Cell cultures
We purchased MKN28 cells and AGS cells from the Cell Bank of Chinese Academy of Sciences (Shanghai, China). Ham's F-12 medium used contained fetal bovine serum, streptomycin, and penicillin. We cultured cells in an incubator at 37 °C with air having 5% CO2. MKN28/DDP and AGS/DDP cells were induced in vitro by continuous incrementation and intermittent high-dose shock with low concentration cisplatin (KeyGEN BioTECH, Jiangsu, China) for 6 months.
CCK8
Placed cells into 96-well plates with 3000 cells per well and cultivated for 6 hours. After cell adherence, cisplatin was added according to the designed 10 concentration gradients, and 5 multiple Wells were set for each concentration gradient. Then the cells were cultured in an incubator for 24h. The Cell Counting Kit-8 (MedChemExpress, US) was used to detect cell viability. Measure the absorbance at 450 nm, calculate the semi-inhibitory concentration (IC50), and repeat three times.
Lentivirus‑mediated RNA interference (RNAi) and overexpression
We used CLIC1 interfering RNA sequences and negative control siRNA sequences consistent with previous studies[13]. The synthesized siRNA was inserted into the lentiviral vector. We purchased lentiviral vectors for CLIC1 overexpression (OE) and negative control vectors (NC) from the Genecopoeia. The lentiviral vector was then transfected into 293T cells, and the supernatant of the virus was collected and concentrated on determining the final titer of the virus. The recombinant lentivirus was transfected into cells, and the medium was changed after 16 hours. The transfected cells were observed by fluorescence microscopy 48 h later.
RT‑PCR
First, we utilized the RNA extraction kit (Vazyme, China) to extract the total RNA of cells and then reverse-transcribed the RNA into cDNA and diluted it into 100ul. ChamQ SYBR QRT-PCR Master Mix (Vazyme, China) was used for QRT-PCR detection. The thermal cycling parameters are as follows: Initial denaturation conditions are 95℃ denaturation 30s, 95℃ denaturation 10s, 60℃ denaturation 30s, and 40 cycles. The mRNA expression differences were normalized to β-actin and recorded as multiples of increase over specified controls. The primer sequences are shown in Table 1.
Table 1
Name
|
Sequence
|
CLIC1-F
|
ACCGCAGGTCGAATTGTTC
|
CLIC1-R
|
ACGGTGGTAACATTGAAGGTG
|
β-actin-F
|
CTACCTCATGAAGATCCTCACCGA
|
β-actin-R
|
TTCTCCTTAATGTCACGCACGATT
|
Western blot
RIPA lysis buffer (Beyotime, China) and PMSF (Solarbio, China) were used for cell lysis in a ratio of 100:1. we used the BCA method to determine the protein concentration after extracting protein (Beyotime, China). Proteins were isolated by SDS-PAGE and transmitted onto a PVDF membrane. Subsequently, the PVDF membrane was sealed with 5% skim milk expanded with Tris-buffered saline (TBS), and primary antibodies specific to LC3(CST, USA), P62 (CST, USA), GAPDH (PTG, Wuhan, China), Beclin-1(PTG, Wuhan, China), beta-ACTB (PTG, Wuhan, China) and CLIC1 (Sant Cruz, USA) were incubated overnight at 4℃, then incubated at room temperature with the corresponding secondary antibody for 1 h. The ECL kit (Tanon, China) was used as the luminescent fluid, and using li-Cor Biosciences (Lincoln, NE) detected bands and quantified them with the Image J software.
Cell invasion and migration assay
Used in the serum-free medium to dissolve the matrix gel and diluted to 300μg/ mL for cell invasion assay.100μL was added to each Transwell chamber and the matrix solidified after incubation at 37°C for 1h. MKN28 and AGS cells and drug-resistant cells were suspended in serum-free medium. The cell number was counted and diluted at 10000 cells /50ul. 200μl MKN28, MKN28/DDP, AGS, and AGS/DDP with a density of 3×105/ml were seeded in each compartment, respectively, and 800μl of Ham's F-12 contained 10% fetal bovine serum was counted in the downward compartment and incubated for 24 h. After 24h, used 0.1% crystal violet (Beyotime, China) to stain cells that crossed the membrane and counted in 5 microscope fields randomly selected from each filter. The matrix glue was not prepared for the cell migration test, and the rest was the same as the invasion test.
In vivo cisplatin sensitivity test
We commissioned Guangxi Yisheng Biotechnology Co., Ltd. to conduct zebrafish experiments. Reproduction of zebrafish embryos occurs naturally in pairs. The embryos were cleaned at 6 and 24 hours after fertilization and suitable embryos were selected according to their stage of development. Embryos were incubated at 28℃. The cells of the NC group and CLIC1-OE group were digested and centrifuged successively, and suspending the cells in a new medium to prepare 1-2×107 cells /mL for future use. The cells were labeled with red fluorescence, and then the two groups of cells were respectively injected into the yolk sac of 2-day zebrafish. About 500 cells were injected into each fish. After injection, zebrafish recovered at 28℃ for 1 hour and then transferred to a 35℃ incubator for 24 hours. After 24 hours, cisplatin injection was prepared with normal saline, and 2.5ng or normal saline was injected into the yolk sac of zebrafish in the two groups, respectively, and treated for 72 hours. Zebrafish in the NC group and OE group were observed and photographed under a fluorescence microscope for 24h and 96h, respectively, and the fluorescence intensity was counted. After the experiment, the young zebrafish were frozen and killed at -80℃ for preservation. The procedure of killing zebrafish was under the guidelines of the American Veterinary Medical Association (AVMA).
The 5-week-old male thymic BALB/ C nude mice were raised under certain conditions. It subcutaneously injected the NC or OE group AGS cells (6.5×107 in 200μ L medium) into the axillary region and checked for tumor growth every two days. When the implanted tumor grew to the eighth day, cisplatin was injected intraperitoneally every three days until day 28, and the dose of cisplatin was 3mg /kg each time [25], and then killed the mice on the 30th day. Finally, we extracted RNA and protein from the tumor for QRT-PCR and Western Blot experiments, and some primary tumors were paraffin-embedded for immunostaining analysis of CLIC1 protein expression.
Statistical analysis
Mean ± standard deviation was used to represent data. Using the t-test to compare the two groups and the Analysis of variance (ANOVA) was used to analysis the mean values between multiple groups. The difference was regarded as statistical significance when P<0.05. Calculations were made for at least three separate experiments.