fos), and pro-inflammatory cytokines and increased levels of anti-inflammatory cytokines in the hippocampus, and a significant increase in the density of spines of the dentate gyrus area. Furthermore, the CX3CR1 -/- -SD group also showed a decreasing expression of microglial phagocytosis-related factors.

Conclusion These findings suggest that CX3CR1 deficiency leads to different cerebral behaviors and responses to sleep deprivation. CX3CR1 deletion can alleviate the sleep deprivation-induced cognitive impairment. The inflammation-attenuating activity and the related modification of synaptic pruning are possible mechanism candidates, which indicate CX3CR1 as a candidate therapeutic target for the prevention of the sleep loss-induced cognitive impairments.

Neurobiology of Disease

sleep deprivation

cognitive dysfunction

microglia

CX3CR1 deficiency

Sleep is an important and indispensable physiological process to maintain human health. As modern fast-paced life often disrupts the sleep cycle of the general public, sleep deprivation is increasingly prevalent worldwide, especially in the middle-aged population, who are under tremendous pressure [1].

Recent studies have shown that sleep deprivation leads not only to declined immunity, increasing incidence of cerebrovascular diseases but also to deteriorated cognitive functions [2, 3]. Sleep disorders are strongly associated with Alzheimer's disease (AD). The incidence of AD in people with sleep disorders is 1.4 times higher than that in people without AD [4]. At the same time, accumulating evidence implies a close causal relationship between SD and cognitive disorders [5, 6].

The post-learning sleep contributes to the retainment of the long-term memories [5]. The hippocampus-dependent cognitive function is extremely sensitive to sleep deprivation-associated damage [7–9]. For humans, even a single night of sleep loss impairs the objective working memory [10] and functional magnetic resonance imaging reveals a significantly-decreased activity of the hippocampus due to sleep disorders [11]. Up to date, accumulative evidence has documented that sleep deprivation results in an abnormal microglial activity in the brain [12–14]. In addition, an increasing number of studies have reported that sleep deprivation can lead to cognitive impairments and affect the immune and inflammatory responses [15, 16]. However, the underlying mechanism remains elusive.

Synaptic plasticity is the basis of learning and memory. The long-term potentiation (LTP) recorded from Schaffer collateral CA1 synapses has been found to be impaired in rats subjected to forced locomotion-induced sleep deprivation for 12 hours [17], which supports that sleep deprivation attenuates synaptic plasticity in the hippocampus. Recent studies have shown that synaptic pruning is involved in the development of sleep [14]. Accurate recognition and clearance of corresponding synapses are very important to synaptic plasticity. Within the brain, synaptic pruning is mainly executed by microglia. Thus, microglial synaptic pruning has a crucial involvement in the pathological process of sleep disorders. The process of synaptic pruning involves microglial distinguishing, phagocytosis, digestion, clearance and regeneration of synaptic components (synaptic spines, presynaptic terminals, synaptic vesicle transporters, etc.) to promote synaptic remodeling [18]. However, it remains blurred whether the sleep deprivation-induced cognitive impairments involve the microglial synaptic pruning.

As a highly-expressed CX3C chemokine in the hippocampus, chemokine (C-X3-C motif) ligand 1 (CX3CL1) selectively binds to the CX3C-chemokine receptor 1 receptor (CX3CR1), the only receptor mainly expressed in microglia, triggering a series of secondary pathophysiological changes. The interaction and mechanism between CX3CL1 secreted by neurons and CX3CR1 on microglia has become the focus of research on the role of microglia. The blockage of the CX3CL1/CX3CR1 signal axis by CX3CR1 knockout has been found to increase the production of interleukin-1 beta (IL-1β) and deteriorate the development of Tau pathology [19]. An enriched environment may attenuate cognitive loss and improve synaptic plasticity but may not affect CX3CR1-deficient mice [20].

Together, these findings suggest that sleep deprivation may lead to abnormal microglial activity and impact on cognitive function and that CX3CR1 is likely to participate in synaptic pruning and microglial inflammation, affecting the integrity of central nervous system (CNS) structure and functional circuits, ultimately leading to alterations in cerebral behavior and cognition. In this study, the middle-aged CX3CR1^−/− mice and age-matched wild type C57BL/6 mice (WT) were subjected to acute sleep deprivation, which mimics the pathophysiological changes of middle-aged people after staying up all night in daily life. We hypothesized that intrinsic CX3CR1-deficiency-induced functional changes in microglia may participate in the hippocampal synaptic pruning and cognitive decline in the pathogenesis of sleep disorders. In other words, we investigated whether the interference in the microglial function by the CX3CR1 knockout affects the CNS’s response to sleep deprivation. These findings uncover that microglial CX3CR1 signal-mediated physiopathogenesis may confer susceptibility to cognition loss during the development of the sleep disorders.

Animals and Groups

Wild type male C57BL/6 mice (aged 13 months old) and age-matched CX3CR1^−/− mice were used in this study. The CX3CR1^−/− mice were introduced from Jackson Laboratory (Stock: 005582) and generated on the C57BL/6 genetic background, in which the CX3CR1 gene was replaced by a green fluorescent protein (GFP) reporter gene such that homozygote CX3CR1^GFP/GFP (CX3CR1^−/−, knockout) mice are lack functional CX3CR1. Mice were housed in a 12 h light/dark cycle and allowed free access to food and water. Both groups were exposed to two experimental environments respectively [7]: (1) normal sleeping (S), therefore S group; (2) acute sleep deprivation (SD), SD group. All animal procedures and all experiments observed The National Institutes of Health Guide for the Care and Use of Laboratory Animals and were approved by the Ethics Committee on Animal Care and Use of Fujian Medical University.

Eight-hour Sleep-deprived (SD) Paradigm

SD mice were exposed to gentle handling and running platforms during the light phase to achieve a total deprivation from 8:00 a.m. to 4:00 p.m. S mice were exposed to the same environment but with a normal sleep phase. After the deprivation, both groups were sacrificed at the same time (4:00 p.m.), except those who will undergo behavioral tests. Independent groups of S and SD mice were used for molecular and histological studies.

Behavioral Tests

The mice participated in the behavioral tests after 8 h SD. They were placed in the experimental environments and allowed adjustment for more than half an hour before tests. The apparatus was thoroughly cleaned with 95% alcohol and dried after each test to keep it clean and odorless.

