LPAR5 confers cancer cells radioresistance associated with EMT activation via ERK/ Snail pathway

doi:10.21203/rs.3.rs-1742763/v1

Download PDF

Research

LPAR5 confers cancer cells radioresistance associated with EMT activation via ERK/ Snail pathway

https://doi.org/10.21203/rs.3.rs-1742763/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Epithelial-to-mesenchymal transition (EMT) is a critical event contributing cancer cells more aggressive phenotypes. EMT programs are frequently activated in radiation-targeted cells during the course of radiotherapy, and which often endows cancers the acquired radioresistance. Through RNA-seq based transcriptome analysis, here we found that LPAR5 is downregulated in the early response of HeLa cells to γ-rays irradiation. Radiation-induced alterations of LPAR5 expression were further revealed to be a bidirectional dynamic process in HeLa and A549 cells, i.e., early downregulating phase at 2 ~ 4h and late upregulating phase at 24h post-irradiation. Overexpression of LPAR5 prompts EMT programing and migration of cancer cells. Moreover, increased expression of LPAR5 is significantly associated with IR-induced EMT and confers cancer cells radioresistance. Knockdown of LPAR5 suppressed IR-induced EMT by attenuating the activation of ERK signaling and downstream Snail, MMP1, and MMP9 expressions. In conclusion, LPAR5 is an important upstream regulator of IR-induced EMT through modulating ERK/Snail pathway. This study provides further insights into understanding the mechanism of radiation-induced EMT and promising target for improving the effectiveness of cancer radiation therapy.

Radiotherapy is one of the most commonly used cancer therapy measures over the past century. It is sometimes used alone, but now is more frequently applied in combination strategy with other therapeutic methods including chemotherapy and immunotherapy.[1, 2]. With the increasing knowledge of advanced biology and in-depth understanding of radiobiological mechanisms, radiotherapy has been translating into better clinical practice, and obtained much better clinical curative outcomes[3]. Ionizing radiation (IR) kills the cells in dose-dependent through indirect and direct effects, double-strand break (DSB) is the main molecular event induced by IR to trigger the DNA damage response and cell death signaling[4]. Radioresistance of cancer cells and side effects of normal tissue injuries are two main barriers hindering the clinical application of radiotherapy. The radiosensitive determinants of both cancer cells and normal cells include the exogenous factors and endogenous factors. A series reports indicated that epithelial-mesenchymal transition (EMT) is one of the most important endogenous factors promoting the radioresistance of cancer cells and also development of normal tissue fibrosis [5–10]. EMT is a biological process that refers to the transformation of epithelial cells into cells with a mesenchymal phenotype under the control of a set of genes’ expression products. EMT results in reduced adhesion between cells and other epithelial cells, and the molecular characteristics of losing epithelial adhesion markers (E-cadherin) and gain of mesenchymal markers such as N-cadherin, vimentin and fibronectin[11]. During cancer progression, cancer cells originated from epithelial cells can develop both mesenchymal and epithelial characteristics, exhibiting hybrid E/M phenotype in a process known as partial EMT[12]. This phenotype of partial EMT is thought to confer tumors the properties of radio/chemoresistance[13] and metastasis[14, 15], immune escape[16], and generate circulating tumor cells [17, 18]and cancer stem cells[15]. EMT can endow tumors radioresistance, and in turn irradiation may further prompt EMT programing of cancer cells, ultimately increasing the radioresistance or metastatic progression.

Accumulating evidence suggests that IR-induced EMT accelerates the malignant progression of tumors in the course of radiotherapy, resulting in increased invasion, migration, radioresistance and chemoresistance in esophagus, cervical, breast, lung and liver cancers, etc, ultimately leading to tumor recurrence and treatment failure[5, 19–22]. [23]. Therefore, targeting EMT-related signaling pathways will be considered as promising therapeutic strategies for tumor treatment.

