Nuclear localization of platelet-activating factor receptor accounts for microglial phagocytosis in ischemic stroke

doi:10.21203/rs.3.rs-1732120/v1

Download PDF

Research Article

Nuclear localization of platelet-activating factor receptor accounts for microglial phagocytosis in ischemic stroke

https://doi.org/10.21203/rs.3.rs-1732120/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Platelet-activating factor receptor (PAFR), known as a G-protein-coupled receptor (GPCR), is extensively expressed in the plasma membrane of several cells. Several studies showed that nuclear PAFR performs distinct functions from cell surface. Our previous studies showed that inhibition of microglial PAFR by miR-98 overexpression can protect salvageable neurons from microglial phagocytosis in ischemic stroke; however, the underlying mechanism remains to be fully elucidated. Herein, we created PAFR knockout mice by Crispr/Cas9-mediated genome engineering and performed in vitro studies to determine whether nuclear PAFR is a crucial regulator of microglial phagocytosis in ischemic stroke. Our results demonstrated that nuclear PAFR recruited transcription factor Specificity protein 1 (Sp1) to trigger gene transcription of milk fat globule EGF factor 8 (MFG-E8), which binds to the exposed phosphatidylserine, mediates primary phagocytosis of viable neurons during inflammation, and, in turn, enhances microglial phagocytosis. Membrane-permeable PAFR antagonist Apafant had greater therapeutic effects than membrane-impermeable antagonist Ginkgolide B in ischemic stroke. Our findings provide an explanation for the nuclear PAFR-mediated microglial phagocytosis and have implications for the selection of PAFR antagonists for use in the treatment of ischemic stroke based on the nuclear receptors target.

Nuclear PAFR

microglia

Sp1

MFG-E8

phagocytosis

ischemic stroke

Ischemic stroke is one of the most severe and crippling diseases, with major economic and social consequences. Despite several decades of research on the rapid recanalization of occluded vessels for neural restoration in ischemic stroke, the therapeutic effects of recanalization have been inadequate^1,2. Thus, the specific pathogenesis of ischemic stroke needs to be explored further³.

PAFR is a phospholipid-related receptor from the GPCR family and mainly mediates cellular proinflammatory and angiogenic effects. PAFR is exclusively expressed on the surfaces of endothelial cells, platelets, and macrophages^4–6. Several studies have reported that PAFR participates in the pathological processes underlying ischemic stroke. PAFR antagonists reduce neutrophil chemotaxis, inflammatory response, and release of free radicals and excitatory amino acids through blocking the ligand PAF-mediated responses; this reduces the oxidative stress and excitatory toxicity, which leads to a neuroprotective role in ischemic stroke^7–10. Nevertheless, the mechanisms underlying PAFR-mediated signal transduction have not been studied thoroughly. Therefore, drugs that target PAFR may be useful for the treatment of ischemic stroke.

In recent years, the Sylvain Chemtob team conducted extensive studies on the novel functions of subcellular translocation of GPCRs and drug development based on these functions^11–13. They found that GPCRs are also located in other regions of the cell apart from cytoplasmic membrane, such as nucleus, endosomes and mitochondria. A transcriptional profiling analysis reported that PAFR was expressed in brain microglia¹⁴. Some studies demonstrated that PAFR is involved in the process of phagocytosis mediated by microglial cells and macrophages^15,16. Microglia are specialized phagocytes in the brain that remove dead cell fragments, dead neurons, synapses, and neurons with mild damage that can be recovered^17–21. Our previous work showed that overexpression of miR-98 blocks microglial phagocytosis of “stressed but salvageable” neurons possibly by inhibiting PAFR²². However, the specific mechanism underlying PAFR-mediated microglial phagocytosis remains unclear. Interestingly, Bhosle et al. found that nuclear PAFR of endothelial cells translocated in an agonist-independent manner and performed different functions from the cytoplasm²³, which sparked us to speculate the same manner occurring in microglia.

Studies have shown that when neurons are damaged by ischemia, MFG-E8, a bridge molecule located on microglia, binds to phosphatidylserine on the apoptotic cells to initiate and mediate phagocytosis^24,25. Currently, there is no evidence that PAFR is directly involved in gene regulation as a single nuclear transcription factor. We hypothesized that PAFR may act as a transcription coactivator and promote the expression of phagocytic genes by combining with other transcription factors, thus initiating the phagocytic process. Specially, PAFR may be associated with MFG-E8 regulation.

The aim of the present study was to determine the mechanism underlying microglial phagocytosis due to the transcriptional activation of phagocytic gene MFG-E8 promoted by nuclear localization of PAFR in an in vivo ischemic stroke model and in vitro induced microglial phagocytosis model, to provide a new theoretical basis for the treatment of stroke.

Animals

All in vivo experiments were approved by Institution Animal Care and Use Committee (IACUC) of Nanjing Medical University and the Approval No. IACUC-1706013 & 1912041. 10 to 12-week-old C57BL/6J male mice weighing 30 ± 2 g were purchased from the Animal Resource Center of the Faculty of Medicine of Nanjing Medical University for experimental use. All the animals were bred in a standardized barrier environment, maintained on a regular 12-h light/dark cycle and housed with access to food and water ad libitum (temperature 25 ± 2 ℃, humidity 55 ± 10%). All the experimental animals were allowed to adapt to the new environment for 2 weeks and fasted for 12 h before the experiments. All the animals were allocated to experimental groups and processed with randomization and the investigator was blinded to the group allocation. All the animals will be humanely euthanized.

