Intracellular BAPTA directly inhibits PFKFB3, thereby impeding mTORC1-driven Mcl-1 translation and killing Mcl-1-addicted cancer cells

doi:10.21203/rs.3.rs-1734783/v1

Download PDF

Article

Intracellular BAPTA directly inhibits PFKFB3, thereby impeding mTORC1-driven Mcl-1 translation and killing Mcl-1-addicted cancer cells

https://doi.org/10.21203/rs.3.rs-1734783/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 08 Sep, 2023

Read the published version in Cell Death & Disease →

You are reading this latest preprint version

Intracellular Ca²⁺ signals control several physiological and pathophysiological processes. The main tool to chelate intracellular Ca²⁺ is intracellular BAPTA (BAPTA_i), usually introduced into cells as a membrane-permeant acetoxymethyl ester (BAPTA-AM). We previously demonstrated that BAPTA_i enhanced apoptosis induced by venetoclax, a Bcl-2 antagonist, in diffuse large B-cell lymphoma (DLBCL). These findings implied a novel interplay between intracellular Ca²⁺ signaling and anti-apoptotic Bcl-2 function. Hence, we set out to identify the underlying mechanisms by which BAPTA_i enhances cell death in B-cell cancers. In this study, we observed that BAPTA_i alone induced apoptosis in lymphoma cell models that were highly sensitive to S63845, an Mcl-1 antagonist. BAPTA_i provoked a rapid decline in Mcl-1 protein levels by inhibiting mTORC1-driven MCL-1 translation. Overexpression of nondegradable Mcl-1 rescued BAPTA_i-induced cell death. We further examined how BAPTA_i diminished mTORC1 activity and found that BAPTA_i impaired glycolysis by directly inhibiting 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase 3 (PFKFB3) activity, an up to now unkown effect of BAPTA_i. All aforementioned effects of BAPTA_i were also elicited by a BAPTA_i analog with low affinity for Ca²⁺. Thus, our work reveals PFKFB3 inhibition as an unappreciated Ca²⁺-independent mechanism by which BAPTA_i impairs cellular metabolism and ultimately the survival of Mcl-1-dependent cancer cells. Our work has two important implications. First, direct inhibition of PFKFB3 emerged as a key regulator of mTORC1 activity and a promising target in the treatment of Mcl-1-dependent cancers. Second, cellular effects caused by BAPTA_i are not necessarily related to Ca²⁺ signaling. Our data support the need for a reassessment of the role of Ca²⁺ in cellular processes when findings were based on the use of BAPTA_i.

Biological sciences/Chemical biology/Target identification

Biological sciences/Cell biology/Cell death/Apoptosis

Biological sciences/Cancer/Haematological cancer/Lymphoma

Biological sciences/Biochemistry/Metabolomics

Biological sciences/Cell biology/Cell signalling/Calcium signalling

Intracellular Ca²⁺ is a ubiquitous second messenger that controls cellular processes ranging from fertilization and cell division to cell death(1),(2).

Cancer cells attenuate intracellular Ca²⁺ signaling, thereby promoting tumorigenesis and conferring resistance to chemotherapeutic regimens(3),(4). Several tumor suppressor proteins and (proto)-oncogenes, including anti-apoptotic members of the Bcl-2 family, directly modulate Ca²⁺ fluxes to enhance survival(5)–(8).

Moreover, anti-apoptotic Bcl-2 family members, including Bcl-2, Bcl-XL and Mcl-1, inhibit the mitochondrial apoptotic pathway(9). Increased abundance of anti-apoptotic Bcl-2, the founding member of the family, is found in several B-cell malignancies, including diffuse large B-cell lymphoma (DLBCL), thereby counteracting pro-apoptotic signaling induced by oncogenic stress(10). This “primed to death” status represents an Achilles’ heel in cancers that can be exploited by BH3-mimetic drugs (such as venetoclax), which antagonize anti-apoptotic Bcl-2 proteins. However, venetoclax resistance in cancer cells has already emerged due to acquired mutations in Bcl-2 and upregulation of Bcl-XL or Mcl-1(11). Hence, selective BH3-mimetic antagonists have been developed for Bcl-XL (including A-1331852, A-1155463 and WEHI-539) and Mcl-1 (S63845), thereby driving cell death in Bcl-XL- and Mcl-1-dependent cancer cells(12),(13).

We previously demonstrated that intracellular BAPTA (BAPTA_i), a widely used, high-affinity chelator of cytosolic Ca²⁺ loaded into cells as BAPTA-acetoxymethyl ester (BAPTA-AM), enhanced venetoclax-induced cell death in OCI-LY-1 and SU-DHL-4 cells, two DLBCL cell models(14). Extracellularly added BAPTA-AM can pass across the plasma membrane and thus enter the cell, where it is hydrolyzed into the free acid form of BAPTA that chelates cytosolic Ca²⁺. As such, BAPTA is trapped in the cells. BAPTA-AM is typically applied in the extracellular environment at about 10 µM. However, due to the accumulation of the hydrolyzed free acid form, which is cell membrane-impermeant, intracellular BAPTA concentrations that can reach 1 to 2 mM (15).

Given the fast Ca²⁺-chelating properties enabling BAPTA_i to buffer Ca²⁺ in close proximity to Ca²⁺ channels and microdomains, our results suggested an unprecedented interplay between constitutive Ca²⁺ signaling and the anti-apoptotic function of Bcl-2 proteins in B-cell cancer cells. However, intracellularly loaded BAPTA, and its derivatives, may also interfere with cell physiological processes independently of its Ca²⁺-chelating properties by directly targeting proteins such as the Na⁺/K⁺ ATPase(15),(16).

Despite the emerging evidence for off-target effects, BAPTA_i continues to be widely used without adequate controls(16). Indeed, thousands of publications have used such chemical Ca²⁺ buffers to delineate the involvement of Ca²⁺ signals in specific cellular processes(17)–(20). Moreover, since BAPTA_i can theoretically buffer microscopic ‘local Ca²⁺ signals’ originating in close proximity to Ca²⁺ channels, BAPTA_i has routinely been used to determine the involvement of Ca²⁺ in a cellular process without actually visualizing the Ca²⁺ signals. A significant confounding issue is that by directly affecting targets independently of its Ca²⁺-chelating properties, the cellular actions of BAPTA_i and related compounds may not be limited to Ca²⁺ buffering(21),(22). This urges an in-depth investigation into this unanticipated property of chemical Ca²⁺ buffers(16). Understanding the mechanism by which BAPTA_i affects B-cell cancer cell survival and augments their sensitivity to Bcl-2 inhibitors is not only important for developing improved anticancer strategies but also key to unraveling which processes underlie this fascinating interplay.

Here, we aimed to decipher the molecular mechanisms by which BAPTA_i impacted cancer cell survival. We found that BAPTA_i by itself could evoke cell death in Mcl-1-dependent cancer cells, but not in those cells not addicted to Mcl-1. To distinguish between Ca²⁺-dependent versus Ca²⁺-independent effects of BAPTA_i, we used a variety of BAPTA derivatives (Fig. 1), including tetrafluoro-BAPTA_i (TF-BAPTA_i), whose affinity for Ca²⁺ is about 400-fold lower (K_D ~65 µM) than that of BAPTA (K_D ~160 nM). As such, the affinity of TF-BAPTA_i for Ca²⁺ is 500 to 600-fold lower than the basal cytosolic Ca²⁺ concentration, which is about 100 nM. However, similarly to BAPTAi, TF-BAPTA_i was equally potent in inducing the death of Mcl-1-addicted cancer cells. Using a broad array of approaches, we revealed a novel Ca²⁺-independent, inhibitory effect of BAPTA_i on glycolysis, thereby rapidly suppressing mTORC1 activity and thus abrogating mTORC1-driven processes such as Mcl-1 translation. Due to its short-lived nature, Mcl-1 protein levels rapidly decline in BAPTA_i-loaded cells. In cancer cells, or genetically engineered cells that are dependent on Mcl-1 for cell survival, BAPTA_i (and TF-BAPTA_i) therefore provokes significant cell death, irrespective of intracellular Ca²⁺ buffering. We further identified the presumed BAPTA target, demonstrating that BAPTA directly inhibited 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase-3 (PFKFB3). In addition, direct PFKFB3 inhibition using AZ67 mimicked the inhibitory effect of BAPTA_i on mTORC1 activity and Mcl-1 protein levels. Overall, our work sheds novel light on the cellular effects and direct targets of BAPTA_i, revealing a novel link between PFKFB3, mTORC1 and Mcl-1 irrespective of Ca²⁺ chelation.

1. Cell culture and transfections

SU-DHL-4 and OCI-LY-1 DLBCL cell lines were kindly provided by Dr. Anthony Letai (Dana Farber Cancer Institute, Boston, Massachusetts, USA). H929 cells were purchased from DSMZ (Braunschweig, Germany). OCI-LY-1 cells were cultured in suspension in Iscove modified Dulbecco’s medium (IMDM, Life Technologies, Brussels, Belgium). SU-DHL-4 and H929 cells were cultured in suspension in Roswell Park Memorial Institute (RPMI-1640) medium (Life Technologies, Brussels, Belgium). Mito-primed seminal vesicle epithelial cells (SVECs) were kindly obtained from Prof. Stephen Tait.(23) All media were supplemented with 10% fetal bovine serum (FBS, Life Technologies), 2% GlutaMAX™ Supplement (Life Technologies, Brussels, Belgium) and 2% penicillin/streptomycin (Life Technologies, Brussels, Belgium). Cultures were incubated at 37°C and 5% CO_2, and sterile conditions were maintained at all times. Cells were validated through STR profiling and were cultured in mycoplasma-free conditions, whereby cell cultures were monitored once every two weeks for mycoplasma infection. Research with human cell lines was approved by ethical committee UZ Leuven (S63808).

