Impact of Nosema ceranae infection on sucrose solution consumption, midgut epithelial cell structure, and lifespan of Apis cerana cerana workers

doi:10.21203/rs.3.rs-1737488/v1

Download PDF

Research Article

Impact of Nosema ceranae infection on sucrose solution consumption, midgut epithelial cell structure, and lifespan of Apis cerana cerana workers

https://doi.org/10.21203/rs.3.rs-1737488/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Apis cerana is the original host for N. ceranae, and the impact of Nosema ceranae infection on A. cerana is largely unknown. In this study, workers of Apis cerana cerana were inoculated with N. ceranae spores. and the effects on the microsporidian spore load, host sucrose solution consumption, midgut epithelial cell structure, and lifespan were investigated. Spore counting suggested that the spore load in the host midguts decreased from 1 to 2 days post inoculation (dpi), while it increased from 2 to 13 dpi. No statistically significant difference in workers’ sucrose solution consumption was detected between N. ceranae-inoculated and un-inoculated groups. Microscopic observation showed darkly stained microsporidia in the midgut epithelial cells of N. ceranae-inoculated workers from 7 to 10 dpi. Additionally, the boundary of N. ceranae-inoculated host epithelial cells was blurred, the nucleus had almost disappeared, and the nucleic acid substance was diffused, whereas the boundary of un-inoculated midgut epithelial cells remained intact and the darkly stained nucleus was clear. The survival rates of workers in both N. ceranae-inoculated groups and un-inoculated groups started to decrease at 5 dpi. Additionally, the survival rate of workers in N. ceranae-inoculated groups was nearly always lower than that in un-inoculated groups, and there was a significant difference between these two groups from 11 to 20 dpi. These results demonstrate that the spore load of N. ceranae continuously elevated with microsporidian proliferation, causing damage to the midgut epithelial cell structure and shortening the host’s lifespan. Our findings offer a solid basis for exploring the molecular mechanism underlying N. ceranae infection and N. ceranae–A. cerana interaction.

Honey bee

Apis cerana

Apis cerana cerana

Nosema ceranae

Host-parasite interaction

Apis cerana is the original host for Nosema ceranae, a fungal parasite that causes bee nosemosis, a chronic disease that frequently occurs in colonies throughout the world (Klee et al. 2007; Pașca et al. 2021). After long-term interactions and co-evolution, A. cerana and N. ceranae have adapted to living with each other (Li et al. 2012). Since the first identification of N. ceranae in A. ceranae by Fries et al. (Fries et al. 1996), N. ceranae has been reported to infect European honeybees (Apis mellifera) in Taiwan, Europe, North America (Klee et al. 2007; Huang et al. 2007; Higes et al. 2006). Currently, N. ceranae is the most predominant microsporidian in honeybees worldwide (Martín-Hernández et al. 2018).

Previous studies suggested that N. ceranae infection could lead to damage to the midgut epithelial cell structure, an increase in the consumption of sucrose solution, inhibition of apoptosis and immunosuppression, earlier foraging activity, as well as a shortening of the lifespan for European honeybee (Apis mellifera) workers (García-Palencia et al. 2010; Mayack and Naug 2009; Kurze et al, 2018; Goblirsch et al. 2013). However, few studies have investigated the influence of N. ceranae infection on A. cerana (Wu et al. 2020; Sinpoo et al. 2018), and a deeper understanding of microsporidian infection and microsporidian–host interaction is lacking.

Apis cerana cerana, the nominated A. cerana species, is a bee species that exists in China and is widely used in beekeeping practice in many Asian countries (Lin et al. 2016). To decipher the interaction between N. ceranae and Apis cerana cerana workers at the molecular level, our team previously identified the miRNA response and miRNA-regulated network of the host following N. ceranae infection (Chen et al. 2019) and performed a comprehensive investigation of the profiles of highly expressed genes in both the host and microsporidian (Fu et al. 2020; Xiong et al. 2020). Recently, our group investigated the immune response of A. c. cerana workers to N. ceranae infection using a transcriptomic investigation and revealed that different cellular and humoral immune responses were utilized by A. c. cerana and Apis mellifera ligustica workers to defend themselves against infection by N. ceranae (Xing et al. 2021).