Generation of PAFR knockout mice

The heterozygous recombinant PAFR knockout mice (C57BL/6J) were created by Crispr/Cas9-mediated genome engineering. Inter-cross heterozygous targeted mice to generate homozygous targeted mice. The PAFR gene (NCBI Reference Sequence: NM_001081211; Ensembl: ENSMUSG00000056529) is located on Mouse chromosome 4. 2 exons are identified, with the ATG start codon in exon 2 and the TAA stop codon in exon 2 (Transcript: ENSMUST00000070690) and to be selected as target site. Cas9 and gRNA were co-injected into fertilized eggs for KO Mouse production. gRNA target sequences include:

gRNA1 (matching forward strand of gene): GCCTTGGAATTGTTGATATAAGG

gRNA2 (matching reverse strand of gene): TTTATCGCATCCCCGGGTTAAGG

gRNA3 (matching reverse strand of gene): TGGATGTTGGCGTCCTCTCTAGG

gRNA4 (matching reverse strand of gene): TTCCTTGCCATGAGGGACCGAGG

Genotype identification

The pups will be genotyped by Polymerase Chain Reaction (PCR) and followed by agarose gel electrophoresis. Homozygotes: one band with 440 bp; Heterozygotes: two bands with 440 bp and 457 bp; Wildtype allele: one band with 457 bp. The wildtype mice generated by inter-cross heterozygous targeted mice were as control of homozygous PAFR knockout mice. 3 ~ 4 litters for each group were used for experiments.

PCR Primers1 (Annealing Temperature 60.0 ºC):

F1: 5’-CACTCAGGTCTCTCCTTCTACTAC-3’

R1: 5’-AAAGTAAAGGTAGAAGGACGACTGG-3’

Product size: 440 bp

PCR Primers2 (Annealing Temperature 60.0 ºC):

F1: 5’-CACTCAGGTCTCTCCTTCTACTAC-3’

R2: 5’-AAGTTAGCAAAGACCCATAGCACA-3’

Product size: 457 bp

Establishment of cerebral ischemia stroke model

The normal 10 to 12-week-old C57BL/6J male mice and homozygous PAFR knockout mice were used for focal cerebral ischemia/reperfusion experiments. A transient middle cerebral artery occlusion (tMCAO) model was established. Briefly, animals were anesthetized with isoflurane, and then the right external and internal carotid artery were exposed. Along the internal carotid artery into the middle cerebral artery, a nylon monofilament coated with silicon resin (Doccol) was introduced through a small incision and advanced to the carotid bifurcation. The monofilament was withdrawn to restore blood flow 1 h after the occlusion. Focal cerebral ischemia was assessed by Laser Doppler flowmetry. Neurological function was evaluated using a 4-point scale neurological score method (0, no observable deficit; 1, forelimb flexion; 2, decreased resistance to lateral push and immediate circling; 3, severe rotation progressing into loss of walking or righting reflex; 4, not walking spontaneously and some degree of consciousness). Animals dead in the model were excluded. The identification of ischemic core zones and penumbra field is performed as previously described.

Quantitative Reverse Transcription-Polymerase Chain Reaction (qRT-PCR)

Real-time qRT-PCR was carried out using the 2× SYBR Green qPCR Master Mix (bimake, B21203) in a QuantStudio 5 system (Thermo Fisher Scientific, USA). The Total RNA was extracted from tissues and cells by using a RNAiso Plus reagent (TaKaRa, 9109) and prepared for quantitative reverse transcriptase PCR by using MasterMix (abm, Cat. No. G592). A reverse transcription reaction was performed in a thermal cycler as follows: 37°C for 15 min, 65°C for 10 min, and held at 4°C forever. The relative expression of target genes was determined using the 2-ΔΔct method. The cycling conditions were as follows: denaturation at 95 ℃ for 15 s, followed by 40 cycles of DNA anneal and extension at 60 ℃ for 60 s and 72 ℃ for 30 s, and one cycle of 95 ℃ for 15 s, 60 ℃ for 60 s and 95 ℃ for 15 s. The primers are as follows.

Mouse-GAPDH-Forward: AGGTCGGTGTGAACGGATTTG

Mouse-GAPDH-Reverse: GGGGTCGTTGATGGCAACA

Mouse-PAFR-Forward: TCTGAGTTTCGATACACGCTCT

Mouse-PAFR-Reverse: CATAGCCGTTGGCAACCAC

Mouse-Mfge8-Forward: CGGGCCAAGACAATGACATC

Mouse-Mfge8-Reverse: TCTCTCAGTCTCATTGCACACAAG

Western blotting

Tissue and cell samples were dissociated in 100 µL of RIPA consisting of 1% phenylmethanesulfonyl fluoride (PMSF) (KeyGEN, KGP610). The protein concentrations were determined with a BCA Protein Assay kit (KeyGEN, KGP903), and the proteins were denaturalized with 6× loading buffer. Total proteins (20 µg) were separated by sodium dodecyl sulfate – polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to Immobilon-P PVDF Membrane (Millipore, Cat# IPVH00010). Then, 5% skim milk in Tris-buffered saline–Tween-20 was used to block the membranes for 2 h at room temperature. The membranes were then incubated with the following primary antibodies at 4°C overnight: PAFR (abcam, Cat# ab104162, 1:200), Sp1 (active motif, Cat# 2793151, 1:500), α-tubulin (Proteintech, Cat# 10094-1-AP, 1:2000).

Nissl Staining

The paraffinized mice brain sections were treated with Nissl Staining Solution (KeyGEN, KGMP0185). The basic nervous structure of the brain displayed a bluish-purple color. Nissl bodies represented that the nerve cells had a high ability to synthesize proteins. When the nerve cells were damaged, the Nissl corpuscles decreased significantly. The number of stained cells was counted randomly and analyzed with Image-Pro Plus 6.0.

Immunofluorescence and confocal image acquisition

Mice were anesthetized with isofluorane and perfused with 4% paraformaldehyde (PFA). The brains were dehydrated using a graded series of alcohol, cleared in xylene, and embedded in paraffin. Then, paraffin sections (5 µm) were cut by a rotary microtome (LEICA, RM2245, Heidelberg, Germany). After deparaffinization, sections were incubated with 5% goat serum for 1 h and then stained with primary antibodies (IBA1, goat, abcam, Cat# ab5076, 1:500; IBA1, rabbit, WAKO, 019-19741, 1:500; NeuN, Millipore, MAB377, 1:400; PAFR, abcam, Cat# ab104162, 1:200; MFG-E8, Santa Cruz Biotechnology, sc-8029, 1:500) overnight at 4 ℃. The slices were incubated with Alexa Fluor donkey anti-mouse, anti-goat, and (or) anti-rabbit secondary antibodies (1:1000 dilution, Invitrogen Life Technologies, NY, USA) after washing with PBS. Images were captured by a confocal microscopy or two-photon Microscope (Zeiss LSM880 with NLO & Airyscan). 3D reconstructions were generated using ZEN software (blue/black edition).