2. Transfection

Twenty-four hours after seeding, OCI-LY-1 cells were transfected using the Amaxa® Cell Line Nucleofector® Kit L (Lonza, Basel, Switzerland), program C-05 as previously described(46). Cells were briefly transfected with the constructs described below and collected at 18 hours posttransfection to use in experiments and to confirm transfection via western blot.

3. Reagents, antibodies and constructs

The following reagents were used in this study. EGTA (Acros Organics, Geel, Belgium, 409910250), dimethyl sulfoxide (DMSO, Sigma-Aldrich, Overijse, Belgium), Fura-2-AM (Life Technologies, Carlsbad, CA, USA, F1221), 2-DG (Sigma-Aldrich, Overijse, Belgium; purity ≥ 98%), 1,2-Bis-(o-Aminophenoxy)-ethane-N,N,N’,N’-tetraacetic acid, tetraacetoxymethyl ester (BAPTA-AM, Life Technologies, Brussels, Belgium), 5,5’,6,6’-Tetrafluoro-BAPTA-AM (Interchim, Montluçon, France), 5,5’-difluoro-BAPTA-AM and 5,5’-dimethyl-BAPTA-AM (Sigma Aldrich, Overijse, Belgium), S63845 (Gentaur, Kampenhout, Belgium), venetoclax (ABT-199, Active Biochem, Kowloon, Hong Kong), A1155463 (Selleck Chemicals, Houston, USA), Z-Val-Ala-DL-Asp(OMe)-fluoromethylketone (ZVAD-(OMe)-FMK, ABCAM, Cambridge, UK) cycloheximide (C7698, Sigma-Aldrich, Overijse, Belgium), AZ PFKFB3 67 (Bio-techne, Abingdon, UK).

In addition to BAPTA itself, three different BAPTA analogs were used in this study: tetrafluoro-BAPTA (TF-BAPTA), difluoro-BAPTA (DF-BAPTA) and dimethyl-BAPTA (DM-BAPTA) (Fig. 1). The value of EGTA reported is obtained at pH 7.4 and 20°C. Whereas placing fluor groups on the benzene ring of BAPTA (para- position, or meta- and para- positions, for DF-BAPTA and TF-BAPTA, respectively) severely reduces the affinity for binding Ca²⁺, methyl groups (para position) augment the Ca²⁺-chelating properties of BAPTA. All of the Ca²⁺ chelators used in this study were introduced into the cells as acetoxymethyl esters using standard loading procedures.

The following primary antibodies were used in this study: anti-Mcl-1 (4572, Cell Signaling Technology), anti-Bcl-XL (MA5-15142, Invitrogen), anti-Bcl-2 HRP (sc-7382, Santa Cruz), anti-vinculin (V9131, Sigma Aldrich), anti-P-p70S6K (9234S, Cell Signaling Technology), anti-p70S6K (9202S, Cell Signaling Technology), anti-GFP, anti-PARP (9542S, Cell Signaling Technology), and anti-β actin (A5441, Sigma Aldrich).

The pcDNA3.1 vector bearing the sequence of the nondegradable human gene Mcl-1 with mutated ubiquitination sites, referred to as Mcl-1^K/R was kindly provided by Professor Marc Diederich(47). Corresponding empty control plasmids were used in parallel. pcDNA3.1-hMcl-1 was a gift from Roger Davis (Addgene plasmid 25375, Cambridge, MA, USA) and is indicated in the text as WT Mcl-1. Bcl-XL overexpression was achieved using a pcDNA3.1(+) vector encoding human Bcl-XL.

The Mcl-1 5’UTR sequence inserted into the pcDNA3.1 plasmid to generate a GFP reporter construct was GCGGCCGCGCAACCCTCCGGAAGCTGCCGCCCCTTTCCCCTTTTATCGGAATACTTTTTTTAAAAAAAAAGAGT
TCGCTGGCGCCACCCCGTAGGACTGGCCGCCCTAAAAGTGATAAAGGAGCTGCTCGCCACTTCTCACTTCCGCT
TCCTTCCAGTAAGGAGTCGGGGTCTTCCCCAGTTTTCTCAGCCAGGCGGCGGACTGGCAGAATTC. A scrambled
Mcl-1 5’UTR sequence served as a negative control: GCGGCCGCAGTTTTTAGTACAGCAGCCCCCCATAACGGCGCCGCCTAGCGCTCAGTAGTCTTTTAGGCGTTGGG
AACAGTGCTGCACGATAGGGTCGTCTCCAGCGGGCCATTGTTGCATACACCATACCGCTGGCGTTATCCCTGTG
CATCCGGGCTCATCCGCCAACCTGGTACCACTAGCATCTTATCCCAAAGGGCCGACCATTTCCCACGGAATTC.

4. Apoptosis assay

Cells (5 × 10⁵ cells/ml) were treated as indicated in the Results, pelleted by centrifugation, and incubated with annexin V-FITC/7-AAD or annexin V-APC in the presence of annexin V binding buffer. Cell suspensions were analyzed with an Attune® Acoustic Focusing Flow Cytometer (Applied Biosystems). Cell death by apoptosis was scored by quantifying the population of annexin V-FITC-positive cells (blue laser; BL-1) or annexin V-APC-positive cells (red laser; RL-1). Flow cytometric data were plotted and analyzed using FlowJo software (version 10).

5. RNA extraction and PCR analysis

Cells were harvested and centrifuged for 5 minutes at 500 × g. RNA was extracted using the HighPure RNA Isolation kit (Roche, Mannheim, Germany; # 11828665001) according to the manufacturer’s protocol. cDNA was prepared using the High Capacity cDNA Reverse Transcription kit (Applied Biosystems, Brussels, Belgium; # 4368814) according to the manufacturer’s protocol. mRNA was amplified using GoTaq Green master mix (Promega, Leiden, The Netherlands; # M7112) and specific primers for the mRNA of interest (IDT, Leuven, Belgium) and separated on a 2.5% Ultrapure agarose (Invitrogen, # 16500-500) gel containing 0.005% EtBr (Invitrogen, # 15585-011).

6. Western blot analysis

Cells were washed with phosphate-buffered saline and incubated at 4°C with lysis buffer (20 mM Tris − HCl (pH 7.5), 150 mM NaCl, 1.5 mM MgCl₂, 0.5 mM dithiothreitol, 1% Triton-X-100, and one tablet of complete EDTA-free protease inhibitor (Thermo Scientific, Brussels, Belgium)) for 30 minutes. Cell lysates were centrifuged for 5 minutes at 12000 × g and analyzed by Western blotting as previously described(48). Western blot quantification was performed using Image Lab 5.2 software.

7. Cytosolic Ca²⁺ measurements

OCI-LY-1 cells were seeded in poly-L-lysine-coated 96-well plates (Greiner Bio One, Vilvoorde, Belgium) at a density of 5 × 10⁵ cells/ml. The cells were loaded for 30 minutes with 1.25 µM Fura-2-AM at 25°C in modified Krebs solution, followed by a 30- minute treatment with the compounds of interest. Fluorescence was monitored on a FlexStation 3 microplate reader (Molecular Devices, Sunnyvale, CA, USA) by alternately exciting the Ca²⁺ indicator at 340 and 380 nm and collecting emitted fluorescence above 510 nm, as described previously(49).

8. Live cell imaging

OCI-LY-1 cells (5 x 10⁶) were transfected with a pcDNA3.1 plasmid bearing either the CMV 5’ UTR, a scrambled Mcl-1 5’ UTR or the original 5’ UTR. All vectors expressed GFP, and both cell confluence and GFP intensity were measured. Following transfection, the cells were incubated in the IncuCyte® Live Cell Analyzer, and microscopic pictures (Nikon 10x objective) were taken every two hours. After four hours, the cells were treated with 10 µM pan-caspase inhibitor ZVAD-OMe-FMK and 30 minutes later with 10 µM vehicle, TF-BAPTA-AM or BAPTA-AM. The cell plate was subsequently placed in IncuCyte® for another 20 hours.

9. Metabolic flux analysis

Glycolysis was measured with the Seahorse Glycolysis Stress Test on a Seahorse XFe24 Analyzer (Agilent Technologies, Heverlee, Belgium), which determines the extracellular acidification rate (ECAR) as a measure of glycolytic activity. OCI-LY-1 cells (5 × 10⁵ cells/ml) were pretreated for 1 hour in Seahorse Seahorse XF base medium supplemented with glutamine (103334-100, Agilent Technologies, Heverlee, Belgium) in a CO₂-free incubator. After pretreatment, the ECAR was measured after the subsequent addition of glucose (10 mM final concentration), oligomycin (1 µM final concentration) and 2-deoxyglucose (2-DG, 50 mM final concentration) to assess normal glycolytic activity, maximal glycolytic activity and the nonglycolytic acidification level, respectively. Afterwards, protein concentrations in each well were measured using the BCA assay and used for normalization.

10. Extracellular lactate assay

OCI-LY-1 cells (5 x 10⁵ cells/ml) were washed twice in prewarmed PBS and resuspended in Seahorse XF base medium supplemented with glutamine (103334-100, Agilent Technologies, Heverlee, Belgium). Cells were treated with compounds of interest as indicated, and glucose (10 mM) was added 30 minutes after treatment. Extracellular lactate was measured according to the manufacturer’s protocol using the Lactate-Glo™ Assay kit (J5021, Promega, Leiden, The Netherlands).

11. Tracer metabolomics analysis

OCI-LY-1 cells were seeded at 3 x 10⁵ cells/ml in IMDM without glucose (AL230A, HiMedia, Mumbai, India) and supplemented with 4.5 mg/ml ¹³C or ¹²C glucose, 10% dialyzed FBS (A3382001, Thermo Scientific, Brussels, Belgium) and 2% penicillin/streptomycin (Life Technologies, Brussels, Belgium). After 24 hours, the cells were treated with vehicle or the indicated compound. One hour later, the cells were centrifuged at 1500 x g for 5 minutes at 4°C, washed with 1 ml of ice-cold NaCl (150 mM in H₂O) and again centrifuged under the same conditions. Subsequently, the washing solution was removed, and 150 µL of extraction buffer (80% MeOH at − 80°C) was added using a precooled pipet tip. Cells were vortexed until the pellet was completely dissolved. The solution was centrifuged at 20 000 x g for 15 minutes at 4°C, the supernatant was used for further analysis, and the protein pellet was used to measure the protein concentration (BCA assay).