Open Field Test

The open field test was performed as previously described [21]. Briefly, mice were placed in a square arena (50 × 50 × 50 cm³) of opaque black plexiglass with a central area of 18 × 18 cm². Each mouse underwent a single 10-minute trial. All performances were recorded with a camera positioned above the apparatus and analyzed automatically with the software and by experimenters blinded to the treatment conditions. The traveled distance, speed spent in the central and peripheral zones of the arena were recorded.

The Fear Conditioning Test

The fear conditioning test was conducted as previously indicated [7]. Briefly, the fear conditioning apparatus (Sansbio, China) was placed in a quiet room. On the first day, mice were placed in the conditioned fear box for 2 minutes (phase A), and the freezing time of animals in the first 2 minutes was recorded as a baseline. Then a click noise of 80 dB was added for 30 seconds (phase B). Subsequently, the mice were shocked by 0.35 mA electric current that lasted for 2 seconds (phase C). After one round of training was completed, another two rounds of the three-phase training (phase A, B and C) were performed. During the whole training period, the animal's freezing time was recorded. The test phase, including context test, altered context test, took place on the second day after training. Mice were put into the same box used on the first day, and the computer automatically recorded the animal's stagnation behavior. The animal's contextually-conditioned fear was measured by recording the freezing time in the operating box for five minutes. One hour later, mice were put into the modified box and the freezing time was recorded to evaluate the altered context test for three minutes.

Immunohistochemistry

Three stages, including brain collection, sectioning and immunolabeling, were performed during immunohistochemical analysis. Although CX3CR1^+/− mice are often used to represent mice with normal CX3CR1 function, in strict consideration, we chose wild-type mice as the normal control to ensure the complete retention of CX3CR1 function. In order to compensate for the difference of GFP fluorescence between wild-type mice and CX3CR1^−/− mice, we used ethanol dehydration and paraffin embedding to quench GFP fluorescence as previously described [22]. After anesthesia, mice were first transcardially perfused with 20 ml 0.1M pre-cooled phosphate buffered saline (PBS) until colorless liquid drained out of the right auricle. Then, pre-cooled 4% polyformaldehyde (PFA) was perfused to fix the tissues. The whole brain was removed and post-fixed in 4% PFA at 4 °C overnight. Then, the samples were dehydrated with sucrose and embedded in paraffin. Subsequently, serial coronal sections (5 µm in thickness) were cut from bregma − 1.46 mm to -2.46 mm.

For all the antibodies, the immunolabeling procedure was the same. The paraffin slices were baked at 65 °C for 2 hours. After three washes with PBS, antigen retrievals were performed in an ethylene diamine tetraacetic acid (EDTA) buffer by microwaving for 10 minutes. Slices were appropriately cooled at room temperature and then incubated in a 3% hydrogen peroxide solution at room temperature for 10 minutes in the absence of light, followed by blocking with 5% bovine serum albumin (BSA) for 10 minutes. Immunolabeling was then conducted by incubating the slices with different antibodies at 4 °C overnight: rabbit anti-ionized calcium-binding adaptor molecule-1 (Iba-1) (1:100, Abcam, USA), rabbit anti-cellular oncogene fos (c-fos) (1:300, Abcam, USA), mouse anti-microtubule-associated protein-2 (MAP-2) (1:100, Thermo fisher, USA). After washing, sections were then incubated with specific secondary antibodies respectively, at 37℃ for 50 minutes. The negative control was treated without primary antibody, which was performed at the same time for accuracy. The slices were examined under an inverted microscope (Olympus, IX51) with a Micropublisher Q-imaging system. To evaluate the density of microglia and c-fos/MAP-2 positive neurons, the dentate gyrus (DG) of the hippocampus was measured using the Image J software (Version 1.52 s NIH). The operators of all analyses were blinded to genotypes and groups.

Golgi Staining

Golgi staining was performed using a Hito Golgi-Cox OptimStain™ Kit (Hitobiotec Corp.) according to the User's instructions and previous studies [23]. After deep anesthesia, the brain tissue was carefully and quickly removed and transferred to a prepared soaking solution (equal amount of kit solutions 1 and 2) of at least 5 times volume and stored at room temperature overnight. The next day, the soaking solution was refreshed and the brain tissue was placed at room temperature for 2 weeks without light. Afterwards, the tissue was transferred to solution 3 of at least five times volume and stored at 4℃ in a light-proof storage. Solution 3 was refreshed 12 hours later and 48 hours later, successive coronal sections of 150 µm were cut with a freezing microtome (CM1950, Leica, Germany). The sections were examined under a Zeiss LSM 780 confocal microscope with a 100 × oil objective. The images of dendritic branches in the hippocampus were thus obtained. The spine density was determined by operators blinded to genotype and groups using Image J.

Western Blot

After the removal of the brain tissue, the hippocampus was quickly separated on ice. They were put into the pre-marked cryopreservation tube and immediately transferred to liquid nitrogen for quick freezing. Then they were quickly transferred to the freezer at − 80 °C for storage and subsequent use.

The western blotting was performed with the following primary antibodies: anti-brain-derived neurotrophic factor (BDNF) (1:1000, Abcam, USA), anti-cAMP-responsive element binding protein (CREB) (1:500, CST, USA), anti-phosphorylated cAMP-responsive element binding protein (p-CREB) (1:500, CST, USA), and anti-glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (1:10000, Abcam, USA). Protein concentrations were measured by the bicinchoninic acid (BCA) method. The level of each protein was standardized on the basis of GAPDH expression.

Real-time fluorescence quantitative polymerase chain reaction (qRT-PCR)

qRT-PCR was performed using the following reaction system: SYBR Green Ⅱ(Rox) 10 µl, forward primer (300 nM) 0.6 µl, reverse primer (300 nM) 0.6 µl, RNase-free water 6.8 µl, template cDNA 2 µl at 50℃ for 2 minutes, 95℃ for 10 minutes, 95℃ for 15 seconds and 60℃ for 1 minute. A total of 40 cycles were executed. Primers were summarized in Table 1. GAPDH was used as an internal control and relative expressions of target gene were analyzed by the Ct method.

