All restriction enzymes were purchased from MBI Fermentas (Germany), M199 medium (Sigma, USA), Oxythiamin & Pyrithiamin (Sigma, USA), Fetal Bovine Serum (FBS; Hiclone, USA), Blasticidin (Sigma), Penicillin (Sigma, USA), Streptomycin (Sigma, USA), pMAL-c2 vector (New England Biolabs, Inc., MA, USA), Factor-Xa (NEB, Inc., MA, USA), Amylose resin (NEB, Inc., MA,USA). The other chemical reagents used in this study were analytical or cell culture grade, and were commercially available.
Parasite and mammalian cell culture
Promastigotes of Leishmania donovani strain BOB (LdBOB, MHOM/SD/62/1S-CL2D) were cultured at 22oC in modified M-199 medium (Sigma, USA) with 100 U/ml penicillin), 100 µg/ml streptomycin supplemented with 10% heat-inactivated FBS (Hiclone, USA). THP-1 human macrophage cell line was obtained from ATCC and maintained in RPMI- 1640 medium (Sigma) supplemented with 10% FBS, at 37°C in 5% CO2 atmosphere.
Sequence analysis
A combination of sequence and profile-based methods was employed to identify the orthologs of the enzymes involved in vitamin B1 biosynthetic pathway in L. major, L. donovani and L. infantum. The sequence-based methods employ sequence similarity searches using BLAST against L. major genome sequences [23]. Profile-based methods employ the generation of Hidden Markov Models (HMM) for each of the individual enzymes using their homologous sequences from Swiss-Prot database [24]. For the analysis of molecular evolution and for constructing phylogenetic tree, MEGA software analysis tool was used [25]. Multiple phylogenetic trees were generated using different phylogenetic methods such as Maximum Likelihood, Neighbour joining trees to evaluate the evolutionary relationship of the L. major homologs with the other organisms, and within Leishmania species. Profile HMM based searches were employed to identify the homologs from other eukaryotic pathogens listed in eupathdb, which were subsequently used for comparative gene analysis [26].
Cloning, expression and purification of LdTPK
A DNA fragment of ~ 1632 bp was amplified from the genomic DNA of Leishmaina donovani (BOB strain), using specific primers with a flanking BamHI (underlined), 5’ TTTGGATCCATGTCTCGCCTCGAGACATACAT 3’- forward primer and HindIII (underlined), 5’ TTTAAGCTTTTACAAGGACGCCGGCGCATCTT 3’- reverse primer. The amplified DNA fragment of ∼1632-bp which forms the coding region of LdTPK was cloned into the BamHI/HindIII cloning sites of pMAL-c2x vector (NEB, Inc., MA, USA). The recombinant construct was transformed into BL21 (ʎDE3) strain of E. coli. Expression from the construct pMAL-c2x-LdTPK was induced by 0.3 mM IPTG (isopropyl-d-thiogalactoside, Sigma). MBP-tagged LdTPK was affinity purified on a pre-equilibrated amylose resin (NEB, Inc., MA, USA). Finally, the protein was loaded onto the amylose resin using column buffer (20mM Tris HCl, 200mM NaCl, 1mM EDTA), and eluted with 10mM maltose in the same buffer. Factor-Xa cleavage of Maltose Binding Protein (MBP)-tagged LdTPK was carried out at a w/w ratio of 1% the amount of the fusion protein [27], in a cleavage reaction using buffer: 20mM Tris-HCl, 100 mM NaCl, 2 mM CaCl2 (pH 8.0). Fractions were analyzed by SDS-PAGE and protein concentrations were determined by Bradford method using Bovine Serum Albumin (BSA) as standard [28].
Transfection and overexpression of LdTPK in L. donovani
A DNA fragment of ~ 1632-bp was amplified from genomic DNA of Leishmania donovani using specific primers with a flanking KpnI (underlined), 5’ TTTGGTACCATGTCTCGCCTCGAGACATACAT 3’- forward primer and EcoRV (underlined), 5’ TTTGATATCATTACAAGGACGCCGGCGCATCTT 3’- reverse primer. The amplified gene was cloned in Leishmania specific pNUS-mRFPnD vector (gifted by Prof. Asis Dutta, National Institute of Plant Genome research, New Delhi) that contain blasticidin as selection marker. 4 x 107 log phase promastigotes were harvested for transfection. The cells were centrifuged at 3,500 rpm for 12 min. The pellet was first washed with PBSG (10 mM Na2HPO4, 10 mM NaH2PO4, 145 mM NaCl and 2% glucose, filter sterilized) and then with electroporation buffer (21 mM HEPES, 135 mM NaCl, 5 mM KCl, 0.7 mM NaH2 PO4 and 6 mM glucose, filter sterilized), followed by centrifugation at 3,500 rpm for 12 min. The cells were resuspended in 400 µl electroporation (EP) buffer, 20 µg of the plasmid was added, and then transferred to a 2 mm gap electroporation cuvette. Electroporation was done with single pulse, at the following parameters 450 V, 500 µF, (Bio-RAD). Cells were incubated on ice for 10 min. The transfectants were then transferred to a T25 flask, in 5 ml of M199 medium with 20% FBS. Blasticidin was added after 24 hrs. as a selectable marker and the culture was allowed to propagate for 3–4 cycles by increasing the concentration of blasticidin (2µg/ml to 20µg/ml). Robust culture of blasticidin resistant cells was selected after 12–16 days.