Ten microliters of each supernatant sample was loaded into a Dionex UltiMate 3000 LC System (Thermo Scientific Bremen, Germany) equipped with a C-18 column (Acquity UPLC -HSS T3 1. 8 µm; 2.1 x 150 mm, Waters) coupled to a Q Exactive Orbitrap mass spectrometer (Thermo Scientific) operating in negative ion mode. A step gradient was carried out using solvent A (10 mM TBA and 15 mM acetic acid) and solvent B (100% MeOH). The gradient started with 0% solvent B and 100% solvent A and remained at 0% B until 2 minutes post injection. A linear gradient to 37% B was carried out until 7 minutes and increased to 41% until 14 minutes. Between 14 and 26 minutes, the gradient increased to 100% B and remained at 100% B for 4 minutes. At 30 minutes, the gradient returned to 0% B. The chromatography was stopped at 40 minutes. The flow was kept constant at 250 µL/min, and the column was placed at 25°C throughout the analysis. The MS operated in full scan mode (m/z range: [70–1050]) using a spray voltage of 3.2 kV, capillary temperature of 320°C, sheath gas at 10.0, and auxiliary gas at 5.0. The AGC target was set at 3e6 using a resolution of 140.000, with a maximum IT fill time of 512 ms. Data collection was performed using Xcalibur software (Thermo Scientific). The data analysis was performed by integrating the peak areas (El-Maven – Polly - Elucidata).

12. PFKFB3 kinase activity assay

Biochemical Assay Principle: PFKFB3 enzyme activity was estimated by calculating the amount of ADP generated in a kinase reaction. ADP generation was measured using an ADP Glo kit (Promega, Leiden, The Netherlands) with no deviation from the recommended protocol.

Kinase activity assay: PFKFB3 kinase activity was measured according to a published protocol with slight modifications.(26) Briefly, 2X base buffer was prepared as a standard for all kinase reactions. This buffer contained 100 mM HEPES (pH 7.5), 200 mM KCl, 10 mM MgCl₂, 8 mM dithiothreitol, 0.02% Triton X100, 0.02% BSA and 4 mM fructose 6-phosphate. Immediately prior to starting the assay, kinase enzyme was added to the base buffer at a 2X concentration of 40 nM. Each well with PFKFB3 enzyme received 2 µL of the 2X enzyme/base buffer solution. Compounds of interest (1 µL) were added, followed by a 30-minute preincubation. Next, 1 µL containing 80 ATP µM was added (giving a final concentration of 20 µM ATP, 2 mM fructose 6-phosphate and 20 mM enzyme) to start the reaction. The kinase reaction was stopped after two hours by adding 4 µL of ADP-Glo Reagent. One hour later, 8 µL of ADP-Glo Detection Reagent was added. After an additional hour, a PerkinElmer Envision® with an enhanced luminescence module was used to measure the luminescence signal generated in each well. For background subtraction, wells receiving ATP but enzyme-free base buffer and without compound addition were used. To verify the potential effect of compounds on the ADP-Glo kit enzymes (counter assay), wells with compounds received enzyme-free base buffer.

13. Molecular docking

The PFKFB3 protein structure in dimeric form was retrieved from the PDB (3qpv)(50) and prepared for docking using the protonate3D functionality implemented in MOE (Molecular Operating Environment (MOE), 2020.09 Chemical Computing Group ULC, 1010 Sherbooke St. West, Suite #910, Montreal, QC, Canada, H3A 2R7, 2022.). The BAPTA (and EGTA) ligand was also modeled in MOE using the mmff94x forcefield as a deprotonated ligand. FTmap was used to identify the potential ligand binding sites both in the monomer and at the dimer interface. Each site was next used for docking of the BAPTA ligand using GOLD with standard parameters.(51) The docking score was calculated using the GOLDfitness score. Induced fit docking was performed on the top scoring pockets using MOE, and the free energy of binding of the ligand to the receptor was calculated using the GBVI/WSA method (Molecular Operating Environment (MOE), 2020.09 Chemical Computing Group ULC, 1010 Sherbooke St. West, Suite #910, Montreal, QC, Canada, H3A 2R7, 2022).

14. Statistical analysis

All statistical tests were performed using Prism 7 (GraphPad, La Jolla, CA, USA). Two-group comparisons were made using Student′s t-test assuming equal variances. Multiple groups were analyzed by one-way ANOVA with Greenhouse-Geisser corrections and P-values were included. Unless otherwise indicated, all data are presented as the mean ± S.D. with a significant P-value (* P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001).

1. BAPTA_i induces apoptosis in B-cell lymphoma cell lines

To explore whether DLBCL cell models could be addicted to Ca²⁺ signaling for their survival, we applied 10 µM BAPTA-AM to the extracellular environment to load the cells with BAPTA_i and determined the proportion of annexin V-FITC/7-AAD-stained cells using flow cytometry, as a measure of cell survival. The percentage of living cells was quantified by determining the proportion of AnnexinV/7-AAD-negative cells at different time points and benchmarked against vehicle treatments for each time point. We found that OCI-LY-1 and SU-DHL-4 cells displayed different kinetics and extents of apoptosis (AnnexinV-positive cells) in response to BAPTA_i (Fig. 2A and 2C for typical cytometry analysis for 6-hour-treated cells; 2B and 2D for results from replicate analysis for different time points). In comparison to vehicle treatment, 6 hours of BAPTA_i loading in OCI-LY-1 cells evoked an increase in the proportion of AnnexinV-positive cells, indicative of apoptotic cell death (Fig. 2A). In contrast, in SU-DHL-4 cells, 6 hours of BAPTA_i loading did not evoke any additional AnnexinV-positive cells in comparison to vehicle treatment (Fig. 2D). Such analyses were performed for different BAPTA_i loading times. OCI-LY-1 cells exposed to BAPTA_i displayed rapid and extensive apoptotic cell death that steadily increased over a time course of 8 hours, a feature not observed in vehicle-treated conditions (Fig. 2B). In contrast, SU-DHL-4 cells exposed to BAPTA_i did not display any significant apoptosis in a time period of 8 hours (Fig. 2E). The apoptotic fraction was determined for each time point (i.e. percentage of living vehicle-treated cells - percentage of living BAPTA_i-loaded cells) in both OCI-LY-1 and SU-DHL-4 cells (Fig. 2E).

2. BAPTA_i elicits decreased abundance of Mcl-1 in both SU-DHL-4 and OCI-LY-1 cells

DLBCL cells are highly dependent on the expression of anti-apoptotic Bcl-2 family members to counteract apoptosis. We therefore asked whether BAPTA_i could differentially impact the expression profile of these proteins in OCI-LY-1 versus SU-DHL-4 cells. Immunoblotting of different Bcl-2 family members in OCI-LY-1 cells and SU-DHL-4 cells treated with BAPTA_i for various time periods showed no significant differences in Bcl-2, Bcl-XL and Bim protein levels between vehicle- and BAPTA_i-treated OCI-LY-1 and SU-DHL-4 cells (Supplementary Fig. 1). However, Mcl-1 protein levels rapidly decreased upon BAPTA_i treatment in both OCI-LY-1 and SU-DHL-4 cells, with prominent decreases from 4 hours onwards (Fig. 3A and B).

To ensure that decreased Mcl-1 protein levels were caused by intracellular BAPTA and not extracellular BAPTA, we applied BAPTA as a free acid (not conjugated to acetoxymethyl ester and abbreviated BAPTA_e for extracellular BAPTA), which cannot enter the cell. In contrast to BAPTA_i, BAPTA_e failed to provoke a decrease in Mcl-1 protein levels, indicating that the latter effect is indeed caused by intracellularly loaded BAPTA (Fig. 3C).

3. BAPTA_i decreases Mcl-1 protein levels and provokes cell death in a Ca²⁺-independent manner

The above results imply that Ca²⁺ signals, buffered by BAPTA_i, are essential to maintain adequate Mcl-1 protein levels and thus to sustain the survival of OCI-LY-1 cells that may be dependent on Mcl-1. We therefore determined whether the ability of different BAPTA analogs to chelate intracellular Ca²⁺ correlated with their efficacy in decreasing Mcl-1 levels and limit OCI-LY-1 cell survival. Hence, we compared the cell death-inducing properties of BAPTA_i in the OCI-LY-1 cell model to three BAPTA_i analogs that possess different Ca²⁺-binding affinities (Fig. 1). EGTA (loaded into cells as EGTA-AM) was included as a control since it has a Ca²⁺-binding affinity similar to that of BAPTA, albeit with a slower kinetic profile and a different molecular structure, lacking the two benzene rings (Fig. 1). Moreover, inclusion of EGTA-AM treatment as a control eliminates any effect caused by the acetoxymethyl (AM) residue after hydrolysis.