Table 1

Primers used in qRT-PCR
IL-1β	forward	ATGCCACCTTTTGACAGTGATG
IL-1β	reverse	TGATGTGCTGCTGCGAGATT
Arg-1	forward	CAATGAAGAGCTGGCTGGTG
Arg-1	reverse	GGCCAGAGATGCTTCCAACT
IL-4	forward	GAACGAGGTCACAGGAGAAGG
IL-4	reverse	AATATGCGAAGCACCTTGGAA
Cx3cr1	forward	GAGTATGACGATTCTGCTGAGG
Cx3cr1	reverse	CAGACCGAACGTGAAGACGAG
Trem2	forward	CTGGAACCGTCACCATCACTC
Trem2	reverse	CGAAACTCGATGACTCCTCGG
C3	forward	CTGGCCCTGATGAACAAACT
C3	reverse	GGATGTGGCCTCTACGTTGT
CR3	forward	GGCTTTGGACAGAGTGTGGT
CR3	reverse	ACACTGGTAGAGGGCACCTG
Arg-1: Arginase-1; IL-4: Interleukin-4; Trem2: Triggering receptor expressed on myeloid cells 2; C3: Complement C3; CR3: Complement receptor3.

Statistical Analysis

All results were presented as the mean ± S.E.M. All analyses were performed with GraphPad Prism (version 6.0). The data were analyzed by Student’s t-test and one-way analysis of variance (one-way ANOVA). When assessing statistical effects was required by the experiment, one-way ANOVA with repeated measures was performed. Statistical significance was set at p-value < 0.05.

CX3CR1 deficiency prevents sleep deprivation-induced cognitive decline

In order to investigate the effect of CX3CR1 on hippocampus-dependent learning and memory, the fear conditioning test was performed. Mice were trained and tested with a standard protocol as described before [24]. During the training period, the percentage of freezing time in each group was comparable (p > 0.05) (Fig. 1A), suggesting a similar cognitive function at the basal line. Twenty-four hours after the training phase, significant differences were found among groups in the conditional fear test. In WT groups, the freezing time of SD-treated mice was significantly shorter than that of the normal sleep group (p < 0.01) (Fig. 1B). Surprisingly, although the cognitive function of CX3CR1-deficient mice was significantly impaired when compared with that of WT-S mice (p < 0.001) (Fig. 1B), the freezing time increased significantly in CX3CR1-deficient mice after SD (p < 0.05) (Fig. 1B), indicating that CX3CR1 deficiency induces a different response to sleep deprivation and thereby preserving the cognitive function. When placed in a novel environment, no significant differences were observed among groups (p > 0.05) (Fig. 1C), suggesting that hippocampus-dependent learning and memory are indeed impaired after SD.

To examine the anxiety condition, all groups were tested in the open field task. No differences were observed in either traveled distance or speed in the center zone among groups (p > 0.05) (Fig. 1D-E). Neither the loss of function of CX3CR1^−/− gene nor SD causes excessive anxiety-like behavior in this study. Together, all these results imply that the absence of CX3CR1 prevents the SD-induced cognitive impairment.

Elevated BDNF and CREB phosphorylation in the hippocampus of CX3CR1-deficient mice after SD

The expression of selected neurotrophins BDNF, p-CREB and CREB in the hippocampus was evaluated by western blotting (Fig. 2A-E). Compared with the WT mice, the level of BDNF was significantly reduced in CX3CR1^−/− mice (p < 0.01) (Fig. 2B). Of note, this reduction was dramatically reversed in CX3CR1^−/− mice after SD (CX3CR1^−/−-SD vs. CX3CR1^−/−-S group, p < 0.05) (Fig. 2B). In contrast, though there was no significance, a downward trend in BDNF was found in the WT-SD group when compared with WT-S group (p > 0.05) (Fig. 2B). No significant differences in CREB expression were found among groups (p > 0.05) (Fig. 2C). Regarding the CREB activation, the phosphorylation of CREB was assessed. The CX3CR1^−/−-SD mice displayed a higher expression level of p-CREB than the CX3CR1^−/− -S group (p < 0.001) (Fig. 2D). When WT-SD was compared, we also saw a significant upward trend in the CX3CR1^−/−-SD group (p < 0.001, Fig. 2D). In addition, the ratio of p- CREB/CREB was also significantly increased in the hippocampus in CX3CR1^−/−-SD mice when compared with CX3CR1^−/−-S mice and WT-SD mice (p < 0.05, for both) (Fig. 2E).

The microglial density in the DG of CX3CR1-deficient mice decreases after SD

Representative activity and distribution of microglia in the DG were illuminated by Iba-1, a marker of microglia (Fig. 3B). Representative images showed an increased Iba-1 positive immunoreactivity in the DG of WT mice after SD. The number of microglia increased 1.8 folds in response to the sleep deprivation in the WT mice (p < 0.001) (Fig. 3C), while the effect was offset when the function of CX3CR1 was deleted. A notable decrease of Iba-1 positive cells in the DG was observed in CX3CR1-deficient mice after SD (p < 0.001, for both) (Fig. 3C). Meanwhile, the absence of CX3CR1 induced a marked increase in Iba-1 + cells in the DG area when compared with that of the WT mice (p < 0.01) (Fig. 3C). These findings indicate that CX3CR1 mediates the sleep deprivation-induced microglial over-activation, which can be attenuated by CX3CR1 deficiency.

Diverse levels of c-fos expression in the DG are observed in WT and CX3CR1-deficient mice after SD

Immediate early genes (IEGs) refer to a group of genes that are first expressed in neurons after stimulation and are closely related to inflammation. The most characteristic and important one is c-fos gene [1]. The expression of c-fos in the DG region of the hippocampus was detected by double labeling of c-fos/MAP-2 (Fig. 3A). After sleep deprivation, the average positive staining area percentage of c-fos in the DG was significantly higher in the WT-SD group than in WT-S mice (p < 0.01) (Fig. 3D). Interestingly, in CX3CR1^−/− groups, the c-fos expression was lower in SD group than in S group (p < 0.05) (Fig. 3D). After SD, the c-fos level in CX3CR1-deficient mice was significantly lower than that of WT mice (p < 0.001) (Fig. 3D). These results indicate a differential alteration in microglia-neuron interaction and neuronal activity between the WT and CX3CR1-deficient mice after SD and that the CX3CR1-deficient mice fail to react to the SD-induced neuronal stress response, thus preserving the neuronal functions.