Functional activity of LdTPK:
Functional activity of purified LdTPK (tagged with MBP at N-terminus) was measured by monitoring the depletion of ATP throughout time course of a kinase reaction. This was achieved by utilizing a method, ADP-Glo™ Kinase assay (Promega) which is ATP regeneration-based luciferase reaction system, in which the luminescence signal generated is proportional to the amount of ATP released in the reaction, thus correlating with kinase activity of an enzyme. Pyrophosphorylation activity of LdTPK was performed in an assay buffer containing 0.2 M HEPES (pH 7.4), 2 mM thiamine, 5 mM MgCl2 and different concentrations of purified MBP-LdTPK (0.25 µM, 0.5 µM, 1.0 µM and 2.0 µM) in a total volume of 40 µl. Reactions were initiated by adding 1 µM ATP, followed by incubation at 37°C for 10 min, 1 h, 4h, 8 h and 12h. Equivalent amount of heat inactivated enzyme was taken as negative control for each case. Reactions were stopped by heating at 100°C for 5 minutes and mixed with equal volume of kinase detection reagent to introduce luciferase and luciferin to detect ATP, followed by incubation at room temperature for 30 minutes [29, 30]. The luminescence produced was measured with Varioskan® Flash multimode reader (Thermo Fisher Scientific) using Skanlt Software 2.4.5 RE.
Generation of polyclonal antisera against LdTPK in mice
Antibodies against recombinant TPK (MBP tag at N-terminus) were generated by immunizing three 46 weeks old female BALB/c mice. Briefly, each animal was initially injected through intra-peritoneal route (primary immunization) with 50 µg purified recombinant protein, emulsified in equal volume of Freund's complete adjuvant (SigmaAldrich), followed by collecting preimmune sera. Two booster injections (boosting immunizations) of 50 µg recombinant protein in equal volume of incomplete Freund's adjuvant (SigmaAldrich) were given through the same route twice at 3week intervals in order to obtain a prolonged persistence of the immunogen and a continuous stimulation of the immune system. At 10 days after the final immunization, blood was collected from orbital venous sinus of the immunized mice and allowed to clot for 2–3 hours at 37oC, followed by incubation at 4°C for an hour to allow the clot to contract. The crude antisera were collected by centrifugation at 4,200 x g for 5 min at room temperature (RT) and stored at -20°C. The sera thus obtained were checked for integrity by probing TPK from Leishmania donovani lysate through western blotting.
Characterization of Hyper-Immune Sera (HIS) by western blotting
Western blotting was performed as per previously reported [31] to ascertain whether the serum raised in mice against recombinant TPK could recognize protein of predicted size in the parasite lysate. Towards this, cells were lysed by three freeze-thaw cycles in 0.1 X PBS supplemented with protease inhibitor cocktail (sigma), followed by protein quantification by QuantiPro BCA Assay Kit (Sigma). 50 µg of the cell lysate, prepared as above, was denatured in SDS-PAGE sample loading buffer, and resolved on 8% polyacrylamide gel (all protein electrophoresis and Western blotting reagents were from Bio-Rad Laboratories, Inc.). Proteins were electro-transferred onto nitrocellulose membrane (0.45 µm pore size) for 50 min. at 15V (RT) in Towbin’s buffer. The blot was blocked overnight at 4°C, in PBS containing 5% non-fat dried milk. Anti-serum (1:100, diluted in PBS containing 1% BSA) was added to the blot and incubated at RT for 6 hrs. Lysate probed with pre-immune serum was taken as negative control, and 1 µg of recombinant protein probed with anti-sera was taken as positive control. After washing the blot three times for 20 min each with PBS containing 0.05% Tween-20, blot was incubated with Horseradish Peroxidase (HRP)-conjugated anti-mice IgG (1:5000) for 1 hr. Blot was then washed again, and the bound immunoglobulin was detected by incubation with Luminata Forte Western HRP Substrate (Millipore) for 5 min. Visualization of the target proteins was achieved through x-ray film imaging method.
Localization of LdTPK:
To detect the localization of TPK in L. donovani, RFP transfected promastigotes were used. Fluorescence imaging of the stabilized culture was performed using confocal laser scanning microscope (Zeiss LSM 510 META). Briefly 1x107 promastigotes/mL were pelleted. The cells were then washed with Phosphate-Buffered Saline (PBS) containing 1% FBS, and resuspended in the same PBS solution with identical concentration of the cells. The promastigotes were then immobilized on poly(L)lysine coated coverslips. The coverslips were incubated in ice-cold paraformaldehyde for 20 minutes, followed by washing with PBS. Cells were then permeabilized using 0.5% Triton-X. Transfected promastigotes were stained with DAPI and Mitotracker green (0.1µg/ml), for 15–20 minutes at room temperature. The parasites stained with DAPI and Mitotracker green were observed at an excitation wavelength of 405 nm and 490 nm, respectively.