Primary neuron and microglia cultures

Primary neuron and microglia cultures were prepared from cerebral cortices of embryonic day (E) 16 ~ 18 mice embryos. Cerebral cortices were dissected and digested with 0.125% trypsin (Life Technologies, 27250-018) and 0.025% DNase I (Biofroxx, 1121MG010) at 37 ℃ for 15 min. Dissociated cells were filtered with 80-µm cell strainer, collected by brief centrifugation and plated on 24-well plates (Corning, 3524) coated with 0.01 mg/mL Poly-D-Lysine (Sigma, P6407) and cultured in DMEM (Life Technologies, 11965-084) containing 10% Fetal Bovine Serum (Life Technologies, Australia, 10099-141), 50 U/mL penicillin-streptomycin (Life Technologies, 15140122). At 6 h after seeding, the medium was changed to Neurobasal medium (Life Technologies, 21103-049) supplemented with 2% B27 (Life Technologies, 17504044) and 50 U/mL penicillin-streptomycin. Neurons were maintained at 37 ℃ in an incubator and grown for 10 ~ 12 days with half of the media replaced every 2 days. Microglia were separated from the mixed primary culture by shaking off for 5 h at 100 rpm and then planked in plates with DMEM medium containing 10% FBS and 50 U/mL penicillin-streptomycin. Primary microglia were transfected in a 6/24-well plate with SiRNA, purchased from GenePharma (Shanghai, China) using siRNA-Mate (GenePharma, G04002), according to the manufacturer’s instructions. The sequences are as follows.

Mouse-Ptafr siRNA:

Forward: 5’-CCAACUUCCAUCAGGCUAUTT-3’

Reverse: 5’-AUAGCCUGAUGGAAGUUGGTT-3’

Negative control:

Forward: 5’-UUCUCCGAACGUGUCACGUTT-3’

Reverse: 5’-ACGUGACACGUUCGGAGAATT-3’

Primary neuron-microglia physical coculture

Cortical neurons (1×10^6 cells/mL) were cultured in 24-well plates and grown for 8 ~ 9 days replaced with Neurobasal medium without B27 supplement, which inhibits the growth of glial cells. Primary microglia (1×10^5 cells/mL) were seeded and cultures 1:10 with neurons.

Oxygen and glucose deprivation and reoxygenation (OGD-R)

OGD experiments were performed using an incubator (Thermo Fisher Scientific, Waltham, USA) with premixed gas (95% N2 and 5% CO2) kept at 37 ℃. To initiate OGD, cells culture medium was replaced with deoxygenated, glucose-free DMEM (Life Technologies, 11966-025). After OGD, the cells were then transferred to a normoxic incubator (95% air and 5% CO2) replaced with normal medium. While, the time of OGD challenge and reoxygenation could be adapted according to different cells and culture system.

The detection of microglial phagocytosis

The experiment is followed according to the pHrodo™ Red zymosan bioparticles conjugate for phagocytosis (Life Technologies, P35364) procedure. Microglia were labeled with Cell Tracker™ Green. After twice washed with PBS, microglia were incubated with PBS containing 10 µL/ml of pHrodo Red zymosan bioparticles at 37°C for 15 min (if microglia were treated with OGD, incubated when reoxygenation). The treated microglia were examined every 30 min by a fluorescence microscope (Zeiss, Heidelberg, Germany).

Drug treatment

In vitro BV2 cells were treated with IL-4 (PeproTech, 20 ng/ml) to induced phagocytosis and Sp1 inhibitor Plicamycin (100 nM). Apafant (MCE, HY-108634) and Ginkgolide B (MCE, HY-N0784) applied in vitro experiments were 1 µM. Apafant (cayman, 14532) given in vivo was resolved in 10% DMSO and 90% saline with the concentration of 10 mg/ml. Ginkgolide B (MCE) administrated in vivo was resolved in 10% DMSO and 90% (20% SBE-β-CD (MCE, HY-17031) in saline) with the concentration of 10 mg/ml. The administration doses of mice with Apafant and Ginkgolide B after ischemic stroke were 14 mg/kg.

Coimmunoprecipitation (CO-IP) assay

For immunoprecipitation, BV2 cell lysates were incubated in RIPA lysis buffer for 30 min at 4°C, with agitation three times every 10 min, followed by centrifugation at 12,000 × g for 10 min at 4°C. Five hundred microliters of supernatant solution were incubated with specific antibodies overnight at 4°C with constant swirling; 40 µL of 50% protein A/G agarose beads (Santa Cruz, 15596026) were then added with incubation for 3 h. The beads were collected by centrifugation at 12,000 × g for 1 min at 4°C and washed three times using the lysis buffer. The precipitated proteins were eluted by suspending the beads in 6× loading buffer and then heated at 95°C for 5 min. The eluate was analyzed by immunoblotting.

Chromatin immunoprecipitation (ChIP)

ChIP assays were performed using a ChIP Assay Kit (Millipore, 17–295). 275 µL of 37% formaldehyde were added to each 10 mL of medium with swirling for 10 min. One milliliter of 10 × glycine buffer (1.25 M) was then added, and the mixture was swirled for 10 min to inactivate excess formaldehyde. The medium was then removed, and the cells were washed with ice-cold phosphate-buffered saline (PBS) twice and collected into a microfuge tube with 1 mL PBS and a mixture of proteinase inhibitors, followed by centrifugation at 1000 × g at 4°C for 5 min. Then 200 µL of lysis buffer plus proteinase inhibitors were added to suspend the cells, which were sonicated 20 times for 20 s each, with a 40 s rest each time at 40% setting, followed by centrifugation at 13,000 × g for 15 min. Supernatant solutions were diluted in dilution buffer, 60 µL of protein G agarose were added, and the mixture was rotated at 4°C for 1 h. The agarose was then removed by centrifuging at 2,000 × g for 1 min, and 4 µL of supernatant solution were saved at 4°C as “input.” Immunoprecipitation was performed overnight at 4°C with 1 µg normal rabbit IgG (CST, Cat# 2729) or anti-PAFR. Protein G agarose was then added, and the mixture was rotated for another hour. The complex was washed in sequence with low-salt, high-salt, LiCl, and Tris EDTA (TE) buffers (twice). Protein–DNA complexes were then eluted with TE elution buffer at 65°C for 5 h to reverse the cross-links. The samples were then treated with RNase A and proteinase K and then DNA was extracted and purified. The PCR primer of MFG-E8 promoter are as follows.