Altered levels of pro-inflammatory and anti-inflammatory cytokines in the hippocampus of CX3CR1-deficient mice after SD

To further evaluate the SD-triggered inflammatory response in the hippocampus, we examined the expression levels of pro-inflammatory and anti-inflammatory cytokines in the hippocampus using qRT-PCR. As expected, an upward trend of pro-inflammatory levels was found in the WT group after SD (p < 0.01) (Fig. 4A). The IL-1β expression in the DG was markedly decreased in CX3CR1-deficient mice after SD when compared with the CX3CR1^−/−-S group and WT-SD group (p < 0.05, for both) (Fig. 4A). Arg-1 and IL-4 were chosen as typical representatives of anti-inflammatory factors. Compared with the CX3CR1^−/−-S group, CX3CR1^−/−-SD mice showed a significant increase in Arg-1 (p < 0.01) (Fig. 4B). The mRNA level of Arg-1 significantly increased in the CX3CR1-deficient mice after SD (CX3CR1^−/− -SD vs. WT-SD, p < 0.001) (Fig. 4B). A similar trend of IL-4 was found in the CX3CR1-deficient mice. The level of IL-4 in CX3CR1^−/−-SD group was higher than that in the CX3CR1^−/−-S group, though with no statistical difference. Moreover, CX3CR1deficiency significantly reduced the level of IL-4 (p < 0.05) (Fig. 4C). Taken together, these data support the notion that SD-induced pernicious neuroinflammation is decreased in CX3CR1-deficient mice.

The spine density in the DG is better retained and accompanied with the decrease of phagocytosis-related factors in CX3CR1-deficient mice after SD

We next determined whether memory restoration in CX3CR1-deficient mice after SD was reflected at the spine construction. Mid-apical dendritic segments of the hippocampal DG area, which are segments between 100 and 400 mm from the soma, were analyzed using the Golgi staining (Fig. 5A-D). The analysis showed a remarkable decrease in the spine density in middle-aged WT-SD mice when compared with that of WT-S mice (p < 0.01) (Fig. 5E). In the CX3CR1-deficient groups, opposite noteworthy differences were found between SD mice and S mice; a significantly higher spine density was observed in CX3CR1^−/−-SD mice when compared with that of the CX3CR1^−/−-S mice (p < 0.05) (Fig. 5E). Meanwhile, the CX3CR1 deficiency significantly reduced the spine density (CX3CR1^−/−-S vs. WT-S, p < 0.001) (Fig. 5E), while after SD, the spine density was even higher in CX3CR1^−/−-SD mice when compared with WT-SD mice, though without significance. Altogether, these data indicate that CX3CR1 deficiency partially restores the reduction of synapses in the DG area of the SD mice.

Besides the CX3CL1/CX3CR1 system, several other microglia-specific pathways are required in the process of synaptic elimination, including the classical complement signaling and TREM2 in microglia. We first tested the expression level of CX3CR1 in all groups by qRT-PCR. As expected, almost no expression of CX3CR1 was seen in CX3CR1^−/− groups and the CX3CR1 expression significantly increased in the WT mice after SD (p < 0.05) (Fig. 6A). The TREM2 is required for the phagocytosis of microglia. In WT mice, the up-regulated expression of TREM2 was evident in the SD group (p < 0.01) (Fig. 6B), while in CX3CR1-deficient mice, the decrease was significant in SD mice when compared with S mice (p < 0.001) (Fig. 6B). CR3 is the classical receptor of complement C3 and the specific pattern recognition receptor of microglia. The C3/CR3 signaling pathway also plays an important role in microglial phagocytosis. A similar trend with the former two factors was found: in the groups of CX3CR1^−/−, C3 and CR3 levels decreased significantly after SD (respectively, p < 0.001 and p < 0.05) (Fig. 6C, Fig. 6D); conversely, a significant increase in C3 and CR3 expression in the hippocampus was found after SD in WT mice (p < 0.05, for both) (Fig. 6C and D). Thus, we confirm that the deficiency of CX3CR1 in the middle-aged WT mice can cause completely different changes of microglial phagocytic capacity.

It has become a consensus that sleep disorders impair cognitive function, though the mechanism is still unclear [7]. Tens of thousands of people suffer from insomnia and many middle-aged people are forced to stay up all night because of various pressures. Obviously, understanding the mechanisms by which sleep deprivation leads to cognitive impairments can help those who suffer from sleep deprivation to combat the deleterious effects.

To our knowledge, the present study reveals for the first time a pivotal role of CX3CR1 through microglial activity in the suppression of hippocampal-related memory decline after the sleep deprivation in middle-aged mice. As we all know, a lack of sleep can lead to serious cognitive impairment, while in this study, unlike the WT mice, the cognitive function of CX3CR1-deficient mice was improved rather than impaired after sleep deprivation. At the same time, the inhibition of microglial activity, the decreased pernicious neuroinflammation and the up-regulated hippocampal BDNF, p-CREB level, were found in the CX3CR1-deficient mice after sleep deprivation. Consistent with the improved cognitive function, CX3CR1 deficiency restored the abnormal synaptic pruning process and the density of the spines in the DG after sleep deprivation. The modulation of the microglial phenotype by targeting the CX3CR1 pathway might serve as a way to restore the microglial homeostasis and treat sleep disorders-associated cognition loss.

Previous studies have shown that hippocampus-dependent memory is particularly sensitive to sleep deprivation [9]. In the present study, middle-aged mice were selected for eight-hour acute sleep deprivation and received the fear conditioning test, which enables researchers to examine hippocampus-dependent cognitive function by testing their ability to connect electric shock to a purposeful environment. WT-SD mice showed a significant cognitive decline in the conditioned fear test as expected. However, although CX3CR1 knockout showed cognitive impairment in the normal sleep group, unexpectedly, unlike the WT mice, the cognitive function in CX3CR1-deficient mice after SD was distinctively improved, which, to our knowledge, is the first study of its kind in CX3CR1 knockout mice. For sleep deprivation experiment, stress is an inevitable factor, the spontaneous activity and anxiety state of mice were evaluated by the open field test, which found no significant differences among groups. As mice had similar freezing time in the training phase in the fear conditioning test, it is unlikely that stress leads to the changed cognitive function after sleep deprivation.