First, we validated the distinct Ca²⁺-buffering properties of the different BAPTA_i derivatives. We performed cytosolic Ca²⁺ measurements in Fura-2-loaded OCI-LY-1 cells that were exposed to Ca²⁺-mobilizing agonists in the presence of extracellular EGTA to chelate extracellular Ca²⁺. Anti-IgG/IgM activates the B-cell receptor, thereby generating IP₃ and evoking IP₃R-mediated Ca²⁺ release from the ER, whereas ionomycin acts as a Ca²⁺ ionophore, thereby mobilizing Ca²⁺ from all internal stores. The various BAPTA analogs affected anti-IgG/IgM- and ionomycin-evoked Ca²⁺ signals in a manner that was consistent with their theoretical K_D values for Ca²⁺; DM-BAPTA_i was the most potent in buffering the cytosolic Ca²⁺ increases, while TF-BAPTA_i did not affect cytosolic Ca²⁺ increases triggered by anti-IgG/IgM and ionomycin (Fig. 3D). Hence, in subsequent experiments, TF-BAPTA_i was used as a control to determine the role of Ca²⁺ buffering in the cellular effects of BAPTA-AM treatment. After establishing that the BAPTA analogs differentially buffered intracellular Ca²⁺ signals according to their Ca²⁺ affinity, their effects on Mcl-1 levels and cell death in OCI-LY-1 cells were analyzed via western blotting and flow cytometry, respectively (Fig. 3E and F). Regardless of their differences in Ca²⁺-buffering capacity, all BAPTA_i analogs similarly decreased Mcl-1 protein levels and evoked cell death in OCI-LY-1 cells. Compared to BAPTA_i and its different derivatives, EGTA_i appeared less effective in reducing Mcl-1 abundance and failed to provoke cell death, although EGTA_i buffered the IgG/IgM- and ionomycin-induced Ca²⁺ responses more avidly than TF-BAPTA_i and DF-BAPTA_i. This observation also excludes that the effects of BAPTAi on Mcl-1 and cell death were due to the released AM moiety, since EGTA_i, which too releases this AM moiety, does not exert these effects. Finally, we validated that BAPTA_i and its derivatives provoked cell death through apoptosis: i. Cell death induced by BAPTA_i and its derivatives could be rescued by ZVAD-OMe-FMK, a pan-caspase inhibitor (Supplementary Fig. 2A), and ii. BAPTA_i and its derivatives provoked the cleavage of PARP, a downstream target of caspase-3. Additionally, in these assays, EGTA_i did not have major effects (Supplementary Fig. 2B).

4. BAPTA_i-induced cell death is dependent on decreased abundance of Mcl-1

We found that BAPTA_i decreased Mcl-1 protein levels both in OCI-LY-1 and SU-DHL-4 cells but mainly provoked cell death in OCI-LY-1 cells. We therefore asked whether the difference in BAPTA_i sensitivity could be explained by differences in Mcl-1 dependence between OCI-LY-1 and SU-DHL-4 cells. We exposed both cell lines to varying concentrations of S63845, a high-affinity Mcl-1 antagonist validated to inhibit Mcl-1(12). Furthermore, we included H929 cells, a multiple myeloma cell line known to be highly sensitive to Mcl-1 antagonism. As shown in Fig. 4A, S6385 caused a concentration-dependent death of H929 and OCI-LY-1 cells but did not affect SU-DHL-4 cells.

To underpin the involvement of Mcl-1 in cell death caused by BAPTA_i and BAPTA_i analogs, we engaged two independent approaches. First, we hypothesized that H929 cells would be sensitive to BAPTA_i, since they strongly rely on Mcl-1 expression. Consistent with our previous findings, we observed that H929 cells were highly sensitive to BAPTA-AM treatment, and that BAPTA_i rapidly provoked cell death in a large subset of H929 cells (Fig. 4B and 4C). Second, to ensure that our findings were not due to heterogeneous cellular genetic backgrounds among the different cell lines, we implemented an isogenic cell system using cells with genetically engineered dependence towards Mcl-1(23). ‘Mito-priming’ is based on the equimolar co-expression of pro- and anti-apoptotic Bcl-2 proteins to artificially generate an addiction to a specific anti-apoptotic Bcl-2 protein. We compared the effects of BAPTA_i and BAPTA_i analogs on the survival of wild-type (WT, parental control) and Mcl-1-dependent SVECs (Fig. 4D). Each cell line was treated with TF-BAPTA-AM and BAPTA-AM, while their Mcl-1 dependence was benchmarked using specific antagonists for Mcl-1 (S63845), Bcl-2 (venetoclax) and Bcl-XL (A1155483). SVECs engineered to be dependent on Mcl-1 died in response to S63845 but not to venetoclax or A1155483 treatment, while the parental SVEC control controls were much less affected by all three BH3 mimetics. Both BAPTA_i and TF-BAPTA_i provoked significant cell death in Mcl-1-dependent SVEC cells but were only marginally effective in the WT parental control cells. These results indicate that BAPTA_i-induced cell death depends on cell addiction to Mcl-1 for survival and is not a cell type- or DLBCL-specific phenomenon.

The data presented above indicate that treating cells with BAPTA-AM or BAPTA-AM analogs leads to a rapid loss of Mcl-1 proteins within cells. Since Mcl-1 is a short-lived and rapidly turned-over protein, we examined whether enhancing Mcl-1 protein levels could alleviate sensitivity to BAPTA_i. To this end, we transfected OCI-LY-1 cells with a nondegradable Mcl-1 mutant (Mcl-1^K/R)(24). This Mcl-1 mutant was obtained through sequential mutagenesis of the established ubiquitination sites in human Mcl-1 (amino acids 5, 40, 136, 194, and 197) from lysine to arginine to prevent its ubiquitination and subsequent proteasomal degradation. To allow appropriate estimation of the effectiveness of the nondegradable Mcl-1^K/R mutant, parallel cultures were transfected with either an empty vector or a vector overexpressing wild-type Mcl-1. We also overexpressed Bcl-XL to further confirm the specific mediation of the effects by Mcl-1 rather than just any Bcl-2-family member. Overexpression of Bcl-XL, wild-type Mcl-1 and the nondegradable Mcl-1^K/R mutant in OCI-LY-1 cells was confirmed by immunoblotting (Fig. 4E, lanes 4, 7 and 10 versus lane 1). Immunoblot analysis showed that wild-type Mcl-1 levels were strongly reduced in BAPTA-AM-treated cells. This was the case for both endogenous (empty vector, EV) and ectopically expressed Mcl-1 (Mcl-1^WT). In contrast, both Bcl-XL and the nondegradable Mcl-1^K/R mutant protein levels were virtually unaffected by treatment of OCI-LY-1 cells with BAPTA-AM or TF-BAPTA-AM. Ectopic expression of the nondegradable Mcl-1^K/R mutant conferred significant protection against apoptosis towards treatment with BAPTA-AM or TF-BAPTA-AM compared to cells transfected with an empty vector, Bcl-XL or WT Mcl-1. These results further indicate that BAPTA_i triggered cell death in OCI-LY-1 cells by decreasing Mcl-1 protein levels, since restoring Mcl-1 protein levels could counteract this process.

5. BAPTA_i reduces Mcl-1 protein levels by suppressing mTORC1, an important driver of MCL-1 translation

Next, we examined the mechanism by which BAPTA_i evoked a decline in Mcl-1 protein levels. We first analyzed the effect of BAPTA_i and its analogs on MCL-1 mRNA levels but did not observe any change following treatment with the different BAPTA-AM compounds, indicating the absence of effects on MCL-1 transcription (Fig. 5A). To determine whether BAPTA_i enhanced Mcl-1 protein degradation, we pretreated OCI-LY-1 cells with cycloheximide to inhibit the de novo translation of Mcl-1 (Fig. 5B). Since Mcl-1 is rapidly turned over by proteasomal degradation, halting translation using cycloheximide results in a rapid decline in Mcl-1 (Fig. 5B, blue bars). However, compared to the vehicle control, neither BAPTAi nor TF-BAPTAi accelerated the cycloheximide-induced decline in Mcl-1 protein levels (Fig. 5B, yellow and red bars). Thus, BAPTA_i and TF-BAPTA_i did not promote Mcl-1 degradation.

Since BAPTA_i neither inhibited MCL-1 transcription nor accelerated Mcl-1 degradation, we assessed whether BAPTA_i could suppress Mcl-1 translation. We monitored translation by cloning the 5’ untranslated region (UTR) of MCL-1 in front of an open reading frame encoding GFP (Fig. 5C). We also cloned the 5’ UTR of CMV to monitor general translation. These constructs were benchmarked against a control that lacked a 5’ UTR (for this, we used a scrambled version of the 5’ UTR of MCL-1), which provides the background translation in our system, potentially due to leaky translational events. First, we validated that the 5’ UTR of MCL-1 and CMV significantly augmented the translation of GFP compared to the scrambled 5’ UTR of MCL-1 (Fig. 5D). Then, we assessed the impact of BAPTA_i and TF-BAPTA_i on both MCL-1 and CMV 5’ UTRs to determine their effect on Mcl-1 translation and general translation events. MCL-1 5’ UTR- and CMV 5’ UTR-driven translation was decreased by BAPTA_i and TF-BAPTA_i, indicating that BAPTA_i inhibits Mcl-1 translation and CMV-driven translation in a Ca²⁺-independent manner (Fig. 5E).

Since Mcl-1 translation is driven by mammalian target of rapamycin complex 1 (mTORC1), we assessed the effect of BAPTA_i on the phosphorylation of p70S6K, a downstream target of mTORC1 signaling that drives mRNA translation and controls cell growth and metabolism (Fig. 5F)(25). OCI-LY-1 cells were treated with vehicle, TF-BAPTA-AM or BAPTA-AM. The selective and high-affinity mTORC1 inhibitor Torin1 was included as a positive control. Samples were taken after 30, 60 and 90 minutes, and the ratio of P-p70S6K/total p70S6K was analyzed via western blot. All treatments similarly and significantly lowered the phosphorylation of p70S6K, indicating that BAPTA_i suppresses mTORC1 activity in a Ca²⁺-independent manner. Moreover, these results indicate that BAPTA_i may diminish general protein translation by inhibiting mTORC1 activity.