Role of LdTPK overexpression in oxidative stress response
We induced Reactive Oxygen Species (ROS) generation using the sub-lethal concentration of Menadione (2.5–10 µM). Intracellular amastigotes overexpressing LdTPK and BOB strain were treated with the varying concentrations of menadione for 12 hrs. After 12 hrs, intracellular ROS level was detected using the fluorescent dye H2DCFDA. Intracellular ROS was detected using 100 µM of 2', 7'-dichloro dihydro fluorescein diacetate (H2DCFDA) dye. Fluorescence was measured at 485 nm excitation wavelength and 520nm emission wavelength.
Effect of inhibitors on Promastigotes of L. donovani and Intracellular Amastigote:
The effect of inhibitors- thiamine analogs, oxythiamine and pyrithiamine [29, 32] on the growth of promastigotes of BOB strain was determined by MTT assay. 1×106 parasites/well of mid-log phase promastigotes were put in 96-welled tissue culture plate with M199 complete media, and incubated with varying concentration of oxythiamine and pyrithiamine (1.25 µM to 10 µM) at 22oC. After 72 h, 5 mg/ml MTT [3-(4,5-dimethylthiazol-2-yl)-2, 5- diphenyl tetrazolium bromide] dissolved in PBS, pH 7.2 was added. Plates were incubated at 37ºC until purple-colored crystals formed. The reaction was stopped by the addition of 50% isopropanol and 10% Sodium Dodecyl Sulphate (SDS) solution with gentle shaking, at 37ºC for 1 hour. Absorbance was measured spectrophotometrically at 570 nm.
THP-1 human macrophage-like cell line was obtained from ATCC and maintained in RPMI-1640 medium (Sigma) supplemented with 10% FBS, at 37ºC in 5% CO2 atmosphere. Before infection, 5×105 cells/well were plated in 96-welled plates and differentiated with phorbol Myristic Acetate (PMA, 20ng/ml). They were allowed to adhere for 48 hrs. and were infected with stationary phase BOB promastigotes transfected with the b-lactamase gene, at a ratio of 20 parasites per monocyte, as reported earlier [33, 34]. After 6 hrs. of infection, the non-internalized parasites were washed off with RPMI medium and different concentrations of oxythiamine and pyrithiamine were added. Intracellular amastigotes grown in THP-1 cell lines were quantified after 72 hrs. of drug addition, for β-lactamase activity, by first removing the medium by gentle pipetting. Subsequently, 50 µL of 50 µM substrate, CENTA (Calbiochem, La Jolla, CA) in 1X PBS and 0.1% Nonidet P-40 were added. The plates were incubated at 37ºC for 4 hrs. and the absorbance was taken at 405 nm.
Cytotoxic effect of oxythiamine and pyrithiamine was evaluated on THP1 by MTT assay. Briefly, THP1 cells were seeded in 96-well microtiter plate (50,000 cells/200 µL/well) and treated with the compounds (12.5 µM to 100 µM), and incubated at 37°C for 72 hrs. After incubation, 0.5 mg/mL MTT was added and incubated at 37°C for 4 hrs. Purple-colored formazan crystals, thus formed, were dissolved in 100 µL DMSO and optical density was measured spectrophotometrically by taking absorbance at 570 nm in a multimode plate reader (Thermo Fisher). The absorbance of untreated THP1 was taken as 100%.
Effect of inhibitors on LdTPK binding
Binding affinity of LdTPK for Thiamine (substrate of TPK), Thiamine-Pyrithiamine (5 µM) and Thiamine-Oxythiamine (5 µM) was determined using biolayer interferometer Octet K2 system (Pall Fortebio Corp., Menlo Park, CA) at 30oC, following the instrument user guidelines. Briefly, Aminopropylsilane (APS) biosensors were rinsed in an assay buffer (HEPES-MgCl2) for 300 s to obtain an initial baseline. Next, LdTPK was immobilized on the APS biosensors for 300 s to get a loading curve. After that, the LdTPK immobilized-APS biosensors were dipped into assay buffer for 300 s to acquire another baseline. The LdTPK-immobilized-APS biosensors were exposed at 2 µM concentration in assay buffer for 300 s to obtain association curves (Kon/M− 1s− 1). Finally, the LdTPK-immobilized-APS biosensors were again dipped into assay buffer without LdTPK to get dissociation curves (Koff/s− 1). The interaction of LdTPK with thiamine, thiamine-pyrithiamine (5µM) and thiamine-oxythiamine (5µM) was expressed as layer thickness (nm) over time (second). The binding affinity (KD) was calculated by dividing Kon by Koff [35].