We observed an improvement in BDNF levels, a neurotrophic factor widely distributed in the central nervous system, in the hippocampus along with the ameliorative hippocampus-dependent cognitive function in CX3CR1-deficient mice after SD, which is the opposite of the WT group. BDNF is one of the most important regulators of synaptic plasticity, closely related to cognitive function [25]. It has been confirmed to modulate ligand-gated channels like N-methyl-D-aspartic acid (NMDA) and α-amino-3-hydroxy-5-methyl-4-isoxazole-propionicacid (AMPA) receptors. Studies show that serum BDNF levels in early Alzheimer’s patients can be increased by donepezil treatment[26] and more recent studies evidence its role in sleep regulation [15]. Wong et al. have found that the deletion of p75, a receptor possibly interacting with BDNF precursor, prevents SD-mediated decrease in the hippocampal BDNF and improves the cognitive behavior [27]. CREB is a transcription factor directly related to BDNF expression. In the current study, we found no differences in the level of hippocampal CREB among groups, but, after SD, the CX3CR1-deficient mice had a notable elevated level of p-CREB. Abundant experiments have proved that the CREB-BDNF pathway plays a key role in learning and memory processes and that, using plasmid transfection, the increased level of CREB can significantly reduce the apoptosis of neurons and promote the survival of neurons, which is closely related to the level of p-CREB [28]. Taken together, in the present study, the absence of CX3CR1 leads to the resistance to the harmful effects of SD on cognitive function at both behavioral and protein levels.

IEGs are a group of informative neural activity markers, of which c-fos is the most characteristic and important [29]. C-fos is called “the third messenger” for it transforms external signals into gene expression and has the characteristics of signal transmission. We validated hippocampal neuron response by c-fos immunofluorescence and found that the c-fos-positive neurons were activated by sleep deprivation in WT mice. However, most intriguingly, the c-fos-positive neurons reached a much lower level after SD in CX3CR1-deficient mice. The SD influences on c-fos level are consistent with previous studies in WT mice, increased c-fos level is observed to be independent of age, various SD durations and SD patterns [30]. It should be noted that the high expression of c-fos occurs not only during sleep deprivation but also during spontaneous wake, indicating that its elevation is not due to the stress of sleep deprivation [31]. As a famous third messenger, the protein expressed by c-fos gene regulates the response of the body to external stimulation by activating or inhibiting its target genes [32], including inflammatory response. Zhang et al. have reported that both c-fos and pro-inflammatory genes were promoted by high salt while the up-regulation of pro-inflammatory factors can be notably eliminated by the selective inhibitor of c-fos [33]. In the present study, the activation of c-fos after SD was significantly reduced by CX3CR1 knockout, according with the ameliorated memory ability. These data indicate that CX3CR1 deficiency may mediate the excessive inflammatory response caused by sleep deprivation through the activation of c-fos, thereby leading to cognitive impairment.

Sleep is closely related to the immune system. Microglia are the most common macrophages in the central nervous system and a loyal guardian against the stimulation of external environment [34]. In this study, a prominent increase in number of the Iba-1-positive microglia in DG regions was found in the WT mice after SD, which tends to decrease in the absence of CX3CR1 gene. CX3CR1 belongs to the fractalkine receptor family and is supposed to be exclusively expressed on the microglia in the brain, which is important for mediating neuron–microglia interaction under both pathological and physiological conditions [35]. CX3CR1 is the unique receptor of neuronally-expressed CX3CL1 [36]. As previously shown, some pro-inflammatory phenotypes are seen in the DG area in the absence of CX3CR1 [21]. In the detection of pro-inflammatory factors represented by IL-1β, our study has obtained similar results. Sleep deprivation causes the over-activation of microglia and over secretion of pro-inflammatory factors. Surprisingly, we found a rather low expression of IL-1β and high level of anti-inflammatory factors Arg-1 and IL-4 in the hippocampus in CX3CR1-deficient mice after SD. Neuroinflammation occurs widely in a variety of central nervous system diseases related to cognitive impairment, including AD. Beta amyloid (Aβ) leads to excessive microglial activation and production of pro-inflammatory cytokines in mice models of Aβ deposition [34]. The abnormal inflammatory response mediated by microglia plays an important role in cognitive impairment after brain injury. Inflammatory microglia have been found to inhibit the recovery of central nervous system, increase excitotoxicity, increase oxygen free radicals, and aggravate necrosis and apoptosis of nerve cells [37]. Based on the above information, the microglial activation may be involved in the SD-induced cognitive impairment through the modulation of inflammatory factors, as CX3CR1 and the above inflammatory cytokines are candidates underlying the SD resistance in the CX3CR1^−/− mice. CX3CR1 knockout can prevent this abnormal inflammatory response and improve cognitive function after SD.

In general terms, the over-activation of CX3CR1 in microglia can induce inflammatory damage, but a limited activation of CX3CR1 may play a neuroprotective role, in which synaptic pruning plays an important role, a process that can clear the dead cells and synapses in physiological and pathological condition, thus promoting the regeneration of synapses and myelin sheaths in the process of brain injury repairment [38]. Electron microscopy and two-photon imaging in vivo research have found many synapses and synaptic spines become smaller and disappear after contacting microglia, which directly confirms that microglia have significant synaptic pruning effect. After dark stimulation, microglia change their morphology and synaptic contact mode, indicating that microglia participate in the brain synaptic pruning and remodeling after an environmental stimulation, in which, sleep is thought to affect the synaptic pruning process of microglia [39]. Other researchers reconstructed and analyzed 6,920 synapses in the brain of mice using serial scanning 3D microscopy, and measured their sizes. It was found that compared with the waking state, the sleeping state is more conducive to the correct implementation of synaptic pruning [40]. Of note, both in middle-aged WT-SD and age-matched CX3CR1^−/−-S mice, the activated microglia were related to fewer synapses in the DG area. A reasonable explanation is that the over-activated microglia perform an incorrect synaptic pruning procedure, and the synapses are abnormally engulfed and eliminated, thus affecting the growth of new synapses. Unexpectedly, this abnormal synaptic pruning process was offset in CX3CR1^−/−-SD mice in the present study. Our data showed that CX3CR1^−/−-SD mice had more synapses and better cognitive function. Strong evidence shows that enough synapses are extremely important for the formation and maintenance of learning and memory. A previous study showed that the inhibition of microglial over-activation significantly reduced the extent of early synapse loss in adult AD mice [41]. Guang Yang et al. also found that after learning different skills, new dendritic spines appeared in mice [42]. Our findings support the notion that, in CX3CR1-deficient mice, the microglial activation and the related abnormal excessive synaptic pruning induced by sleep deprivation are reduced, eventually improving the related cognitive function. Interestingly, Milior's study showed that CX3CR1-knockout mice did not respond to depression behaviors in harsh environments such as chronic stress [35]. The above findings suggest that the deficiency in CX3CR1/ CX3CL1 signaling pathway may prevent the harmful reconstruction of brain structure and function, and the change of cognitive behavior caused by environmental stimulation.