A: 5’-AGCCCAGACTAGTCTGGAACTC-3’

B: 5’-ACTCCTGGATTATTTTATTTTATTT-3’

C: 5’-AGCCCTCCCTCTTCCCAC-3’

D: 5’-GGCCAGTGGGCGGAGCT-3’

E: 5’-GGAGCGGACGCAGGAACT-3’

Z: 5’-GAGGCGCAGAGTAGCATG-3’

Statistical analysis

Data was analyzed in a blinded way. Statistical analyses were performed using Graphpad Prism7. Multiple comparisons were conducted using one/two-way ANOVA and Tukey’s multiple comparisons test or Kruskal-Wallis nonparametric test followed by Dunn multiple comparisons test. The means of the two treatment groups were analyzed using unpaired or paired Student’s t-tests. Data are expressed as means ± standard error of measurements (SEMs). A value of p < 0.05 indicates that the difference was statistically significant.

PAFR mediated the microglial phagocytosis of “stressed but salvageable” neurons after ischemic stroke

To study the role of PAFR, we established a tMCAO-induced ischemic stroke mouse model from day 1 to week 5 (Fig. 1a). After separating the core zone and penumbra field of ipsilateral tissues²⁶, we found that the mRNA expression level of PAFR was upregulated both in the core zone and penumbra field (Fig. 1b), which peaked on day 5 and gradually recovered (Fig. 1c). The protein expression level of PAFR in the core zone reached its peak on day 5 after ischemia, which was higher than that in the penumbra region (Fig. 1d–f).

p>Koizumi et al. found that phagocytosis of microglia and astrocytes has different spatial and temporal distribution. Phagocytic microglia appeared on day 1 after the occurrence of ischemic stroke in mice, reached the peak on day 3, and disappeared 1 week later. In contrast, phagocytic astrocytes appeared on day 3, peaked on day 7, and disappeared 2 weeks later. In addition, most phagocytic microglia are concentrated in the ischemic core, while phagocytic astrocytes are concentrated in the ischemic penumbra^27,28. Our results showed that the microglia expressing PAFR were activated on day 1 after ischemia and had a phagocytic morphology, while they were abundantly transformed into phagocytes on days 3–5 (Fig. 1g).

With the development of single-cell RNA sequencing, the heterogeneity of cells, microglia and astrocytes, can be clearly distinguished^29–31. Some studies have reported that some cell subsets that co-express astrocytes (GFAP and S100β) and microglial surface markers (CX3CR1, CD11b, CD68, and Iba1) were detected in the brain of patients with ischemic stroke and other neurodegenerative diseases³². Our data also demonstrated that the subpopulation of cells that co-express astrocyte (GFAP) and microglial (Iba1) markers appeared after ischemic stroke. However, the morphology of these cell subsets was similar to that of microglia. Meanwhile, Z-Stack images showed that PAFR was co-located with these cell subsets (Fig. 1g).

NeuN and IBA1 were used to label neurons and microglia, which showed that in the tissues contralateral to ischemic stroke in mice, microglia presented normal conditions and were located adjacent to neurons on day 3 (Fig. 2a). On day 5, few phagocytic microglia with expression of PAFR appeared (Fig. 2d). In the core zone, these microglia highly expressed PAFR, transformed into phagocytes, and destroyed the “stressed but salvageable neurons.” The incomplete pattern of NeuN indicated increasing neuronal damage (Fig. 2b, e). To further confirm the effects of PAFR on microglial phagocytosis, we generated PAFR knockout (PAFR^−/−) mice using Crispr/Cas9-mediated genome engineering.

We used PAFR^−/− mice to establish the ischemic stroke model and found that PAFR deficiency inhibited the microglial phagocytosis of neurons (Fig. 2c, f). In particular, NeuN retained its relative complete shape on day 5 (Fig. 2f). PAFR knockout reduced the number of microglial phagocytes and reversed the decreased expression level of NeuN (Fig. 2g–i). The disappearance of Nissl bodies is an important indicator of nerve cell damage. Our results showed that on day 5 after ischemic stroke, PAFR deficiency partly prevented neuronal death in the core zone (Fig. 2j, k).

After treatment with OGD for 3 h, microglia were added to pH-sensitive rhodamine-based pHrodo™ Red dyes, which were used as specific sensors of endocytic and phagocytic events. The stimulated microglia were examined every 30 min for 150 min after reoxygenation under a fluorescence microscope. Our results demonstrated that PAFR downregulation could delay and reduce the microglial phagocytosis of red bioparticles (Fig. 3a, c). By co-culturing microglia and neurons, we found that PAFR downregulation could inhibit the microglial phagocytosis of surviving neurons and restore the synapse injuries (Fig. 3d, e). Overall, these results suggest that PAFR participates in the pathological course of ischemic stroke and mediates the microglial phagocytosis of “stressed but salvageable” neurons. PAFR deficiency could inhibit the effects of ischemic injury.

PAFR can promote the expression of the phagocytic gene MFG-E8

Studies have shown that MFG-E8 is involved in the microglial phagocytosis of neurons^24,25. Therefore, we detected the correlation between PAFR and MFG-E8 both in vivo and in vitro. Our results found that PAFR knockout could reduce the microglial secretion of MFG-E8 in the core zone on day 5 after ischemic stroke (Fig. 4a–e). Previous studies have demonstrated that IL-4 secreted by ischemic neurons induces a phagocytic phenotype in microglia³³. Thus, we used IL-4 to stimulate the BV2 cells (mouse microglial cell strain) and found that PAFR was upregulated after treatment for 6 h (Fig. 4c, d, h). The mRNA expression level of MFG-E8 was also upregulated (Fig. 4f). Intriguingly, PAFR downregulation could reverse MFG-E8 upregulation (Fig. 4g). Collectively, these results suggested that the expression of MFG-E8 was regulated by PAFR.