At present, the influence of N. ceranae infection on A. cerana is largely unknown. In the present study, to evaluate the impact of N. ceranae infection on A. c. cerana workers, N. ceranae spores were purified and used to inoculate newly emerged A. c. cerana workers. This was followed by an in-depth investigation of the microsporidian spore load as well as the host sucrose solution consumption and survival rate. Additionally, paraffin sections of host midgut tissue were prepared and subjected to microscopic observation. Our data not only offer valuable experimental evidence for N. ceranae infection of A. c. cerana workers but also contribute to the dissection of the host response, microsporidian infection, and host–microsporidian interaction.

Collection of bees for spore extraction and spore inoculation

A. c. cerana workers were obtained from colonies in the teaching apiary of the College of Animal Sciences (College of Bee Science), Fujian Agricultural and Forestry University. Microscopic observation and PCR detection showed that these workers were Nosema-free. No Varroa was observed during the experiment, and there were no specific bands amplified from N. apis, N. ceranae, or several viruses, such as SBV, DWV, IAPV, BQCV, KBV, and CBPV, on the basis of RT-PCR with specific corresponding primers (Xing et al. 2021).

N. ceranae-infected A. c. cerana workers were obtained from an apiary located in Minhou County, Fuzhou City, China. N. ceranae spores had previously been prepared using a discontinuous density gradient Percoll method (Xing et al. 2021). Briefly, a total of 200 foragers were collected from an infected colony. The midguts were dissected and then homogenized in distilled water, followed by filtration through four layers of sterile gauze and three cycles of centrifugation at 6000× g for 5 min. The sediment was resuspended and purified with a discontinuous Percoll gradient (Solarbio). The spore pellet was isolated using a sterile syringe followed by centrifugation on a discontinuous Percoll gradient.

Experimental inoculation and artificial rearing of workers

Before artificial inoculation, the prepared microsporidian spores were observed microscopically (Fig. 1A) and examined by PCR using specific primers for N. ceranae (F: CGGATAAAAGAGTCCGTTACC; R: TGAGCAGGGTTCTAGGGAT), as previously described by Chen et al (Chen et al. 2019) (Fig. 1B). Inoculation and rearing of A. c. cerana workers were performed following our previously established protocol (Chen et al. 2019) (Fig. 1C-E). In this study, at 24 h after emergence, members of the treatment group (n = 35) were each fed 5 µL of 50% (w/v) sucrose solution containing N. ceranae spores (1×10⁶ per mL), while members of the control group (n = 35) were fed 5 µL of sucrose solution without microsporidian spores. The treatment group (or control group) contained six plastic cages. All workers were reared in an incubator at 34 ± 0.5 ℃ and 60–70% RH. After 24 h, the honeybees were fed ad libitum with a feeder containing 4 mL of 50% (w/v) sucrose solution, and the feeders were replaced daily throughout the experiment. Each cage was carefully checked, and the dead worker bees were removed each day. Three biological replicas were used in this experiment.

Measurement of spore load in workers’ midguts

Using the method described by our team (Geng 2021), the spore load in the workers’ midguts during the N. ceranae infection process was counted continuously. In brief, (1) after inoculation with N. ceranae, a single worker in the treatment group was taken from the cage every day, and their midgut was then dissected using a clean ophthalmic forceps and transferred into a sterile 1.5 µL Eppendorf (EP) tube. (2) Next, 200 µL of sterile water was added to the EP tube, and then full grinding (Meibi, Zhejiang, China) with an automatic high throughput tissue grinder was carried out. (3) Sterile water (800 µL) was added to the grinding liquid and then fully mixed by repeated shaking. (4) Using a micropipette, 100 µL of the aforementioned solution was carefully observed using a hemocytometer plate (Qiujing Shanghai, China) under an optical microscope (CSOIF, Shanghai, China), and then spore counting was conducted.