It is believed that the binding of soluble CX3CL1 to its receptor CX3CR1 maintains the “synapse pruning” function of microglia [43]. A previous study found that the number of microglia and dendritic spine density increased in CX3CR1-knockout mice at the age of 2–3 weeks. However, at 40 days after birth, the number of microglia and dendritic spine density returned to the same level as that of wild-type mice [44]. As far as we know, little data are available regarding the microglial status of middle-aged and old CX3CR1^−/− mice. The current study showed the first time that compared with the WT mice, the absence of CX3CR1 showed a marked increase in the number of microglia in the DG area and decrease in dendritic spine density in the middle-aged mice. The synaptic pruning declines in the microglia during aging. The CX3CR1/CX3CL1 pathway is a pivotal signal path to initiate the “find me” phase, after which the microglia can bind with target synapses to perform phagocytosis and clearance [45]. In the present study, CX3CR1^−/−-SD mice showed better cognitive function, associated with higher synaptic density. The rationale for the above facts is that, in middle-aged mice, the absence of CX3CR1 partially reverses the over-activation of microglia and the corresponding abnormal synaptic pruning after sleep deprivation. For those who are activated, the lack of “find me” signal limits their inappropriate phagocytosis of synapses, thus combining with more synapses and protecting the integrity of synaptic links and neural networks. Therefore, this change in microenvironment prevents the disadvantages caused by sleep deprivation.

In order to further observe the microenvironmental changes related to “synaptic pruning” in the brain of the middle-aged CX3CR1^−/− mice after SD. We focused on other factors closely related to the “synaptic pruning” function of microglia, which also links microglial responses to specific stimuli. The TREM2 is uniquely expressed on microglia and is required for microglial synaptic pruning other than CX3CR1 [46]. We found a significant decrease in the level of TREM2 in the hippocampus after sleep deprivation in CX3CR1^−/− mice, which had a higher dendritic spine density. This result is consistent with a previous study that documents that the decreased expression of TREM2 is related to lower phagocytic properties using cell culture system [47]. Similar to TREM2, C3, another factor involved in synaptic pruning-complement proteins, was also reduced in CX3CR1^−/− mice after the stimuli of sleep deprivation. It has been proved that C3 deposit can provoke microglial phagocytosis of synapses. In this regard, during sleep deprivation, the lack of CX3CR1 may give rise to a low expressing level of phagocytosis-related factors like TREM2 and C3, eventually reducing the synaptic pruning exerted by microglia. Therefore, CX3CR1 deficiency might lock microglia in a homeostatic state and block essential functions of microglia during the progression of sleep disorders.

In conclusion, our results indicate that the CX3CR1 has an extremely important role in regulating the CNS response to sleep deprivation and the interplay between external stimulation and brain function. The deficiency of CX3CR1 contributes to the recovery from the sleep deprivation-induced cognitive dysfunction. Although the underlying mechanism is not fully understood, the inflammation-attenuating activity and the related modification of synaptic pruning indicated in the present study, make CX3CR1/CX3CL1 a candidate therapeutic pathway for the prevention of cognitive impairment associated with sleep loss.

CX3CR1

CX3C-chemokine receptor 1 receptor

Wild type C57BL/6 mice

Sleep deprived

Normal sleep

BDNF

Brain-derived neurotrophic factor

P-CREB

Phosphorylated cAMP-responsive element binding protein

C-fos

Cellular oncogene fos

Alzheimer’s disease

LTP

Long-term potentiation

CX3CL1

Chemokine (C-X3-C motif) ligand 1

IL-1β

Interleukin-1 beta

CNS

Central nervous system

GFP

Green fluorescent protein

PBS

Phosphate buffered saline

PFA

Polyformaldehyde

EDTA

Ethylene diamine tetraacetic acid

BSA

Bovine serum albumin

Iba-1

Ionized calcium-binding adaptor molecule-1

MAP-2

Microtubule-associated protein-2

Dentate gyrus

CREB

cAMP-responsive element binding protein

GAPDH

Glyceraldehyde-3-phosphate dehydrogenase

BCA

Bicinchoninic acid

qRT-PCR

Quantitative polymerase chain reaction

Arg-1

Arginase-1

IL-4

Interleukin-4

TREM2

Triggering receptor expressed on myeloid cells 2

Complement C3

CR3

Complement receptor3

One-way ANOVA

One-way analysis of variance

IEGs

Immediate early genes

NMDA

N-methyl-D-aspartic acid

AMPA

α-amino-3-hydroxy-5-methyl-4-isoxazole-propionicacid

Aβ

Beta amyloid

Ethics approval and consent to participate

The National Institutes of Health Guide for the Care and Use of Laboratory Animals were followed in all animal procedures and all experiments were approved by the Ethics Committee on Animal Care and Use of Fujian Medical University.

Consent for publication

Not applicable.

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Competing interests

The authors declare that they have no competing interests.

Fundings

This study was supported by Joint Funds for the Innovation of Science and Technology，Fujian province (No. 2017Y9025;No.2017Y9006); National Natural Science Foundation of China (No.81701087; No.81771179); Fujian Provincial Health-education Joint Research Project (No.WKJ2016-2-08); Research Project of Undergraduate Education and Teaching Reform of Fujian Medical University (No. J18029).

Authors' contributions

Jia-wei Xin, Xiao-chun Chen and Xiao-dong Pan carried out the animal study and quantitative analysis, and were major contributors in writing the manuscript. Xiao-juan Cheng, Chang-fu Xie and Qiu-yang Zhang carried out the animal study and histochemical experiments. Yi-lang Ke and Xuan-yu Huang performed the biochemical study. All authors read and approved the final manuscript.

Acknowledgements

We would like to thank Professor Hongzhi Huang from School of Foreign Languages of Fujian Medical University for his kind proofreading and polishing this manuscript.