Nuclear PAFR synergistically promotes the transcription of MFG-E8 by the transcription factor Sp1

Interestingly, we found that the expression level of nuclear PAFR was increased at 30 min and peaked at 60 min after reoxygenation (Fig. 5a). Simultaneously,we found that the expression level of MFG-E8 fluctuated after reoxygenation and was higher than that under normal conditions (Fig. 5b). Then, microglia were treated with OGD for 3 h and reoxygenation for 60 min for subsequent experiments. Our results showed that the membrane-permeable antagonist Apafant attenuated the increase in mRNA level of MFG-E8, while membrane-impermeable antagonist Ginkgolide B had no effect (Fig. 5c). The results of MTT detection excluded the possibility that the alterations in MFG-E8 expression level resulted from the prevention of cell death by the two antagonists (Fig. 5d). These results indicated that nuclear PAFR regulated the transcriptional level of MFG-E8.

Several studies have reported that SP1 regulates the transcription of MFG-E8 by binding to the promoter regions³⁴. Our results showed that PAFR could co-immunoprecipitate with SP1 in BV2 cells, which was more significant after OGD-R treatment (Fig. 5e). Next, we isolated the nucleus-cytoplasm proteins and found that the protein expression level of nuclear PAFR was upregulated after OGD-R (Fig. 5f). Moreover, the co-immunoprecipitation of Sp1 with nuclear PAFR in BV2 cells increased after OGD-R, indicating that nuclear PAFR could interact with Sp1 (Fig. 5g). To exclude the indirect interaction between nuclear PAFR and Sp1, we used CHO-K1 cells to verify our speculation. PAFR and Sp1 were hardly expressed in the nucleus of CHO-K1 cells under normal culture (Fig. 5h). We transfected CHO-K1 cells with plasmids of wild-type PAFR (PAFR-HA), mutant PAFR (PAFR-310stop), and wild-type Sp1 (SP1-Flag). Of note, 310stop PAFR mutant transfection prevented the nuclear localization of PAFR in mouse-derived CHO-K1 cells compared to wild-type PAFR (Fig. 5i). After co-transfection with PAFR-HA and Sp1-Flag, or PAFR-310stop and Sp1-Flag, we found that nuclear PAFR could directly interact with Sp1 (Fig. 5j). Previous studies have reported that five potential MFG-E8 promoter binding sites with Sp1 were located at the region from − 444 (A), − 324 (B), − 94 (C), − 19 (D), and + 27 (E) to + 146 (Z) (Fig. 6a)³⁴. Our results demonstrated that Apafant and Plicamycin treatment could significantly abrogate OGD-R-induced increase in binding to SP1 at the region from + 27 to + 146 (E/Z) in BV2 cells by ChIP assay (Fig. 6f), while other regions showed no obvious changes (Fig. 6b–e). Taken together, the data showed that nuclear PAFR regulates the expression of MFG-E8 by cooperating with the transcription factor Sp1.

Membrane-permeable PAFR antagonist Apafant manifested significant therapeutic effects on ischemic stroke mice

Ginkgolide B, an active extract of Ginkgo biloba leaves, is a diterpenoid lactone; it is a natural and potent PAFR antagonist, which is available in an injectable form and used in the treatment of stroke in the convalescent stage^35–38. Our data showed that the nuclear PAFR antagonist Apafant showed more significant therapeutic effects on ischemic stroke mice compared to the membrane-impermeable PAFR antagonist Ginkgolide B (Fig. 6g–i).

In this study, we showed that nuclear PAFR mediates microglial phagocytosis of “stressed but salvageable” neurons after ischemic stroke, which is independent of PAF and synergistically promotes the transcription of MFG-E8 with the transcription factor Sp1 (Fig. 6j).

Ischemic stroke is a leading cause of death worldwide. The drugs used in the treatment of ischemic stroke include anticoagulants, defibrase, anti-platelet aggregation drugs, cerebrovascular dilators, brain protective agents, and traditional Chinese medicine for promoting blood circulation. Moreover, Ginkgolide B (Ginkgo biloba extract), a natural and potent PAFR antagonist, is widely used in the treatment of brain and peripheral blood circulation disorders, including ischemic stroke³⁹, acute pancreatitis⁴⁰, cardiovascular disease⁴¹, and cancers⁴². Further exploration of the functions of PAFR can identify additional uses in the treatment of ischemic stroke.

Our previous work showed that overexpression of miR-98 can protect salvageable neurons from microglial phagocytosis through inhibition of microglial PAFR in ischemic stroke. We further explored the specific mechanism underlying PAFR-mediated microglial phagocytosis. In our study, we identified the critical period and functions of PAFR in ischemic stroke. We established a mouse model of ischemic stroke from day 1 to week 5. After separating the core zone and penumbra field, we detected the mRNA and protein expression levels of PAFR over time. Our results showed that the mRNA and protein expression levels of PAFR peaked on day 5 in the core zone and were higher than those in the penumbra field. Immunostaining demonstrated PAFR-mediated microglial phagocytosis of “stressed but salvageable” neurons on days 3 and 5. Next, we generated PAFR knockout mice using Crispr/Cas9 techniques to determine the role of PAFR in microglial phagocytosis. Meanwhile, we used primary culture neurons and microglia to establish an in vitro co-culture system and treated the cells with OGD-R. Our in vivo and in vitro results showed that PAFR deficiency could inhibit the microglial phagocytosis of “stressed but viable” neurons and prevent neuronal death.