To further strengthen the conclusion that BAPTA_i inhibits mTORC1-driven protein translation, we examined eIF4E, the rate-limiting regulator of cap-dependent mRNA translation. eIF4E either forms a complex with eIF4G, thereby recruiting mRNA and driving translation, or forms an inactive complex with 4E-BP1, thereby competing with eIF4G for binding eIF4E and limiting translation. Phosphorylation of 4E-BP1 by mTORC1 causes its release from eIF4E to allow cap-dependent translation to proceed (Fig. 5G). Thus, the eIF4E-binding ratio of eIF4G/4E-BP1 provides a molecular readout for mTORC1-driven mRNA translation activity. Therefore, we pulled-down eIF4E using m7GTP-sepharose beads and checked the binding of eIF4G and 4E-BP1 in lysates of OCI-LY-1 cells treated for 90 minutes with TF-BAPTA-AM, BAPTA-AM or Torin1 as a control (Fig. 5H). All treatments elicited a prominent increase in 4E-BP1 binding to eIF4E compared to the vehicle control, indicating that BAPTA_i indeed inhibits cap-dependent mRNA translation and that this occurs independently of its Ca²⁺-chelating properties.

6. BAPTA_i rapidly suppresses glycolysis in cells preceding cell death by abrogating the conversion of fructose-6-phosphate into fructose-1,6-bisphosphate

Since mTORC1 activity is tightly controlled by the metabolic state of the cell, we monitored glycolytic activity in OCI-LY-1 and SU-DHL-4 cells exposed to TF-BAPTA_i and BAPTA_i. To eliminate any effect caused by the AM residue or by mTOR inhibition itself, EGTA_i and Torin1 were included as controls. Using a Seahorse extracellular flux analyzer, we analyzed the change in extracellular pH (extracellular acidification rate, ECAR), which is an approximate measure of glycolytic activity. Although BAPTA_i-induced cell death was only observed after approximately 4 hours with OCI-LY-1 cells (Fig. 2B), pretreatment with the pan-caspase inhibitor ZVAD-OMe-FMK was performed to avoid any potential adverse effects of cell death initiation. Within 1 hour, BAPTA_i and TF-BAPTA_i strongly lowered ECAR, while Torin1, EGTA_i or vehicle did not exert such an effect (Fig. 5I). In addition, we performed extracellular lactate measurements to validate that both BAPTA_i and TF-BAPTA_i lowered extracellular lactate levels (Fig. 5J).

Next, to unravel the mechanism by which BAPTA_i interferes with glycolysis at the molecular level, we set up a metabolomics approach using nonradioactive ¹³C glucose (Fig. 6). We cultured OCI-LY-1 cells in the presence of U-¹³C-labeled glucose, so that the cells could incorporate the stable ¹³C isotopes into their metabolic pathways. With mass spectrometry, the abundance and labeling patterns (isotopologs and fractional contribution) of metabolites could be detected, allowing us to assess the activity and connectivity of metabolic pathways. The cells were treated for one hour with vehicle, BAPTA-AM or TF-BAPTA-AM. BAPTA_i caused a significant decrease in fructose 1,6-bisphosphate levels, which also occurred in response to TF-BAPTA_i (Fig. 6). Downstream metabolites, but not upstream metabolites, were also reduced. This suggests that BAPTA_i provokes Ca²⁺-independent inhibition of glycolysis at the level of fructose 6-phosphate conversion into fructose 1,6-bisphosphate. Glycolytic metabolites downstream of fructose 1,6-bisphosphate were less reduced by TF-BAPTA_i than BAPTA_i (Fig. 6). This could be caused by better maintained activity of the pentose phosphate pathway (PPP), which converts fructose 6-phosphate into glyceraldehyde 3-phosphate that can re-enter the glycolytic pathway, by-passing the block.

7. BAPTA directly inhibits the activity of purified, recombinantly expressed PFKFB3

The production of fructose 1,6-bisphosphate is catalyzed by the phosphofructokinase 1 (PFK1) enzyme, whose activity strongly depends on fructose 2,6-bisphosphate, a metabolite produced by the activity of the 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase 3 (PFKFB3) enzyme. We therefore asked whether BAPTA could directly impact the master regulator PFKFB3. We measured the kinase activity of the recombinant human PFKFB3 enzyme using a cell-free biochemical assay based on measuring the production of ADP in the presence of different concentrations of BAPTA (ranging from 1 µM to 1 mM). This concentration range was chosen since previous studies indicated that application of 10 µM BAPTA-AM in the extracellular environment (also used in experiments in our work) resulted in the accumulation of BAPTA in the cytosol up to 1–2 mM (15). In this assay, BAPTA directly inhibited PFKFB3 activity with an IC₅₀ of 110 µM (Fig. 7A). Appropriate controls (counter assay, see Material and Methods) confirmed that BAPTA did not affect the ATP-depleting and luciferase detection enzymes included in the ADP-Glo system used in the kinase assay (not shown). We also validated that PFKFB3 activity could be inhibited by AZ PFFKB3 67, showing that the assay reports bona fide PFKFB3 activity. (Supplementary Fig. 3). EGTA, which has a Ca²⁺-binding affinity similar to that of BAPTA but a different molecular structure, did not affect PFKFB3 kinase activity (Fig. 7B). Next, we asked whether the inhibition of PFKFB3 by BAPTA was influenced by Ca²⁺. We found that increasing the Ca²⁺ concentrations in the assay buffer alleviated the inhibitory effect of BAPTA (applied at 1 mM) on PFKFB3 (while this had no impact on PFKFB3 activity in the presence of EGTA), further indicating that the inhibition of PFKFB3 by BAPTA occurs through its Ca²⁺-free form (Fig. 7C). It’s interesting to note that adding 0.5 mM Ca²⁺ to 1 mM BAPTA thus anticipating ~ 50% Ca²⁺-free BAPTA and ~ 50% Ca²⁺-bound BAPTA corresponds to about a 50% reduction of the inhibitory effect of BAPTA. Saturating BAPTA with Ca²⁺ by adding 1 or 2 mM Ca²⁺ to 1 mM BAPTA completely alleviated the inhibitory effect of BAPTA on PFKFB3. This shows that BAPTA can directly inhibit PFKFB3 activity in its Ca²⁺-free form, but not in its Ca²⁺-complexed form.

To further substantiate that BAPTA can directly impact PFKFB3, we performed a molecular modeling approach by docking BAPTA into the different putative binding sites (Fig. 7D). We identified seven different sites, including the ATP-binding site and the fructose 6-phosphate sites in the kinase domain and the fructose 2,6-bisphosphate site in the hydrolase domain and a site at the dimerization interface. The docking simulations preferred a binding mode to both fructose 6-phosphate binding sites bound in the kinase and hydrolase domains (with scores of 94.8 and 83.9 over scoring 74.1 to 58.4 in the other domains). This is not surprising, as both domains are hallmarked by a series of positively charged residues to coordinate multiple phosphates. To obtain a more detailed view, induced-fit docking was performed at both sites, hypothesizing that the acid functionalities of BAPTA mimic the fructose phosphate groups. This resulted in a preferred binding mode of BAPTA to the fructose 6-phosphate sites within the kinase domain (-10.8 kcal/mol) over the hydrolase site (-9.3 kcal/mol). With EGTA, this dropped to -9.0 kcal/mol. The docking simulations suggest specific binding of BAPTA to the fructose 6-phosphate substrate-binding site in the kinase domain competing with the substrate and ATP binding site via phosphate-mimicking interactions.

8. PFKFB3 inhibition suppresses mTORC1 activity, thereby evoking a decline in Mcl-1 protein levels

Finally, we sought to establish a causal link between the inhibition of PFKFB3 activity, inhibition of mTORC1 activity and a subsequent decrease of Mcl-1 protein levels in OCI-LY-1 and SU-DHL-4 cells, thereby mimicking the effect of BAPTA_i. We therefore used the AZ PFKFB3 67 compound, a PFKFB3 inhibitor(26). We exposed OCI-LY-1 and SU-DHL-4 cells to 25 µM AZ PFKFB3 67, a concentration limiting PFKFB3 activity in cells(27). Similar to Torin1 and BAPTA_i, AZ PFKFB3 67 decreased the phospho-p70S6K/total p70S6K ratio and reduced Mcl-1-protein levels in both OCI-LY-1 and SU-DHL-4 cells (Fig. 7E-7H); though AZ PFKFB3 67 appeared less potent than either BAPTA_i or TF-BAPTA_i. These results indicate that pharmacological inhibition of PFKFB3 is sufficient to suppress mTORC1 activity and downstream signaling events, thereby resulting in a decline in Mcl-1 protein levels.

Our results reveal an unprecedented and Ca²⁺-independent effect of BAPTA_i, a high-affinity, rapid Ca²⁺-chelating agent (see Fig. 8 for a simplified model). We demonstrate that BAPTA_i hampers the conversion of fructose 6-phosphate into fructose 1,6-bisphosphate by directly inhibiting the activity of PFKFB3, a major regulatory enzyme of this step. The inhibition of PFKFB3 by BAPTA occurred via its Ca²⁺-free form. Consequently, BAPTA_i strongly suppressed mTORC1 activity, thereby abrogating downstream mTORC1-controlled events such as protein translation. Although likely overall mTORC1-driven protein translation is suppressed, BAPTA_i particularly affects the protein levels of short-lived proteins such as anti-apoptotic Mcl-1, whose protein levels rapidly decline upon inhibition of mTORC1. As a consequence, in cell models in which Mcl-1 is critical for cell survival, BAPTA_i evokes cell death. Thus, our work revealed novel intracellular crosstalk where PFKFB3 inhibition reduces Mcl-1 protein levels by impeding mTORC1 activity.

We previously demonstrated that treatment with BAPTA_i could boost the cell death response of DLBCL cells to venetoclax, an FDA-approved Bcl-2 antagonist (14). This is particularly interesting since resistance to venetoclax treatment is emerging(14),(28),(29). The ability of BAPTA_i to enhance the cell death response of cancer cells to BH3 mimetics has also been observed in other studies. For instance, ovarian carcinoma cells were sensitized to Bcl-XL inhibition upon BAPTA-AM treatment (20). As BAPTA_i is a high-affinity buffer of cytosolic Ca²⁺, these findings suggested a yet unappreciated interplay between constitutive Ca²⁺ signaling, anticipated to be suppressed by BAPTA_i, and the anti-apoptotic function of the Bcl-2 family. However, no studies so far have performed controls using BAPTA_i variants with very low Ca²⁺ affinity such as TF-BAPTA_i that cannot affect basal cytosolic Ca²⁺ levels. Here, we demonstrate that BAPTA_i can exert profound cellular effects that are completely independent of its Ca²⁺-chelating properties.