National Health Inverview Survey. Quickstats: Percentage of Adults Who Reported an Average of < 6 Hours of Sleep per 24-Hour Period bSaAG-US. MMWR Morb Mortal Wkly Rep. 2005;54:933.

Elvsåshagen T, Zak N, Norbom LB, Pedersen P, Quraishi SH, Bjørnerud A, Alnæs D, Doan NT, Malt UF, Groote IR. Evidence for cortical structural plasticity in humans after a day of waking and sleep deprivation. NeuroImage. 2017;156:214–23.

Nir Y, Andrillon T, Marmelshtein A, Suthana N, Cirelli C, Tononi G, Fried I. Selective neuronal lapses precede human cognitive lapses following sleep deprivation. Nature medicine. 2017;23(12):1474.

Shi L, Chen S-J, Ma M-Y, Bao Y-P, Han Y, Wang Y-M, Shi J, Vitiello MV, Lu L. Sleep disturbances increase the risk of dementia: a systematic review and meta-analysis. Sleep medicine reviews. 2018;40:4–16.

Van Someren EJ, Cirelli C, Dijk D-J, Van Cauter E, Schwartz S, Chee MW. Disrupted sleep: from molecules to cognition. J Neurosci. 2015;35(41):13889–95.

Kwon K, Lee E, Kim M, Jeon S, Choi Y, Shin C, Han S-H. The potential role of melatonin on sleep deprivation-induced cognitive impairments: implication of FMRP on cognitive function. Neuroscience. 2015;301:403–14.

Havekes R, Vecsey CG, Abel T. The impact of sleep deprivation on neuronal and glial signaling pathways important for memory and synaptic plasticity. Cellular signalling. 2012;24(6):1251–60.

Ishikawa H, Yamada K, Pavlides C, Ichitani Y. Sleep deprivation impairs spontaneous object-place but not novel-object recognition in rats. Neurosci Lett. 2014;580:114–8.

Walsh CM, Booth V, Poe GR. Spatial and reversal learning in the Morris water maze are largely resistant to six hours of REM sleep deprivation following training. Learning memory. 2011;18(7):422–34.

10.

Rångtell FH, Karamchedu S, Andersson P, Liethof L, Olaya Búcaro M, Lampola L, Schiöth HB, Cedernaes J, Benedict C. A single night of sleep loss impairs objective but not subjective working memory performance in a sex-dependent manner. J Sleep Res. 2019;28(1):e12651.

11.

Yoo S-S, Hu PT, Gujar N, Jolesz FA, Walker MP. A deficit in the ability to form new human memories without sleep. Nature neuroscience. 2007;10(3):385.

12.

Schafer DP, Stevens B. Microglia function in central nervous system development and plasticity. Cold Spring Harbor perspectives in biology. 2015;7(10):a020545.

13.

Wu H, Dunnett S, Ho Y-S, Chnag RC-C. The Role of Sleep Deprivation and Circadian Rhythm Disruption as Risk Factors of Alzheimer’s Disease. Frontiers in neuroendocrinology. 2019:100764.

14.

Bellesi M, de Vivo L, Chini M, Gilli F, Tononi G, Cirelli C. Sleep loss promotes astrocytic phagocytosis and microglial activation in mouse cerebral cortex. J Neurosci. 2017;37(21):5263–73.

15.

Wadhwa M, Prabhakar A, Ray K, Roy K, Kumari P, Jha PK, Kishore K, Kumar S, Panjwani U. Inhibiting the microglia activation improves the spatial memory and adult neurogenesis in rat hippocampus during 48 h of sleep deprivation. J Neuroinflamm. 2017;14(1):222.

16.

Churchill L, Rector D, Yasuda K, Fix C, Rojas M, Yasuda T, Krueger J. Tumor necrosis factor α: activity dependent expression and promotion of cortical column sleep in rats. Neuroscience. 2008;156(1):71–80.

17.

Campbell I, Guinan M, Horowitz J. Sleep deprivation impairs long-term potentiation in rat hippocampal slices. Journal of Neurophysiology. 2002;88(2):1073–6.

18.

Wilton DK, Dissing-Olesen L, Stevens B. Neuron-glia signaling in synapse elimination. Annu Rev Neurosci. 2019;42:107–27.

19.

Zujovic V, Schussler N, Jourdain D, Duverger D, Taupin V. In vivo neutralization of endogenous brain fractalkine increases hippocampal TNFα and 8-isoprostane production induced by intracerebroventricular injection of LPS. J Neuroimmunol. 2001;115(1–2):135–43.

20.

Shaftel SS, Kyrkanides S, Olschowka JA, Jen-nie HM, Johnson RE, O’Banion MK. Sustained hippocampal IL-1β overexpression mediates chronic neuroinflammation and ameliorates Alzheimer plaque pathology. J Clin Investig. 2007;117(6):1595–604.

21.

Bolós M, Perea J, Terreros-Roncal J, Pallas-Bazarra N, Jurado-Arjona J, Ávila J, Llorens-Martín M. Absence of microglial CX3CR1 impairs the synaptic integration of adult-born hippocampal granule neurons. Brain, behavior, and immunity. 2018; 68:76–89.

22.

Zhanmu O, Zhao P, Yang Y, Yang X, Gong H, Li X. Maintenance of fluorescence during paraffin embedding of fluorescent protein-labeled specimens. Front NeuroSci. 2019;13:752.

23.

Alves S, Churlaud G, Audrain M, Michaelsen-Preusse K, Fol R, Souchet B, Braudeau J, Korte M, Klatzmann D, Cartier N. Interleukin-2 improves amyloid pathology, synaptic failure and memory in Alzheimer’s disease mice. Brain. 2017;140(3):826–42.

24.

Rogers JT, Morganti JM, Bachstetter AD, Hudson CE, Peters MM, Grimmig BA, Weeber EJ, Bickford PC, Gemma C. CX3CR1 deficiency leads to impairment of hippocampal cognitive function and synaptic plasticity. Journal of Neuroscience. 2011;31(45):16241–50.

25.

Liao Y, Bae HJ, Park JH, Zhang J, Koo B, Lim MK, Han EH, Lee SH, Jung SY, Lew JH. Aster glehni Extract Ameliorates Scopolamine-Induced Cognitive Impairment in Mice. Journal of Medicinal Food. 2019.

26.