Several studies have reported that MFG-E8 mediates the pathway involved in microglial phagocytosis-induced neuronal loss^43–45. Neher et al. reported that MFG-E8 deletion blocks microglial phagocytosis after ischemic stroke and protects the ischemic brain by preventing delayed loss of active brain tissue rather than reducing the size of residual infarction^17,24,46. To explore whether PAFR mediated the regulation of phagocytic activity of microglia by MFG-E8 secretion, we detected the MFG-E8 expression in the core zone of ischemic stroke mice after PAFR deletion. Simultaneously, we induced the phagocytic phenotype of microglia by IL-4 administration. Our results demonstrated that in vivo PAFR deletion reduced the secretion of MFG-E8, while PAFR knockdown downregulated the mRNA expression of MFG-E8. Thus, we hypothesized that PAFR can regulate the transcription of MFG-E8. Next, we cultured primary microglia and observed the alterations in the expression levels of PAFR and MFG-E8 over time after reoxygenation. Intriguingly, we found that PAFR was abundantly located in the nucleus at 30 min and peaked at 60 min, whereas the mRNA expression level of MFG-E8 was also upregulated at 60 min. After treatment with the membrane permeable antagonist Apafant, the expression level of MFG-E8 was reversed after OGD-R. In contrast, treatment with the membrane impermeable antagonist Ginkgolide B showed no changes. These results indicated that the transcription of MFG-E8 may be regulated by nuclear PAFR. Moreover, we found that nuclear PAFR could interact with transcription SP1 to increase the transcription of MFG-E8, as observed on co-immunoprecipitation and ChIp assay. Finally, we demonstrated that Apafant had more significant therapeutic effects on ischemic stroke mice than Ginkogolide B.

In summary, our findings provide an explanation for the nuclear PAFR-mediated microglial phagocytosis. Our study revealed that nuclear PAFR as a novel therapeutic target for ischemic stroke and has implications for the selection of PAFR antagonists for the treatment of ischemic stroke. Moreover, our results support the concept that subcellular localization of GPCR is vital for drug discovery after injury or disease.

Our findings provide an explanation for the nuclear PAFR-mediated microglial phagocytosis and have implications for the selectivity of PAFR antagonists in the treatment of ischemic stroke based on the nuclear receptors target in the clinic.

ANOVA	Analysis of variance
ChIp	Chromatin immunoprecipitation
CNS CO-IP CZ DAPI	Central nervous system Co-Immunoprecipitation Core Zone 4–6-diamidino-2-phenylindole
GFAP	Glial fibrillary acidic protein
GPCR IACUC	G-protein coupled receptor Institutional Animal Care and Use Committee
IBA1	Ionized calcium binding adapter molecule 1
IF	Immunofluorescence
IL-4 MFG-E8 NC OGD-R PAF	Interleukin-4 Milk fat globule epidermal growth factor 8 Negative control Oxygen and glucose-deprivation and oxygenation Platelet activating factor
PAFR PBS PF PFA	Platelet activating factor receptor Phosphate-buffered solution Penumbra field Paraformaldehyde
Sp1 TF tMCAO TTC	Specificity protein 1 Transcription factor Transient middle cerebral artery occlusion 2,3,5 - triphenyl four azole nitrogen chloride

Ethical Approval and Consent to participate

All in vivo experiments were approved by Institution Animal Care and Use Committee (IACUC) of Nanjing Medical University and the Approval No. IACUC-1706013 & 1912041.

Consent for publication

All authors reviewed, provided substantive input, and approved of the final manuscript. All authors concur with the submission of this manuscript.

Availability of data and materials

The data have not been previously reported and are not under consideration for publication elsewhere, and study data are available.

Competing interests

The authors declare that they have no conflict of interests to report.

Funding

The National Natural Science Foundation of China (Nos. 82003732, 81973301 and 81773701), Medical Research Project of Jiangsu Commision of Health ( No. ZDA2020006), Priority Academic Program Development of Jiangsu Higer Education Institutions, and the Postgraduate Research and Practice Innovation Program of Jiangsu Province (No.KYCX20_1417).

Author contributions

Jin Yang & Juan Ji, conception and design, performing experiments, acquisition, analysis and interpretation of data and writing the paper; Yu-Qin Sun performing the experiments, acquisition and interpreting the data; Shang-Ze Li & Zi-Kai Jiang performing the experiments; Yin-Feng Dong revising the article performing the experiments; Xiu-Lan Sun, conception and design, acquisition, analysis and interpretation of data; revising the article critically for important intellectual content; and final approval of the version to be published.