Detection of host sucrose solution consumption

Daily consumption of sucrose solution by each worker in the N. ceranae-inoculated and un-inoculated groups was analyzed using a previously described method (Liu et al. 2020; Di et al. 2016). The feeder containing 4 mL of sucrose solution was weighed, and the weight was recorded as A. To avoid error due to repeated changing of feeders, the feeder was weighed every 24 h thereafter, and the weight was recorded as B. The sucrose solution in the feeder was replaced daily. Sucrose solution consumption was calculated per worker per day following the formula (B-A)/number of survivors in the N. ceranae-inoculated group (or un-inoculated group).

Paraffin section, hematoxylin eosin (HE) staining, and microscopic observation of workers’ midgut tissues

At 7 days post inoculation (dpi), 8 dpi, 9 dpi, and 10 dpi, midgut tissues of workers in the N. ceranae-inoculated group and un-inoculated group were dissected, respectively. Next, 4% paraformaldehyde was used to fix the midgut tissues. By using an embedding center (Junjie, Wuhan, China) and a microtome (Leica, Nussloch, Germany), paraffin sections of midguts were stained with HE stained by Shanghai Sangon Biological Engineering Co. Ltd., and then detected under an optical microscope with digital camera (SOPTOP, Shanghai, China).

At 7, 8, 9 and 10 days post inoculation (dpi), midgut tissues form workers in the N. ceranae-inoculated and un-inoculated groups were dissected. Next, 4% paraformaldehyde was used to fix the midgut tissues. By using an embedding center (Junjie, Wuhan, China) and a microtome (Leica, Nussloch, Germany), paraffin sections of midguts were stained with HE by Shanghai Sangon Biological Engineering Co. Ltd., and then detected under an optical microscope with a digital camera (SOPTOP, Shanghai, China).

Survival rate of workers

Following the protocol mentioned above, A. c. cerana workers were inoculated with N. ceranae spores and artificially reared. In another group, workers were fed with sucrose solution free of microsporidian spores. After inoculation, the numbers of dead workers from the N. ceranae-inoculated and un-inoculated groups were recorded daily until 20 days post inoculation. This was followed by calculated of the survival rate and data analysis using GraphPad Prism 6.0 software (GraphPad, San Diego, CA, USA).

Statistics

Statistical analysis of the data was performed using SPSS software version. 21 (IBM, Armonk, NY, USA) and GraphPad Prism 6.0 software. Data were presented using mean ± standard deviation (SD), and the significance of the microsporidian spore load and host sucrose solution consumption was analyzed using One-Way ANOVA. P values were corrected with the Bonferroni test. The log-rank (Mantel-Cox) test was used to analyze the host survival rate. P < 0.05 was considered to indicate a statistically significant difference, and P < 0.01 was considered to indicate a highly significant difference.

Dynamics of N. ceranae spore load in the midguts of A. c. ceranae workers

The spore counting results suggest that, in comparison with the spore load at 0 dpi, the spore load in the host midgut decreased from 1 dpi (df = 5, P = 0.0002) to 2 dpi (df = 5, P < 0.0001), whereas an elevated trend was displayed from 2 dpi (df = 5, P < 0.0001) to 13 dpi (df = 5, P = 0.0376); however, the spore load decreased from 13 dpi (df = 5, P = 0.0376) to 14 dpi (df = 5, P = 0.0194) (Fig. 2).

A non-significant difference in sucrose solution consumption between N. ceranae-inoculated and un-inoculated workers was found

The sucrose solution consumption of A. c. cerana workers was calculated, and it was found that from 1 dpi (P = 0.6702) to 20 dpi (P = 0.5332), the consumption of workers in the N. ceranae-inoculated group was nearly always higher than that of workers in the un-inoculated group, except for at 3 dpi (P = 0.4859), 17 dpi (P = 0.7745), and 20 dpi (P = 0.5332) (Fig. 3). The average sucrose consumption of N. ceranae-inoculated and un-inoculated workers was 0.0357 ± 0.0136 and 0.0323 ± 0.0066 g per day, respectively. However, a significant difference in sucrose solution consumption between these two groups was only observed at 5 dpi (P = 0.0422) and 13 dpi (P = 0.0286) (Fig. 3).