Using an unbiased ¹³C tracer metabolomics approach, w found that BAPTA_i impedes a proximal step in glycolysis, namely, the conversion of fructose 6-phosphate into fructose 1,6-bisphosphate. We postulate that BAPTA_i evokes a direct inhibition of PFKFB3, as BAPTA can inhibit the activity of purified PFKFB3 enzyme in in vitro activity assays. In these assays, the inhibition of PFKFB3 by BAPTA was characterized by an IC₅₀ of 110 µM. Although this might seem a high concentration, it is important to note that previous work indicated that extracellular application of 10 µM BAPTA-AM results in cytosolic BAPTA concentrations of about 1 to 2 mM (15), thus well-above the presumed IC₅₀, enabling in cellulo inhibition of PFKFB3 by BAPTA_i. As a consequence of this PFKFB3 inhibition, we found that downstream pathways such as mTORC1 signaling, a major driver of protein translation, were impaired. This statement is supported by pharmacological PFKFB3 inhibitors that could mimic BAPTA_i and inhibit mTORC1 activity. Following mTORC1 inhibition, protein translation is suppressed including the translation of anti-apoptotic Mcl-1 proteins, thereby rapidly decreasing its protein levels. Mcl-1 protein levels are exquisitely susceptible to impaired translation since Mcl-1 is a short-lived protein that is quickly turned over through proteasomal degradation. When cells are addicted to Mcl-1 for their survival, they become sensitive to decreases in Mcl-1 protein levels and thus to BAPTA-AM treatment. This implies that BAPTA_i does not elicit a general, off-target toxicity but provokes a specific Ca²⁺-independent inhibition of glycolysis.

Mcl-1 is an important pharmacological target since it is an emergent resistance factor in tumor cells treated with BH3 mimetics, such as ABT-199 (venetoclax), ABT-263 (navitoclax) and ABT-737. The need for therapeutic agents targeting Mcl-1 is therefore acute(11). Accordingly, specific Mcl-1 inhibitors have been developed, showing promising results as single agents as well as in combination with other BH3 mimetics(28)–(32). However, increased abundance of nontargeted Bcl-2 family members is not the only resistance mechanism in tumor cells. Following prolonged treatment with venetoclax, several studies reported mutations in the hydrophobic groove of Bcl-2, decreasing the affinity of venetoclax for Bcl-2 and limiting its therapeutic effect(33),(34). Although few studies have addressed this concern so far, it is plausible that a similar mechanism would occur for Mcl-1 when treating tumor cells with a BH3-mimetic Mcl-1 inhibitor. It could therefore be beneficial to target Mcl-1 at the level of its transcription, translation, or degradation. Indeed, it has been shown that inhibition of the mTORC1 complex, and by extension Mcl-1 translation, shows antitumor effects in lymphoma as a single agent and in combination with venetoclax(35),(36). This is supported by our own results demonstrating that BAPTA-induced inhibition of mTORC1 and consequent reduction of Mcl-1 protein levels leads to cell death in Mcl-1-dependent lymphoma cell lines. mTORC1 is an energy sensing complex that controls anabolic processes, including ribosome biogenesis and synthesis of nucleotides, proteins and lipids, and inhibits catabolism (autophagy)(25). While mTORC1 aligns energy supplies with anabolic and catabolic activities in physiological conditions, in cancer cells it lies at the core of metabolic reprogramming to increase proliferation. Accordingly, mTORC1 inhibitors, so-called rapalogs, have been extensively evaluated as potential therapeutics in cancer treatments(37).

Our findings are in line with other studies demonstrating a link between glycolysis, mTORC1 activity and mRNA translation. Indeed, the team of Adams and coworkers revealed that 2-deoxyglucose (2-DG), which inhibits the first step in the glycolytic pathway, caused a decrease in p70S6K phosphorylation and an increase in 4E-BP1 activity, indicating that inhibition of glycolysis using 2-DG provoked a decrease in general translation activity(38). In the same study, 2-DG rapidly affected steady-state Mcl-1 levels, sensitizing human hematopoietic tumor cell lines to ABT-737, a nonselective Bcl-2/Bcl-XL-antagonizing BH3 mimetic.

Although regulation of mTORC1 by amino acids is well established, the exact mechanisms by which glucose controls mTORC1 activity remain poorly understood. Different mechanisms may contribute to glucose sensing by mTORC1, including the AMPK, ULK1/LARS and PFKFB3 pathways(39).

PFKFB3 is a kinase enzyme that catalyzes the phosphorylation of fructose 6-phosphate into fructose 2,6-bisphosphate and acts as a stimulator of PFK1, one of the rate-limiting enzymes of glycolysis. PFKFB3 controls the translocation of mTORC1 to lysosomes by direct interaction with Rag B and subsequent mTORC1 activity(40). Our data reveal that PFKFB3 activity sustains mTORC1 activity and thus mTORC1 signaling. These findings open up future research avenues since increased abundances of PFKFB3 are found in several cancers, and has been associated with cancer hallmarks such as carcinogenesis, cancer cell proliferation, drug resistance and the tumor microenvironment.(41),(42).

Inhibition of glycolytic activity then decreases mTORC1 activity, leading to impaired (Mcl-1) translation and cancer cell death. Indeed, cancer cells are often characterized by a high rate of glycolytic flux, known as the Warburg effect. This mechanism allows fast ATP production and generates carbon sources for de novo nucleotide synthesis; both mechanisms enabling rapid proliferation(43),(44). Direct inhibition of glycolysis has therefore been extensively explored as an anticancer strategy(45), underpinning the importance of the elucidated noncanonical effects of BAPTA_i.

BAPTA has been applied in more than a thousand publications as a “proof” that Ca²⁺ signaling is essential for certain biological processes. For effects of BAPTA_i to be fully ascribed to chelation of Ca²⁺, experimental protocols should incorporate the use of adequate controls such as a TF-BAPTA_i, a BAPTA variant with a Ca²⁺ affinity that is at about 400-fold lower than BAPTA. Our work also expands the previous research performed by Smith and colleagues. Their data revealed that several Ca²⁺-chelating agents and fluorescent Ca²⁺ indicators, including BAPTA, could elicit Ca²⁺-independent effects, such as inhibition of Na⁺/K⁺-ATPase, an ion pump critical for maintenance of ionic balances and control cell volume(15),(16). In the future, it will be interesting to assess a proteome-wide view of the distinct targets of intracellular BAPTA. Such studies are needed to discern effects related to BAPTA’s Ca²⁺-chelating properties versus its potential direct binding to targets and biochemically altering their activity.

Finally, whilst the bulk of data presented in this study highlights Ca²⁺-independent actions of BAPTA, we are not suggesting that Ca²⁺ chelation has no impact on Mcl-1-protein levels. Indeed, EGTA_i modestly lowered Mcl-1-protein levels (Fig. 3E) while it did not inhibit PFKFKB3 activity (Fig. 7B). Moreover, it was evident that direct inhibition PFKFB3 using AZ PFKFB3 67 compound was less potent in decreasing Mcl-1-protein levels than BAPTA_i (Fig. 7F and 7H), thus potentially indicating a contribution of Ca²⁺ chelation to reduced Mcl-1 expression independently of PFKFB3. A common argument for different biological effects being observed when comparing EGTA_i and BAPTA_i is that EGTA_i, as a slow Ca²⁺ buffer, poorly buffers Ca²⁺ in microdomains. Whereas, BAPTA_i, as a fast Ca²⁺ buffer, can effectively buffer Ca²⁺ in microdomains. However, we hypothesize that this is unlikely to account for the results observed in this study since BAPTA_i (K_D of 160 nM) and TF-BAPTAi (K_D of 65 µM) always displayed similar potencies in downregulating Mcl-1 (Fig. 3E, 7F and 7H).

In conclusion, BAPTA elicits important cellular effects independent of its ability to chelate Ca²⁺. We found that BAPTA inhibited the kinase activity of the glycolytic stimulator PFKFB3, leading to impaired glycolysis. This resulted in impairment of mTORC1 activity leading to dysfunctional translation. Consequently, the cellular expression of Mcl-1, a short-lived anti-apoptotic protein quickly affected by the lack of de novo translation, was reduced, promoting cell death in Mcl-1-dependent cancer cells.

Data availability

All relevant data are presented in the manuscript. The full-length immunoblots are included in Supplementary Material.

Conflict of interest

The authors declare no competing interests.

Acknowledgements

The authors wish to thank Anja Florizoone and Rita La Rovere for excellent technical help. The research was funded by grants from the Research Foundation – Flanders (G090118N, G0E7520N, G081821N and G094522N to GB) and from the Research Council – KU Leuven (C14/19/099 and AKUL/19/34 to GB). GB and MDB are part of the FWO Scientific Research Network CaSign (W0.019.17N and W0.014.22N). We thank Dr. Marc Diederich for sharing the Mcl-1^K/R-expression plasmid.