EMT programs are regulated by multiple signaling pathways, including these triggered by transforming growth factor-β (TGF-β), epidermal growth factor (EGF), and their associated signaling drivers such as Notch, Wnt, NF-κB, ERK, Hedgehog, and PI3K/Akt. These signaling molecules can be activated by ionizing radiation to involve in IR-induced EMT of cancer cells and normal tissue cells[24–26], e.g. pulmonary epithelial cells[27–29]. Due to the genetical diversity of cancer cells and complexity of radiation-induced cellular responses, the understanding referring to the mechanism of IR-induced EMT is still limited. Lysophosphatidic Acid Receptor 5(LPAR5) is a recently discovered member of LPAR family. all LPAR members belong to the G protein coupled receptor (GPCR) family[30].These 7-transmembrane GPCRs couple to one or more of the four classes of heterotrimeric G-proteins. All LPAR members signal through at least two of the four Gα subunit families (Gα12/13、Gαq/11、Gαi/o and GαS)[31, 32].Activated G proteins recruit downstream secondary messengers to regulate cell proliferation and cell migration[33].It was shown that LPAR plays an important role in the occurrence and development of cancer. It is abnormally expressed in a variety of tumors and mediates tumor growth, invasion and metastasis[34].LPAR5 is upregulated in papillary thyroid carcinoma (PTC), and downregulation of LPAR5 decreased the proliferation and migration phenotype via the PI3K/Akt pathway[35]. LPAR5 can promote PTC metastasis and tumorigenesis by activating the PI3K/AKT pathway, and LPAR5 can regulate the expression of EMT-related proteins, thereby affecting invasion and migration[36]. Knockout of LPAR5 significantly reduces melanoma-derived lung metastases in mice[37].Upregulation of the LPAR5 gene with an abnormally unmethylated state has been reported to enhance cell proliferation and motility in rat liver-derived hepatoma RH7777 and lung-derived adenocarcinoma RLCNR cells[38]. However, LPAR5 was also reported to negatively regulate cell motility and invasive activity in human osteosarcoma cells[39]. Although LPAR5 signaling is clearly associated with cancer initiation, progression and metastasis, whether and how LAPR5 involves in IR-induced EMT and radiosensitivity of cancer cells have so far remained unclear.

In this study, we constructed the responsive transcriptome of 4 Gy γ-ray irradiated HeLa cells by RNA-seq to identify key molecules involved in early responses to ionizing radiation. LPAR5 was found significantly depressed by irradiation. Our results demonstrate that LPAR5 acts as a key regulator of IR-induced EMT in tumor cells through the ERK/snail pathway.

Transcriptome-wide RNA-seq assay to identify early responsive targets determining sensitivity of cancer cells to radiotherapy

To reveal the patterns of radiation-impacting on messenger RNAs profiles for identifying the early responsive targets determining the sensitivity of cancer cells to radiotherapy, we performed transcriptome-wide RNA-sequencing (RNA-seq) assays in HeLa cells 0.5h post 4Gy of γ-rays irradiation and control cells. Genes with significant levels of differentially expressed mRNAs were subjected to GO and KEGG pathway analyses. GO analysis showed that the differential mRNA expression genes in irradiated HeLa cells are involved in a variety of biological processes, including signal transduction, regulation of transcription, apoptotic process, lipid metabolic process, G protein-coupled receptor signaling pathway); distribute in various cellular components (membrane, cytoplasm, plasma membrane, nucleus, subcellular organelles); and play roles in multiple molecular functions (protein binding, metal ion binding, DNA binding, hydrolysis activity, etc.(Fig. 1A). KEGG enrichment analysis showed that compared with unirradiated cells, differentially expressed genes in irradiated HeLa cells are enriched in tumor development-related pathways such as the PI3K-AKT signaling pathway, PPAR signaling pathway, NOD-like receptor signaling pathway and Jak-STAT signaling pathway, etc (Fig. 1B). Figure 1C represents the Scatter plot of the differential mRNA expression genes. Among 29529 gene sequenced in irradiated HeLa cells, there are 372 differential genes with statistical significance as compared to the control cells, including 312 down-regulated genes (83.8%) and 60 up-regulated genes (16.1%). Based on change levels of differential expressions and the analyses of GO and KEGG, we selected and confirmed the significantly down-regulated gene, lysophosphatidic acid receptor 5 (LPAR5), for further study.

Bidirectional alterations of LPAR5 expression induced by radiation

The transcriptome RNA sequencing (RNA-seq) data suggested the LPAR5 transcription down-regulated by radiation. We then performed real-time qPCR analysis and confirmed that the expression of LPAR5 mRNA was suppressed by 4 Gy γ-rays irradiation in HeLa and A549 cells (Fig. 2). Compared with the unirradiated cells, the RNA expression of LPAR5 significantly decreased at 2h and 4h after 4 Gy irradiation, and then gradually recovered (Fig. 2A and B).Western blot analysis also showed that in HeLa cells and A549 cells, the expression of LPAR5 protein decreased within 2–4 h after irradiation, and thereafter gradually recovered, even increased significantly at 24 h after irradiation (Fig. 2C and D). Therefore, ionizing radiation changes the expression of LPAR5 in a bidirectional dynamic processes of early downregulating phase and late upregulating phase. We further confirmed the dose-dependent inhibition of LPAR5 expression at 2 h after irradiation in mRNA level detected by qPCR (Fig. 2E and F) and protein level detected by Western blotting analysis (Fig. 2G and H) in both HeLa (Fig. 2E and G) and A549 cells (Fig. 2F and H).