The midgut epithelial cell structure of A. c. cerana workers was damaged by N. ceranae infection

Microscopic observation of paraffin sections showed darkly stained microsporidia in the midgut epithelial cells of N. ceranae-inoculated workers from 7 dpi to 10 dpi, whereas no microsporidia were detected in the cells of un-inoculated workers (Fig. 4). Additionally, the number of microsporidian spores in the host cells gradually increased with extension of the infection time (Fig. 4). Moreover, the boundaries of un-inoculated host epithelial cells were found to be intact and the darkly stained nuclei were clear, while the boundaries of midgut epithelial cells of N. ceranae-inoculated workers were blurred, the nuclei had almost disappeared, and the nucleic acid substances were diffused (Fig. 4).

The lifespan of A. c. cerana workers was shortened by N. ceranae infection

The survival rate statistics indicate that the survival rates of workers in both the N. ceranae-inoculated and un-inoculated groups at 1 to 5 dpi were pretty high, and there was little difference between groups (Fig. 5). The survival rates of both groups started to decrease at 5 dpi (Fig. 5). From 5 to 11 dpi, the survival rate of workers in the N. ceranae-inoculated group was lower than that in the un-inoculated group, whereas the survival of workers in the N. ceranae-inoculated group was significantly lower than that in the un-inoculated groups from 11 to 20 dpi (Fig. 5).

Currently, our understanding of the interaction between the Asian honeybee and N. ceranae is very limited. Previous work suggested that both A. mellifera and A. cerana workers could be effectively infected by inoculation with N. ceranae spores (Tsai et al. 2003; Jack et al. 2016). It has been suggested that in A. mellifera workers’ midguts, the spore load of N. ceranae continuously increases from 7 to 14 dpi and from 12 dpi to 20 dpi (Huang and Solter 2013; Charbonneau et al. 2016). Here, we detected that the spore load of N. ceranae increased from 2 to 13 dpi (Fig. 2), indicating continuous proliferation of N. ceranae in host cells. In detail, the spore load of N. ceranae in the workers’ midguts was found to decrease from 1 to 2 dpi, and then increase from 2 to 5 dpi; thereafter, it decreased from 5 to 6 dpi and continuously elevated from 6 to 9 dpi (Fig. 2). It is speculated that the life cycle of N. ceranae in the midgut epithelial cells of A. c. cerana workers is approximately five days, longer than that of A. mellifera workers infected by N. ceranae (about four days). To a certain extent, this shows that N. ceranae is more virulent against A. mellifera workers than A. cerana workers, which is in accordance with the phenomenon that A. mellifera workers are usually heavily infected by N. ceranae (Higes et al. 2007). Additionally, microscopic observation of paraffin sections showed that the number of microsporidia in the midgut epithelial cells increased from 7 to 10 dpi (Fig. 4), further indicating continuous multiplication of N. ceranae during the infection process. These results offer a solid basis for further investigations of N. ceranae infection of A. cerana workers, for example, functional studies on fungal virulence factor-associated genes and development of the RNAi-based control strategy.

N. ceranae infection causes damage to the structure of midgut epithelial cells in A. mellifera workers (García-Palencia et al. 2010). Darkly stained microsporidia were clearly detected in the midgut epithelial cells of N. ceranae-inoculated workers from 7 to 10 dpi (Fig. 4). The boundaries of midgut epithelial cells in N. ceranae-inoculated workers were blurred, and the nuclei had almost disappeared, with the nucleic acid substances dispersed around the cytoplasm (Fig. 4). This suggests that N. ceranae infection damages the structure of the midgut epithelial cells in A. c. cerana workers.