Author contributions

Performing experiments: FS, KW, AS, AV, GE, MD, FSR. Analyzing results: FS, BG. Discussion: FS, MK, MD, MDB. Design research: FS, MDB, GB. Supervision and conceptualization: GB. Acquired funding: GB. Provided critical reagents: SWT

Berridge, M., Lipp, P. & Bootman, M. The versatility and universality of calcium signalling. Nat. Rev. Mol. Cell Biol. 1, 11–21 (2000).
Clapham, D. Calcium signaling. Cell 131, 1047–1058 (2007).
Monteith, G., Prevarskaya, N. & Roberts-Thomson, S. The calcium-cancer signalling nexus. Nat. Rev. Cancer 17, 367–380 (2017).
Marchi, S. & Pinton, P. Alterations of calcium homeostasis in cancer cells. Curr. Opin. Pharmacol. 29, 1–6 (2016).
Akl, H. & Bultynck, G. Altered Ca2+ signaling in cancer cells: Proto-oncogenes and tumor suppressors targeting IP3 receptors. Biochim. Biophys. Acta - Rev. Cancer 1835, 180–193 (2013).
Ando, H., Kawaai, K., Bonneau, B. & Mikoshiba, K. Remodeling of Ca 2+ signaling in cancer: Regulation of inositol 1,4,5-trisphosphate receptors through oncogenes and tumor suppressors. Adv. Biol. Regul. 68, 64–76 (2018).
Grimm, S. The ER-mitochondria interface: the social network of cell death. Biochim. Biophys. Acta 1823, 327–334 (2012).
Rosa, N., Ivanova, H., Wagner, L. E., Kale, J., La Rovere, R., Welkenhuyzen, K., Louros, N., Karamanou, S., Shabardina, V., Lemmens, I., Vandermarliere, E., Hamada, K., Ando, H., Rousseau, F., Schymkowitz, J., Tavernier, J., Mikoshiba, K., … Bultynck, G. Bcl-xL acts as an inhibitor of IP 3 R channels, thereby antagonizing Ca 2+-driven apoptosis. Cell Death Differ. 29, 788–805 (2022).
Sarosiek, K., Ni Chonghaile, T. & Letai, A. Mitochondria: gatekeepers of response to chemotherapy. Trends Cell Biol. 23, 612–619 (2013).
Peperzak, V., Slinger, E., Ter Burg, J. & Eldering, E. Functional disparities among BCL-2 members in tonsillar and leukemic B-cell subsets assessed by BH3-mimetic profiling. Cell Death Differ. 24, 111–119 (2017).
Bose, P., Gandhi, V. & Konopleva, M. Pathways and mechanisms of venetoclax resistance. Leuk. Lymphoma 58, 2026–2039 (2017).
Villalobos-Ortiz, M., Ryan, J., Mashaka, T. N., Opferman, J. T. & Letai, A. BH3 profiling discriminates on-target small molecule BH3 mimetics from putative mimetics. Cell Death Differ. 27, 999 (2020).
Kehr, S. & Vogler, M. It’s time to die: BH3 mimetics in solid tumors. Biochim. Biophys. acta. Mol. cell Res. 1868, (2021).
Vervloessem, T., Ivanova, H., Luyten, T., Parys, J. B. & Bultynck, G. The selective Bcl-2 inhibitor venetoclax, a BH3 mimetic, does not dysregulate intracellular Ca2+ signaling. Biochim. Biophys. Acta - Mol. Cell Res. 1864, 968–976 (2017).
Smith, N. A., Kress, B. T., Lu, Y., Chandler-Militello, D., Benraiss, A. & Nedergaard, M. Fluorescent Ca2+ indicators directly inhibit the Na,K-ATPase and disrupt cellular functions. Sci. Signal. 11, (2018).
Bootman, M. D., Allman, S., Rietdorf, K. & Bultynck, G. Deleterious effects of calcium indicators within cells; an inconvenient truth. Cell Calcium vol. 73 82–87 (2018).
Turner, C., Connell, J., Blackstone, K. & Ringler, S. Loss of calcium and increased apoptosis within the same neuron. Brain Res. 1128, 50–60 (2007).
Williams, J., Hou, Y., Ni, H. & Ding, W. Role of intracellular calcium in proteasome inhibitor-induced endoplasmic reticulum stress, autophagy, and cell death. Pharm. Res. 30, 2279–2289 (2013).
Zhang, L., Cheng, X., Xu, S., Bao, J. & Yu, H. Curcumin induces endoplasmic reticulum stress-associated apoptosis in human papillary thyroid carcinoma BCPAP cells via disruption of intracellular calcium homeostasis. Medicine (Baltimore). 97, (2018).
Bonnefond, M.-L., Lambert, B., Giffard, F., Abeilard, E., Brotin, E., Louis, M.-H., Gueye, M. S., Gauduchon, P., Poulain, L. & N’Diaye, M. Calcium signals inhibition sensitizes ovarian carcinoma cells to anti-Bcl-xL strategies through Mcl-1 down-regulation. Apoptosis 2015 204 20, 535–550 (2015).
Saoudi, Y., Rousseau, B., Doussière, J., Charrasse, S., Gauthier-Rouvière, C., Morin, N., Sautet-Laugier, C., Denarier, E., Scaïfe, R., Mioskowski, C. & Job, D. Calcium-independent cytoskeleton disassembly induced by BAPTA. Eur. J. Biochem. 271, 3255–3264 (2004).
Furuta, A., Tanaka, M., Omata, W., Nagasawa, M., Kojima, I. & Shibata, H. Microtubule disruption with BAPTA and dimethyl BAPTA by a calcium chelation-independent mechanism in 3T3-L1 adipocytes. Endocr. J. 56, 235–243 (2009).
Lopez, J., Bessou, M., Riley, J. S., Giampazolias, E., Todt, F., Rochegüe, T., Oberst, A., Green, D. R., Edlich, F., Ichim, G. & Tait, S. W. G. Mito-priming as a method to engineer Bcl-2 addiction. Nat. Commun. 7, (2016).
Masuoka, H., Mott, J., Bronk, S., Werneburg, N., Akazawa, Y., Kaufmann, S. & Gores, G. Mcl-1 degradation during hepatocyte lipoapoptosis. J. Biol. Chem. 284, 30039–30048 (2009).
XM, M. & J, B. Molecular mechanisms of mTOR-mediated translational control. Nat. Rev. Mol. Cell Biol. 10, 307–318 (2009).
Boyd, S., Brookfield, J. L., Critchlow, S. E., Cumming, I. A., Curtis, N. J., Debreczeni, J., Degorce, S. L., Donald, C., Evans, N. J., Groombridge, S., Hopcroft, P., Jones, N. P., Kettle, J. G., Lamont, S., Lewis, H. J., MacFaull, P., McLoughlin, S. B., … Wingfield, J. Structure-Based Design of Potent and Selective Inhibitors of the Metabolic Kinase PFKFB3. J. Med. Chem. 58, 3611–3625 (2015).
Savva, C., Gonz Alez-Granillo, M., Li, X., Angelin, B., Korach-Andr, M., Modder, M., Kuipers, E. N., Held, N. M., In, W., Panhuis, H., Ruppert, P. M. M., Kersten, S., Kooijman, S., Guisas, B., Houtkooper, R., Rensen, P., Boon, M., … De Meyer, G. 3PO inhibits glycolysis but does not bind to 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase-3 (PFKFB3). Atherosclerosis 315, e87 (2020).
Ramsey, H. E., Fischer, M. A., Lee, T., Gorska, A. E., Arrate, M. P., Fuller, L., Boyd, K. L., Strickland, S. A., Sensintaffar, J., Hogdal, L. J., Ayers, G. D., Olejniczak, E. T., Fesik, S. W. & Savona, M. R. A Novel MCL-1 Inhibitor Combined with Venetoclax Rescues Venetoclax-Resistant Acute Myelogenous Leukemia. Cancer Discov. 8, 1566 (2018).
Konopleva, M., Contractor, R., Tsao, T., Samudio, I., Ruvolo, P., Kitada, S., Deng, X., Zhai, D., Shi, Y., Sneed, T., Verhaegen, M., Soengas, M., Ruvolo, V., McQueen, T., Schober, W., Watt, J., Jiffar, T., … Andreeff, M. Mechanisms of apoptosis sensitivity and resistance to the BH3 mimetic ABT-737 in acute myeloid leukemia. Cancer Cell 10, 375–388 (2006).
Kotschy, A., Szlavik, Z., Murray, J., Davidson, J., Maragno, A., Le Toumelin-Braizat, G., Chanrion, M., Kelly, G., Gong, J., Moujalled, D., Bruno, A., Csekei, M., Paczal, A., Szabo, Z., Sipos, S., Radics, G., Proszenyak, A., … Geneste, O. The MCL1 inhibitor S63845 is tolerable and effective in diverse cancer models. Nature 538, 477–482 (2016).
Hormi, M., Birsen, R., Belhadj, M., Huynh, T., Cantero Aguilar, L., Grignano, E., Haddaoui, L., Guillonneau, F., Mayeux, P., Hunault, M., Tamburini, J., Kosmider, O., Fontenay, M., Bouscary, D. & Chapuis, N. Pairing MCL-1 inhibition with venetoclax improves therapeutic efficiency of BH3-mimetics in AML. Eur. J. Haematol. 105, 588–596 (2020).
van Delft, M., Wei, A., Mason, K., Vandenberg, C., Chen, L., Czabotar, P., Willis, S., Scott, C., Day, C., Cory, S., Adams, J., Roberts, A. & Huang, D. The BH3 mimetic ABT-737 targets selective Bcl-2 proteins and efficiently induces apoptosis via Bak/Bax if Mcl-1 is neutralized. Cancer Cell 10, 389–399 (2006).
Birkinshaw, R., Gong, J., Luo, C., Lio, D., White, C., Anderson, M., Blombery, P., Lessene, G., Majewski, I., Thijssen, R., Roberts, A., Huang, D., Colman, P. & Czabotar, P. Structures of BCL-2 in complex with venetoclax reveal the molecular basis of resistance mutations. Nat. Commun. 10, (2019).
Tausch, E., Close, W., Dolnik, A., Bloehdorn, J., Chyla, B., Bullinger, L., Döhner, H., Mertens, D. & Stilgenbauer, S. Venetoclax resistance and acquired BCL2 mutations in chronic lymphocytic leukemia. Haematologica 104, E434–E437 (2019).
Tarantelli, C., Gaudio, E., Hillmann, P., Spriano, F., Sartori, G., Aresu, L., Cascione, L., Rageot, D., Kwee, I., Beaufils, F., Zucca, E., Stathis, A., Wymann, M. P., Cmiljanovic, V., Fabbro, D. & Bertoni, F. The Novel TORC1/2 Kinase Inhibitor PQR620 Has Anti-Tumor Activity in Lymphomas as a Single Agent and in Combination with Venetoclax. Cancers (Basel). 11, (2019).
Jiang, H., Lwin, T., Zhao, X., Ren, Y., Li, G., Moscinski, L., Shah, B. & Tao, J. Venetoclax as a single agent and in combination with PI3K-MTOR1/2 kinase inhibitors against ibrutinib sensitive and resistant mantle cell lymphoma (MCL). Br. J. Haematol. 184, 298 (2019).
Ricci, J. E. & Chiche, J. Metabolic reprogramming of non-Hodgkin’s B-cell lymphomas and potential therapeutic strategies. Front. Oncol. 8, 556 (2018).
Tailler, M., Lindqvist, L. M., Gibson, L. & Adams, J. M. By reducing global mRNA translation in several ways, 2-deoxyglucose lowers MCL-1 protein and sensitizes hemopoietic tumor cells to BH3 mimetic ABT737. Cell Death Differ. 26, 1766 (2019).
Leprivier, G. & Rotblat, B. How does mTOR sense glucose starvation? AMPK is the usual suspect. Cell Death Discov. 6, 27 (2020).
Almacellas, E., Pelletier, J., Manzano, A., Gentilella, A., Ambrosio, S., Mauvezin, C. & Tauler, A. Phosphofructokinases Axis Controls Glucose-Dependent mTORC1 Activation Driven by E2F1. iScience 20, 434–448 (2019).
De Bock, K., Georgiadou, M., Schoors, S., Kuchnio, A., Wong, B., Cantelmo, A., Quaegebeur, A., Ghesquière, B., Cauwenberghs, S., Eelen, G., Phng, L., Betz, I., Tembuyser, B., Brepoels, K., Welti, J., Geudens, I., Segura, I., … Carmeliet, P. Role of PFKFB3-driven glycolysis in vessel sprouting. Cell 154, (2013).
Shi, L., Pan, H., Liu, Z., Xie, J. & Han, W. Roles of PFKFB3 in cancer. Signal Transduct. Target. Ther. 2017 21 2, 1–10 (2017).
Koppenol, W., Bounds, P. & Dang, C. Otto Warburg’s contributions to current concepts of cancer metabolism. Nat. Rev. Cancer 11, 325–337 (2011).
Vander Heiden, M., Cantley, L. & Thompson, C. Understanding the Warburg effect: the metabolic requirements of cell proliferation. Science 324, 1029–1033 (2009).
Abdel-Wahab, A. F., Mahmoud, W. & Al-Harizy, R. M. Targeting glucose metabolism to suppress cancer progression: prospective of anti-glycolytic cancer therapy. Pharmacol. Res. 150, (2019).
Bittremieux, M., Rovere, R. M. La, Akl, H., Martines, C., Welkenhuyzen, K., Dubron, K., Baes, M., Janssens, A., Vandenberghe, P., Laurenti, L., Rietdorf, K., Morciano, G., Pinton, P., Mikoshiba, K., Bootman, M. D., Efremov, D. G., Smedt, H. De, … Bultynck, G. Constitutive IP3 signaling underlies the sensitivity of B-cell cancers to the Bcl-2/IP3 receptor disruptor BIRD-2. Cell Death Differ. 26, 531 (2019).
Cerella, C., Muller, F., Gaigneaux, A., Radogna, F., Viry, E., Chateauvieux, S., Dicato, M. & Diederich, M. Early downregulation of Mcl-1 regulates apoptosis triggered by cardiac glycoside UNBS1450. Cell Death Dis. 6, (2015).
Monaco, G., Decrock, E., Akl, H., Ponsaerts, R., Vervliet, T., Luyten, T., De Maeyer, M., Missiaen, L., Distelhorst, C., De Smedt, H., Parys, J., Leybaert, L. & Bultynck, G. Selective regulation of IP3-receptor-mediated Ca2+ signaling and apoptosis by the BH4 domain of Bcl-2 versus Bcl-Xl. Cell Death Differ. 19, 295–309 (2012).
Decuypere, J.-P., Welkenhuyzen, K., Luyten, T., Ponsaerts, R., Dewaele, M., Molgó, J., Agostinis, P., Missiaen, L., Smedt, H. De, Parys, J. B. & Bultynck, G. Ins(1,4,5)P3 receptor-mediated Ca2+ signaling and autophagy induction are interrelated. Autophagy 7, 1472 (2011).
Cavalier, M. C., Kim, S. G., Neau, D. & Lee, Y. H. Molecular basis of the Fructose-2,6-bisphosphatase reaction of PFKFB3: Transition state and the C-terminal function. Proteins 80, 1143 (2012).
Jones, G., Willett, P., Glen, R. C., Leach, A. R. & Taylor, R. Development and validation of a genetic algorithm for flexible docking. J. Mol. Biol. 267, 727–748 (1997).