Feigin VL. Anthology of stroke epidemiology in the 20th and 21st centuries: Assessing the past, the present, and envisioning the future. International journal of stroke: official journal of the International Stroke Society. Apr 2019;14(3):223–237. doi:10.1177/1747493019832996
Rust R, Gronnert L, Weber RZ, Mulders G, Schwab ME. Refueling the Ischemic CNS: Guidance Molecules for Vascular Repair. Trends Neurosci. Sep 2019;42(9):644–656. doi:10.1016/j.tins.2019.05.006
Bernhardt J, Hayward KS, Dancause N, et al. A Stroke Recovery Trial Development Framework: Consensus-Based Core Recommendations from the Second Stroke Recovery and Rehabilitation Roundtable. Neurorehabilitation and neural repair. Nov 2019;33(11):959–969. doi:10.1177/1545968319888642
Toscano EC, Silva BC, Victoria EC, et al. Platelet-activating factor receptor (PAFR) plays a crucial role in experimental global cerebral ischemia and reperfusion. Brain research bulletin. Jun 2016;124:55–61. doi:10.1016/j.brainresbull.2016.03.022
Penna C, Bassino E, Alloatti G. Platelet activating factor: the good and the bad in the ischemic/reperfused heart. Experimental biology and medicine (Maywood, NJ). Apr 01 2011;236(4):390–401. doi:10.1258/ebm.2011.010316
Kim YH, Bae JU, Lee SJ, Park SY, Kim CD. SIRT1 attenuates PAF-induced MMP-2 production via down-regulation of PAF receptor expression in vascular smooth muscle cells. Vascular pharmacology. Sep 2015;72:35–42. doi:10.1016/j.vph.2015.04.015
Brewer C, Bonin F, Bullock P, et al. Platelet activating factor-induced apoptosis is inhibited by ectopic expression of the platelet activating factor G-protein coupled receptor. Journal of neurochemistry. Sep 2002;82(6):1502–11.
Lee CM, Jung WK, Na G, et al. Inhibitory effects of the platelet-activating factor receptor antagonists, CV-3988 and Ginkgolide B, on alkali burn-induced corneal neovascularization. Cutaneous and ocular toxicology. Mar 2015;34(1):53–60. doi:10.3109/15569527.2014.903573
Abhilasha KV, Sumanth MS, Chaithra VH, et al. p38 MAP-kinase inhibitor protects against platelet-activating factor-induced death in mice. Free radical biology & medicine. Nov 1 2019;143:275–287. doi:10.1016/j.freeradbiomed.2019.08.019
Chaithra VH, Jacob SP, Lakshmikanth CL, et al. Modulation of inflammatory platelet-activating factor (PAF) receptor by the acyl analogue of PAF. Journal of lipid research. Nov 2018;59(11):2063–2074. doi:10.1194/jlr.M085704
Bhosle VK, Rivera JC, Chemtob S. New insights into mechanisms of nuclear translocation of G-protein coupled receptors. Small GTPases. Jul 2019;10(4):254–263. doi:10.1080/21541248.2017.1282402
Estrada R, Wang L, Jala VR, et al. Ligand-induced nuclear translocation of S1P(1) receptors mediates Cyr61 and CTGF transcription in endothelial cells. Histochem Cell Biol. Feb 2009;131(2):239–49. doi:10.1007/s00418-008-0521-9
Joyal JS, Nim S, Zhu T, et al. Subcellular localization of coagulation factor II receptor-like 1 in neurons governs angiogenesis. Nature medicine. Oct 2014;20(10):1165–73. doi:10.1038/nm.3669
Zhang Y, Chen K, Sloan SA, et al. An RNA-sequencing transcriptome and splicing database of glia, neurons, and vascular cells of the cerebral cortex. The Journal of neuroscience: the official journal of the Society for Neuroscience. Sep 3 2014;34(36):11929-47. doi:10.1523/jneurosci.1860-14.2014
Bellizzi MJ, Geathers JS, Allan KC, Gelbard HA. Platelet-Activating Factor Receptors Mediate Excitatory Postsynaptic Hippocampal Injury in Experimental Autoimmune Encephalomyelitis. The Journal of neuroscience: the official journal of the Society for Neuroscience. Jan 27 2016;36(4):1336–46. doi:10.1523/JNEUROSCI.1171-15.2016
Ferracini M, Rios FJ, Pecenin M, Jancar S. Clearance of apoptotic cells by macrophages induces regulatory phenotype and involves stimulation of CD36 and platelet-activating factor receptor. Mediators of inflammation. 2013;2013:950273. doi:10.1155/2013/950273
Brown GC, Neher JJ. Microglial phagocytosis of live neurons. Nature reviews Neuroscience. Apr 2014;15(4):209–16. doi:10.1038/nrn3710
Brown GC. Neuronal Loss after Stroke Due to Microglial Phagocytosis of Stressed Neurons. International journal of molecular sciences. Dec 14 2021;22(24)doi:10.3390/ijms222413442
Otxoa-de-Amezaga A, Miro-Mur F, Pedragosa J, et al. Microglial cell loss after ischemic stroke favors brain neutrophil accumulation. Acta neuropathologica. Feb 2019;137(2):321–341. doi:10.1007/s00401-018-1954-4
Pluvinage JV, Haney MS, Smith BAH, et al. CD22 blockade restores homeostatic microglial phagocytosis in ageing brains. Nature. Apr 2019;568(7751):187–192. doi:10.1038/s41586-019-1088-4
Brown GC, Neher JJ. Inflammatory neurodegeneration and mechanisms of microglial killing of neurons. Mol Neurobiol. Jun 2010;41(2–3):242–7. doi:10.1007/s12035-010-8105-9
Yang J, Cao LL, Wang XP, et al. Neuronal extracellular vesicle derived miR-98 prevents salvageable neurons from microglial phagocytosis in acute ischemic stroke. Cell death & disease. Jan 6 2021;12(1):23. doi:10.1038/s41419-020-03310-2
Bhosle VK, Rivera JC, Zhou TE, et al. Nuclear localization of platelet-activating factor receptor controls retinal neovascularization. Cell Discov. 2016;2:16017. doi:10.1038/celldisc.2016.17
Neher JJ, Emmrich JV, Fricker M, Mander PK, Thery C, Brown GC. Phagocytosis executes delayed neuronal death after focal brain ischemia. Proceedings of the National Academy of Sciences of the United States of America. Oct 22 2013;110(43):E4098-107. doi:10.1073/pnas.1308679110
Fricker M, Neher JJ, Zhao JW, Thery C, Tolkovsky AM, Brown GC. MFG-E8 mediates primary phagocytosis of viable neurons during neuroinflammation. The Journal of neuroscience: the official journal of the Society for Neuroscience. Feb 22 2012;32(8):2657–66. doi:10.1523/jneurosci.4837-11.2012
Ashwal S, Tone B, Tian HR, Cole DJ, Pearce WJ. Core and penumbral nitric oxide synthase activity during cerebral ischemia and reperfusion. Stroke. May 1998;29(5):1037–46; discussion 1047.
Koizumi S, Hirayama Y, Morizawa YM. New roles of reactive astrocytes in the brain; an organizer of cerebral ischemia. Neurochemistry international. Oct 2018;119:107–114. doi:10.1016/j.neuint.2018.01.007
Morizawa YM, Hirayama Y, Ohno N, et al. Reactive astrocytes function as phagocytes after brain ischemia via ABCA1-mediated pathway. Nature communications. Jun 22 2017;8(1):28. doi:10.1038/s41467-017-00037-1
Zheng K, Lin L, Jiang W, et al. Single-cell RNA-seq reveals the transcriptional landscape in ischemic stroke. Journal of cerebral blood flow and metabolism: official journal of the International Society of Cerebral Blood Flow and Metabolism. Jan 2022;42(1):56–73. doi:10.1177/0271678x211026770
Beuker C, Schafflick D, Strecker JK, et al. Stroke induces disease-specific myeloid cells in the brain parenchyma and pia. Nature communications. Feb 17 2022;13(1):945. doi:10.1038/s41467-022-28593-1
Kronenberg G, Uhlemann R, Richter N, et al. Distinguishing features of microglia- and monocyte-derived macrophages after stroke. Acta neuropathologica. Apr 2018;135(4):551–568. doi:10.1007/s00401-017-1795-6
Wilhelmsson U, Andersson D, de Pablo Y, et al. Injury Leads to the Appearance of Cells with Characteristics of Both Microglia and Astrocytes in Mouse and Human Brain. Cerebral cortex. Jun 1 2017;27(6):3360–3377. doi:10.1093/cercor/bhx069
Ting SM, Zhao X, Zheng X, Aronowski J. Excitatory pathway engaging glutamate, calcineurin, and NFAT upregulates IL-4 in ischemic neurons to polarize microglia. Journal of cerebral blood flow and metabolism: official journal of the International Society of Cerebral Blood Flow and Metabolism. Mar 2020;40(3):513–527. doi:10.1177/0271678x19838189
Wang X, Bu HF, Liu SX, De Plaen IG, Tan XD. Molecular Mechanisms Underlying the Regulation of the MFG-E8 Gene Promoter Activity in Physiological and Inflammatory Conditions. J Cell Biochem. Sep 2015;116(9):1867–79. doi:10.1002/jcb.25142
Wu X, Zhou C, Du F, et al. Ginkgolide B preconditioning on astrocytes promotes neuronal survival in ischemic injury via up-regulating erythropoietin secretion. Neurochemistry international. Jan 2013;62(2):157–64. doi:10.1016/j.neuint.2012.11.007
Xia SH, Fang DC. Pharmacological action and mechanisms of ginkgolide B. Chinese medical journal. May 20 2007;120(10):922–8.
Huang M, Qian Y, Guan T, Huang L, Tang X, Li Y. Different neuroprotective responses of Ginkgolide B and bilobalide, the two Ginkgo components, in ischemic rats with hyperglycemia. European journal of pharmacology. Feb 29 2012;677(1–3):71–6. doi:10.1016/j.ejphar.2011.12.011
Shu ZM, Shu XD, Li HQ, et al. Ginkgolide B Protects Against Ischemic Stroke Via Modulating Microglia Polarization in Mice. CNS neuroscience & therapeutics. Sep 2016;22(9):729 – 39. doi:10.1111/cns.12577
Zhu T, Wang L, Wang LP, Wan Q. Therapeutic targets of neuroprotection and neurorestoration in ischemic stroke: Applications for natural compounds from medicinal herbs. Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie. Apr 2022;148:112719. doi:10.1016/j.biopha.2022.112719
Lou C, Lu H, Ma Z, Liu C, Zhang Y. Ginkgolide B enhances gemcitabine sensitivity in pancreatic cancer cell lines via inhibiting PAFR/NF-кB pathway. Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie. Jan 2019;109:563–572. doi:10.1016/j.biopha.2018.10.084
Huang L, Shi Y, Zhao L. Ginkgolide B Alleviates Learning and Memory Impairment in Rats With Vascular Dementia by Reducing Neuroinflammation via Regulating NF-κB Pathway. Front Pharmacol. 2021;12:676392. doi:10.3389/fphar.2021.676392
Kawasaki K, Kasamatsu A, Ando T, et al. Ginkgolide B Regulates CDDP Chemoresistance in Oral Cancer via the Platelet-Activating Factor Receptor Pathway. Cancers. Dec 15 2021;13(24)doi:10.3390/cancers13246299
Kurematsu C, Sawada M, Ohmuraya M, et al. Synaptic pruning of murine adult-born neurons by microglia depends on phosphatidylserine. The Journal of experimental medicine. Apr 4 2022;219(4)doi:10.1084/jem.20202304
Cai X, Li Y, Zheng X, et al. Propofol suppresses microglial phagocytosis through the downregulation of MFG-E8. Journal of neuroinflammation. Jan 9 2021;18(1):18. doi:10.1186/s12974-020-02061-3
Neniskyte U, Fricker M, Brown GC. Amyloid β induces microglia to phagocytose neurons via activation of protein kinase Cs and NADPH oxidase. The international journal of biochemistry & cell biology. Dec 2016;81(Pt B):346–355. doi:10.1016/j.biocel.2016.06.005
Neher JJ, Neniskyte U, Zhao JW, Bal-Price A, Tolkovsky AM, Brown GC. Inhibition of microglial phagocytosis is sufficient to prevent inflammatory neuronal death. Journal of immunology (Baltimore, Md: 1950). Apr 15 2011;186(8):4973-83. doi:10.4049/jimmunol.1003600