Paris et al (Paris et al. 2017). assessed the survival rate and eating behavior of A. mellifera workers infected by N. ceranae for a period of 1 to 22 days. The results showed that the survival rate of infected workers was significantly lower than that of un-infected workers. In a previous study, we observed that the mortality rate of A. mellifera workers inoculated with N. ceranae spores gradually increased over time, and the mortality rate of N. ceranae-inoculated workers was significantly higher than that of un-inoculated workers at 7 and 10 dpi (Chen et al. 2019). It has been documented that N. ceranae infection significantly increases the mortality rate of A. cerana workers (Huang et al. 2018). In this study, the survival rates of workers in both the N. ceranae-inoculated and un-inoculated groups were pretty high from 1 to 5 dpi (Fig. 5), implying that N. ceranae had little influence on host longevity at the early stage of infection. In addition, from 5 to 20 dpi, the survival rate of N. ceranae-inoculated workers was always lower than that of un-inoculated workers, and the difference was significant at 11 to 20 dpi (Fig. 5), indicating that N. ceranae infection shortened the lifespan of A. cerana workers, similar to the finding of Huang et al (Huang et al. 2018). In conclusion, N. ceranae is able to exert negative influences on the midgut epithelial cell structure and the lifespan of A. c. cerana workers during the infection process.

Taken together. We conducted an in-depth investigation of N. ceranae infection of Apis cerana cerana workers and the resulting impacts on host sucrose solution consumption, midgut epithelial cell structure, and lifespan. Our results indicate that the spore load continuously elevates as N. ceranae proliferates, causing damage to the host midgut epithelial cell structure and decreasing the host’s lifespan. The findings of this current work provide a solid foundation for dissecting the mechanism underlying N. ceranae infection and the interaction between N. ceranae and A. cerana.

Funding This research was funded by the National Natural Science Foundation of China (32172792,31702190), the Earmarked Fund for China Agriculture Research System of MOF and MARA(CARS-44-KXJ7), the Outstanding Scientific Research Manpower Fund of Fujian Agriculture and Forestry University (xjq201814), the Master Supervisor Team Fund of Fujian Agriculture and Forestry University (Rui Guo).

Acknowledgments We thank all editors and reviewers for their helpful and constructive comments. RG appreciates his adorable daughter for her love and goodness.

Conflicts of Interest The authors declare that they have no conflict of interest.

Availability of data and material Not applicable

Author Contributions R.G. and D.C. designed this research; Q.L., M.S. and X.F. contributed to the writing of the article; Q.L., M.S., X.F., W.Z., D.Z., Y.H., Z.W., K.Z., K.Y., H.Z., Y.S. and Z.F., conducted experiments and data analyses. R.G. and D.C. supervised the study and preparation of the manuscript.