(Not answered)

20221118fulllenghtblots.pdf
Full-length blots
Supplementaryfigures.docx

Download PDF

Journal Publication

published 08 Sep, 2023

Read the published version in Cell Death & Disease →

Editorial decision: revise
06 Mar, 2023
Review #4 received at journal
06 Mar, 2023
Review #3 received at journal
04 Mar, 2023
Review #5 received at journal
20 Feb, 2023
Reviewer #5 agreed at journal
19 Feb, 2023
Reviewer #4 agreed at journal
19 Feb, 2023
Reviewer #3 agreed at journal
19 Feb, 2023
Reviewer #2 agreed at journal
08 Jan, 2023
Reviewer #1 agreed at journal
08 Jan, 2023
Reviewers invited by journal
12 Dec, 2022
Submission checks completed at journal
21 Nov, 2022
First submitted to journal
18 Nov, 2022
Editor assigned by journal
18 Nov, 2022

You are reading this latest preprint version

Intracellular BAPTA directly inhibits PFKFB3, thereby impeding mTORC1-driven Mcl-1 translation and killing Mcl-1-addicted cancer cells

Status:

Journal Publication

Version 1

Abstract

Figures

Introduction

Materials And Methods

1. Cell culture and transfections

2. Transfection

3. Reagents, antibodies and constructs

4. Apoptosis assay

5. RNA extraction and PCR analysis

6. Western blot analysis

7. Cytosolic Ca²⁺ measurements

8. Live cell imaging

9. Metabolic flux analysis

10. Extracellular lactate assay

11. Tracer metabolomics analysis

12. PFKFB3 kinase activity assay

13. Molecular docking

14. Statistical analysis

Results

1. BAPTA_i induces apoptosis in B-cell lymphoma cell lines

2. BAPTA_i elicits decreased abundance of Mcl-1 in both SU-DHL-4 and OCI-LY-1 cells

3. BAPTA_i decreases Mcl-1 protein levels and provokes cell death in a Ca²⁺-independent manner

4. BAPTA_i-induced cell death is dependent on decreased abundance of Mcl-1

5. BAPTA_i reduces Mcl-1 protein levels by suppressing mTORC1, an important driver of MCL-1 translation

6. BAPTA_i rapidly suppresses glycolysis in cells preceding cell death by abrogating the conversion of fructose-6-phosphate into fructose-1,6-bisphosphate

7. BAPTA directly inhibits the activity of purified, recombinantly expressed PFKFB3

8. PFKFB3 inhibition suppresses mTORC1 activity, thereby evoking a decline in Mcl-1 protein levels

Discussion

Declarations

References

Additional Declarations

Supplementary Files

Status:

Journal Publication

Version 1

Intracellular BAPTA directly inhibits PFKFB3, thereby impeding mTORC1-driven Mcl-1 translation and killing Mcl-1-addicted cancer cells

Status:

Journal Publication

Version 1

Abstract

Figures

Introduction

Materials And Methods

1. Cell culture and transfections

2. Transfection

3. Reagents, antibodies and constructs

4. Apoptosis assay

5. RNA extraction and PCR analysis

6. Western blot analysis

7. Cytosolic Ca2+ measurements

8. Live cell imaging

9. Metabolic flux analysis

10. Extracellular lactate assay

11. Tracer metabolomics analysis

12. PFKFB3 kinase activity assay

13. Molecular docking

14. Statistical analysis

Results

1. BAPTAi induces apoptosis in B-cell lymphoma cell lines

2. BAPTAi elicits decreased abundance of Mcl-1 in both SU-DHL-4 and OCI-LY-1 cells

3. BAPTAi decreases Mcl-1 protein levels and provokes cell death in a Ca2+-independent manner

4. BAPTAi-induced cell death is dependent on decreased abundance of Mcl-1

5. BAPTAi reduces Mcl-1 protein levels by suppressing mTORC1, an important driver of MCL-1 translation

6. BAPTAi rapidly suppresses glycolysis in cells preceding cell death by abrogating the conversion of fructose-6-phosphate into fructose-1,6-bisphosphate

7. BAPTA directly inhibits the activity of purified, recombinantly expressed PFKFB3

8. PFKFB3 inhibition suppresses mTORC1 activity, thereby evoking a decline in Mcl-1 protein levels

Discussion

Declarations

References

Additional Declarations

Supplementary Files

Status:

Journal Publication

Version 1

7. Cytosolic Ca²⁺ measurements

1. BAPTA_i induces apoptosis in B-cell lymphoma cell lines

2. BAPTA_i elicits decreased abundance of Mcl-1 in both SU-DHL-4 and OCI-LY-1 cells

3. BAPTA_i decreases Mcl-1 protein levels and provokes cell death in a Ca²⁺-independent manner

4. BAPTA_i-induced cell death is dependent on decreased abundance of Mcl-1

5. BAPTA_i reduces Mcl-1 protein levels by suppressing mTORC1, an important driver of MCL-1 translation

6. BAPTA_i rapidly suppresses glycolysis in cells preceding cell death by abrogating the conversion of fructose-6-phosphate into fructose-1,6-bisphosphate