No competing interests reported.

Supplementarymaterials.docx

Download PDF

Version 1

posted

You are reading this latest preprint version

Nuclear localization of platelet-activating factor receptor accounts for microglial phagocytosis in ischemic stroke

Status:

Version 1

Abstract

Figures

Introduction

Materials And Methods

Animals

Generation of PAFR knockout mice

Establishment of cerebral ischemia stroke model

Quantitative Reverse Transcription-Polymerase Chain Reaction (qRT-PCR)

Western blotting

Nissl Staining

Immunofluorescence and confocal image acquisition

Primary neuron and microglia cultures

Primary neuron-microglia physical coculture

Oxygen and glucose deprivation and reoxygenation (OGD-R)

The detection of microglial phagocytosis

Drug treatment

Coimmunoprecipitation (CO-IP) assay

Chromatin immunoprecipitation (ChIP)

Statistical analysis

Results

PAFR mediated the microglial phagocytosis of “stressed but salvageable” neurons after ischemic stroke

PAFR can promote the expression of the phagocytic gene MFG-E8

Nuclear PAFR synergistically promotes the transcription of MFG-E8 by the transcription factor Sp1

Membrane-permeable PAFR antagonist Apafant manifested significant therapeutic effects on ischemic stroke mice

Discussion

Conclusion

Abbreviations

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1