Ethics approval Not applicable

Consent to participate Not applicable

Consent for publication Not applicable

Charbonneau, L.R.; Hillier, N.K.; Rogers, R.E.; Williams, G.R.; Shutler, D. Effects of Nosema apis, N. ceranae, and coinfections on honey bee (Apis mellifera) learning and memory. Sci Rep. 2016, 6, 22626.
Chen, D.F.; Du, Y.; Chen, H.Z.; Fan, Y.C.; Fan, X.X.; Zhu, Z.W.; Wang, J.; Xiong, C.L.; Zheng, Y.Z.; Hou, C.S.; Diao, Q.Y.; Guo, R. Comparative identification of micrornas in Apis cerana cerana workers' midguts in response to Nosema ceranae invasion. Insects. 2019a, 10(9): 258.
Chen, D.F.; Chen, H.Z.; Du, Y.; Zhou, D.D.; Geng, S.H.; Wang, H.P.; Wan, J.; Xiong, C.L.; Zheng, Y.Z.; Guo, R. Genome-wide identification of long non-coding RNAs and their regulatory networks involved in Apis mellifera ligustica response to Nosema ceranae infection. Insects. 2019b, 10, 245.
Di, N.; Hladun, K.R.; Zhang, K.; Liu, T.X.; Trumble, J.T. Laboratory bioassays on the impact of cadmium, copper and lead on the development and survival of honeybee (Apis mellifera L.) larvae and foragers. Chemosphere. 2016, 152, 530–8.
Fries, I.; Feng, F.; Silva, A.D.; Slemenda, S.B.; Pieniazek, N.J. Nosema ceranae n. sp. (Microspora, Nosematidae), morphological and molecular characterization of a microsporidian parasite of the Asian honey bee Apis cerana (Hymenoptera, Apidae). European Journal of Protistology, 1996, 32(3): 356–365.
Fu, Z.M.; Zhou, D.D.; Chen, H.Z.; Geng, S.H.; Chen, D.F.; Zheng, Y.Z.; Xiong, C.L.; Xu, G.J.; Zhang, X.; Guo, R. Analysis of highly expressed genes in Apis cerana cerana workers' midguts responding to Nocema ceranae stress. Journal of Sichuan University(Natural Science Edition). 2020, 57(01): 191–198.
García-Palencia, P.; Martín-Hernández, R.; González-Porto, A.; Marin, P.; Meana, A.; Higes, M. Natural infection by Nosema ceranae causes similar lesions as in experimentally infected caged-workers honey bees (Apis mellifera). J. Apic. Res. 2010, 49, 278–283.
Goblirsch, M.; Huang, Z.Y.; Spivak, M. Physiological and behavioral changes in honey bees (Apis mellifera) induced by Nosema ceranae infection. PLoS One. 2013, 8, e58165.
Geng, S.H. Premary study on the molecular mechanism underlying Nosema ceranae infection of Apis mellifera ligustica worker. M.D. thesis, Fujian Agriculture and Forestry University, Fujian, China, 2021.
Higes, M.; Martín, R.; Meana, A. Nosema ceranae, a new microsporidian parasite in honeybees in Europe. J Invertebr Pathol. 2006, 92(2): 93–5.
Huang, W.F.; Jiang, J.H.; Chen, Y.W.; Wang, C.H. A Nosema ceranae isolate from the honeybee Apis mellifera. Apidologie, 2007, 38(1): 30–37.
Huang, W.F.; Solter, L.F. Comparative development and tissue tropism of Nosema apis and Nosema ceranae. J Invertebr Pathol. 2013, 113, 35–41.
Huang, S.K.; Ye, K.T.; Huang, W.F.; Ying, B.H.; Su, X.; Lin, L.H.; Li, J.H.; Chen, Y.P.; Li, J.L.; Bao, X.L.; Hu, J.Z. Influence of feeding type and Nosema ceranae infection on the gut microbiota of Apis cerana workers. mSystems. 2018, 3(6): e00177-18.
Higes, M.; García-Palencia, P.; Martín-Hernández, R.; Meana, A. Experimental infection of Apis mellifera honeybees with Nosema ceranae (Microsporidia). J Invertebr Pathol. 2007, 94(3): 211–7.
Jack, C.J.; Lucas, H.M.; Webster, T.C.; Sagili, R.R. Colony level prevalence and intensity of Nosema ceranae in honey bees (Apis mellifera L.). PLoS One. 2016, 11, e0163522.
Klee, J.; Besana, A.M.; Genersch, E.; Gisder, S.; Nanetti, A.; Tam, D.Q.; Chinh, T.X.; Puerta, F.; Ruz, J.M.; Kryger, P.; Message, D.; Hatjina, F.; Korpela, S.; Fries, I.; Paxton, R.J. Widespread dispersal of the microsporidian Nosema ceranae, an emergent pathogen of the western honey bee, Apis mellifera. J Invertebr Pathol. 2007, 96(1): 1–10.
Kurze, C.; Le Conte, Y.; Kryger, P.; Lewkowski, O.; Müller, T.; Moritz, R.F.A. Infection dynamics of Nosema ceranae in honey bee midgut and host cell apoptosis. J Invertebr Pathol. 2018, 154: 1–4.