Leyhe T, Stransky E, Eschweiler G, Buchkremer G, Laske C. Increase of BDNF serum concentration during donepezil treatment of patients with early Alzheimer’s disease. Eur Arch Psychiatry Clin Neurosci. 2008;258(2):124–8.

27.

Wong L-W, Tann JY, Ibanez CF, Sajikumar S. The p75 neurotrophin receptor is an essential mediator of impairments in hippocampal-dependent associative plasticity and memory induced by sleep deprivation. Journal of Neuroscience. 2019;39(28):5452–65.

28.

Shalizi A, Lehtinen M, Gaudilliere B, Donovan N, Han J, Konishi Y, Bonni A. Characterization of a neurotrophin signaling mechanism that mediates neuron survival in a temporally specific pattern. J Neurosci. 2003;23(19):7326–36.

29.

Campos-Jurado Y, Igual-López M, Padilla F, Zornoza T, Granero L, Polache A, Agustín-Pavón C, Hipólito L. Activation of MORs in the VTA induces changes on cFos expression in different projecting regions: Effect of inflammatory pain. Neurochem Int. 2019;131:104521.

30.

Hairston IS, Peyron C, Denning DP, Ruby NF, Flores J, Sapolsky RM, Heller HC, O'hara BF. Sleep deprivation effects on growth factor expression in neonatal rats: a potential role for BDNF in the mediation of delta power. J Neurophysiol. 2004;91(4):1586–95.

31.

Pompeiano M, Cirelli C, Tononi G. Immediate-early genes in spontaneous wakefulness and sleep: expression of c‐fos and NGFI‐A mRNA and protein. J Sleep Res. 1994;3(2):80–96.

32.

Dong J, Pan Y-B, Wu X-R, He L-N, Liu X-D, Feng D-F, Xu T-L, Sun S, Xu N-J. A neuronal molecular switch through cell-cell contact that regulates quiescent neural stem cells. Science advances. 2019;5(2):eaav4416.

33.

Zhang W-C, Zheng X-J, Du L-J, Sun J-Y, Shen Z-X, Shi C, Sun S, Zhang Z,, M (Na. Chen X-q, Qin M. High salt primes a specific activation state of macrophages. Cell research. 2015;25(8):893.

34.

Hickman S, Izzy S, Sen P, Morsett L, El Khoury J. Microglia in neurodegeneration. Nature neuroscience. 2018;21(10):1359.

35.

Milior G, Lecours C, Samson L, Bisht K, Poggini S, Pagani F, Deflorio C, Lauro C, Alboni S, Limatola C. Fractalkine receptor deficiency impairs microglial and neuronal responsiveness to chronic stress. Brain, behavior, and immunity. 2016; 55:114–125.

36.

Réaux-Le Goazigo A, Van Steenwinckel J, Rostène W, Parsadaniantz SM. Current status of chemokines in the adult CNS. Prog Neurobiol. 2013;104:67–92.

37.

Jassam YN, Izzy S, Whalen M, McGavern DB, El Khoury J. Neuroimmunology of traumatic brain injury: time for a paradigm shift. Neuron. 2017;95(6):1246–65.

38.

Hong S, Dissing-Olesen L, Stevens B. New insights on the role of microglia in synaptic pruning in health and disease. Current opinion in neurobiology. 2016;36:128–34.

39.

Tropea D, Majewska AK, Garcia R, Sur M. Structural dynamics of synapses in vivo correlate with functional changes during experience-dependent plasticity in visual cortex. Journal of Neuroscience. 2010;30(33):11086–95.

40.

De Vivo L, Bellesi M, Marshall W, Bushong EA, Ellisman MH, Tononi G, Cirelli C. Ultrastructural evidence for synaptic scaling across the wake/sleep cycle. Science. 2017;355(6324):507–10.

41.

Hong S, Beja-Glasser VF, Nfonoyim BM, Frouin A, Li S, Ramakrishnan S, Merry KM, Shi Q, Rosenthal A, Barres BA. Complement and microglia mediate early synapse loss in Alzheimer mouse models. Science. 2016;352(6286):712–6.

42.

Yang G, Lai CSW, Cichon J, Ma L, Li W, Gan W-B. Sleep promotes branch-specific formation of dendritic spines after learning. Science. 2014;344(6188):1173–8.

43.

Valero J, Paris Ia, Sierra A. Lifestyle shapes the dialogue between environment, microglia, and adult neurogenesis. ACS chemical neuroscience. 2016;7(4):442–53.

44.

Zhan Y, Paolicelli RC, Sforazzini F, Weinhard L, Bolasco G, Pagani F, Vyssotski AL, Bifone A, Gozzi A, Ragozzino D. Deficient neuron-microglia signaling results in impaired functional brain connectivity and social behavior. Nature neuroscience. 2014;17(3):400.

45.

Gabandé-Rodríguez E, Keane L, Capasso M. Microglial phagocytosis in aging and Alzheimer's disease. J Neurosci Res. 2020;98(2):284–98.

46.

Jay TR, von Saucken VE, Muñoz B, Codocedo JF, Atwood BK, Lamb BT, Landreth GE. TREM2 is required for microglial instruction of astrocytic synaptic engulfment in neurodevelopment. Glia. 2019;67(10):1873–92.

47.

Caldeira C, Cunha C, Vaz AR, Falcão AS, Barateiro A, Seixas E, Fernandes A, Brites D. Key aging-associated alterations in primary microglia response to beta-amyloid stimulation. Front Aging Neurosci. 2017;9:277.

Download PDF

Version 1

posted

You are reading this latest preprint version

CX3CR1 modulates cognitive dysfunction induced by sleep deprivation

Status:

Version 1

Abstract

Figures

Introduction

Materials And Methods

Animals and Groups

Eight-hour Sleep-deprived (SD) Paradigm

Behavioral Tests

Open Field Test

The Fear Conditioning Test

Immunohistochemistry

Golgi Staining

Western Blot

Real-time fluorescence quantitative polymerase chain reaction (qRT-PCR)

Statistical Analysis

Results

Elevated BDNF and CREB phosphorylation in the hippocampus of CX3CR1-deficient mice after SD

Altered levels of pro-inflammatory and anti-inflammatory cytokines in the hippocampus of CX3CR1-deficient mice after SD

Discussion

Conclusion

Abbreviations

Declarations

References

Status:

Version 1