Li, J.L.; Qin, H.R.; Wu, J.; Sadd, B.M.; Wang, X.H.; Evans, J.D.; Peng, W.J.; Chen, Y.P. The prevalence of parasites and pathogens in Asian honeybees Apis cerana in China. PLoS One. 2012, 7(11): e47955.
Lin, Z.; Page, P.; Li, L.; Qin, Y.; Zhang, Y.; Hu, F.; Neumann, P.; Zheng, H.; Dietemann, V. Go east for better honey bee health: Apis cerana is faster at hygienic behavior than A. mellifera. PLoS One. 2016, 11(9): e0162647.
Liu, Y.J.; Qiao, N.H.; Diao, Q.Y.; Jing, Z.; Vukanti, R.; Dai, P.L.; Ge, Y. Thiacloprid exposure perturbs the gut microbiota and reduces the survival status in honeybees. J Hazard Mater. 2020, 389, 121818.
Mayack, C.; Naug, D. Energetic stress in the honeybee Apis mellifera from Nosema ceranae infection. J Invertebr Pathol. 2009, 100(3): 185–8.
Martín-Hernández, R.; Bartolomé, C.; Chejanovsky, N.; Le Conte, Y.; Dalmon, A.; Dussaubat, C.; García-Palencia, P.; Meana, A.; Pinto, M.A.; Soroker, V.; Higes, M. Nosema ceranae in Apis mellifera: a 12 years post detection perspective. Environ Microbiol. 2018, 20, 1302–1329.
Paris, L.; Roussel, M.; Pereira, B.; Delbac, F.; Diogon, M. Disruption of oxidative balance in the gut of the western honeybee Apis mellifera exposed to the intracellular parasite Nosema ceranae and to the insecticide fipronil. Microb Biotechnol. 2017, 10, 1702–1717.
Sinpoo, C.; Paxton, R.J.; Disayathanoowat, T.; Krongdang, S.; Chantawannakul, P. Impact of Nosema ceranae and Nosema apis on individual worker bees of the two host species (Apis cerana and Apis mellifera) and regulation of host immune response. J Insect Physiol. 2018, 105, 1–8.
Pașca, C.; Matei, I.A.; Diaconeasa, Z.; Rotaru, A.; Erler, S.; Dezmirean, D.S. Biologically active extracts from different medicinal plants tested as potential additives against bee pathogens. Antibiotics (Basel). 2021, 10(8): 960.
Tsai, S.J.; Lo, C.F.; Soichi, Y.; Wang, C.H. The characterization of microsporidian isolates (Nosematidae: Nosema) from five important lepidopteran pests in Taiwan. J Invertebr Pathol. 2003, 83, 51–9.
Wu, Y.Q.; Zheng, Y.F.; Chen, Y.N.; Chen, G.W.; Zheng, H.Q.; Hu, F.L. Apis cerana gut microbiota contribute to host health though stimulating host immune system and strengthening host resistance to Nosema ceranae. R Soc Open Sci. 2020, 7, 192100.
Xiong, C.L.; Chen, H.Z.; Geng, S.H.; Zhou, N.H.; Zhou, D.D.; Zhu, Z.W.; Chen, D.F.; Zheng, Y.Z.; Xu, G.J.; Zhang, X.; Guo, R. Expression profile of high-expressing genes and its potential role during Apis cerana cerana infected by Nosema ceranae. Journal of Sichuan University(Natural Science Edition). 2020, 57(03): 596–604
Xing, W.H.; Zhou, D.D.; Long, Q.; Sun, M.H.; Guo, R.; Wang, L.M.; Immune response of eastern honeybee worker to Nosema ceranae infection revealed by transcriptomic investigation. Insects. 2021, 12, 728

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Impact of Nosema ceranae infection on sucrose solution consumption, midgut epithelial cell structure, and lifespan of Apis cerana cerana workers

Status:

Version 1

Abstract

Figures

Introduction

Materials And Methods

Experimental inoculation and artificial rearing of workers

Measurement of spore load in workers’ midguts

Detection of host sucrose solution consumption

Paraffin section, hematoxylin eosin (HE) staining, and microscopic observation of workers’ midgut tissues

Survival rate of workers

Statistics

Results

Dynamics of N. ceranae spore load in the midguts of A. c. ceranae workers

A non-significant difference in sucrose solution consumption between N. ceranae-inoculated and un-inoculated workers was found

The lifespan of A. c. cerana workers was shortened by N. ceranae infection

Discussion

Conclusions

Declarations

References

Additional Declarations

Status:

Version 1