Knockdown of LPAR5 inhibits cancer cells growth and metastasis and promotes apoptosis

In order to explore the effects of LPAR5 on proliferation phenotype of cancer cells, we knocked-down LPAR5 in HeLa cells and A549 cells by its specific siRNA molecules (Fig. 3A) and found that the proliferation of both cells were significantly suppressed (Fig. 3B and C). The suppressed cells growth was rescued by over expressing exogenous siRNA-resistant LPAR5 vectors. Furthermore, knockdown of LPAR5 significantly suppressed the colony-forming ability of HeLa (Fig. 3D and E) and A549 (Fig. 3F and G) cells. On the other hand, knockdown LPAR5 promoted the apoptosis of HeLa (Fig. 3H and I) and A549 cells (Fig. 3J and K), and which were attenuated by over expressing exogenous si-resistant LPAR5 vectors. The wound healing assay indicated that knockdown of LPAR5 dramatically inhibited the migratory ability of both HeLa (Fig. 3L and M) and A549 cells (Fig. 3N and O).

Overexpression of LPAR5 attenuates apoptosis and proliferation inhibition induced by radiation

To further explore the effects of LPAR5 in IR-induced apoptosis and inhibition of proliferation, we irradiated cells after overexpressing LPAR5 in HeLa cells and A549 cells. As shown in Fig. 4A and 4B, cells proliferation was suppressed by γ-ray irradiation, which was largely attenuated by overexpressing LPAR5. Similarly, overexpression of LPAR5 significantly attenuated the annihilation of colony-forming ability of HeLa (Fig. 4C and D) and A549 (Fig. 4E and F) cells after irradiation. We also found that overexpression of LPAR5 can significantly reduce the apoptosis induction of HeLa (Fig. 4G and H)and A549 ((Fig. 4I and J) cells caused by γ-ray irradiation.

LPAR5 plays critical role in radiation-induced EMT

According to our data, LPAR5 is an important molecule affecting the migration of HeLa cells and A549 cells. To further clarify the role of LPAR5, we determined its potential action on EMT of cancer cells. Western blot analysis showed that compared with the control group, E-cadherin expression was upregulated in HeLa and A549 cells after knocking-down LPAR5, while N-cadherin and vimentin expression was downregulated, and which can be rescued by over expressing siRNA-resistant LPAR5 (Fig. 5A and B). Conversely, overexpressing LPAR5 downregulated E-cadherin expression and upregulated N-cadherin and vimentin expression (Fig. 5C and D). These results indicated that LPAR5 promotes EMT. HeLa and A549 cells underwent EMT at 24 h after 4Gy irradiation as demonstrated by decreased E-cadherin expression and increased N-cadherin and vimentin expression (Fig. 5E and F). When LPAR5 was knocked down by specific siRNA in HeLa and A549 cells, IR-induced EMT was inhibited (Fig. 5E and F). The results indicated that LPAR5 plays a positive role in prompting IR-induced EMT.

LPAR5 promoted radiation-induced EMT through ERK/ Snail axis

To investigate the molecular pathway of LPAR5 functioning in IR-induced EMT, we tested the effect of LPAR5 on related EMT regulators and transcription factors. Western blot analysis showed that compared with the control group, p-ERK, MMP1, MMP9 and Snail expression was downregulated in HeLa and A549 cells after siRNA-mediated knockdown of LPAR5, while the expression of constitutive ERK was not affected (Fig. 5A and B). These alterations were rescued by over expressing siRNA-resistant LPAR5. Whereas overexpressing LPAR5 upregulated p-ERK, MMP1, MMP9 and Snail expressions but not constitutive ERK (Fig. 5C and D).In addition, after pre-treatment with ERK inhibitors FR180204, compared with the overexpressing LPAR5 group, the expression levels of p-ERK and Snail expression was downregulated in HeLa (Fig. 5E)and A549 cells(Fig. 5F),while the expression of constitutive ERK was not affected. These results suggest that LPAR5 can strictly control the expression of Snail, a critical component in EMT programing through the ERK pathway. As shown in Fig. 5G and 5H, the expressions of p-ERK, MMP1, MMP9 and Snail were upregulated in HeLa (Fig. 5G) and A549 cells (Fig. 5H) 24h after 4 Gy irradiation, and which were attenuated by knocking down of LPAR5 As the expression of LPAR5 protein was significantly increased at 24h after 4Gy irradiation (Fig. 2C and D, Fig. 5G and H), which may contribute to activation of p-ERK and Snail, and consequently promoting EMT program.

Radiotherapy is a common and effective method for clinical treatment of tumors. However, radioresistance is one of the main challenges for the applications of radiotherapy. At present, a series of studies have pointed out that radioresistance is related to DNA repair capacity, reduced apoptosis, cell cycle status, EMT and other factors, among which EMT is one of the most important factors affecting the sensitivity of cancer cells to ionizing radiation (IR)[40–42]. Studies have shown that IR-induced EMT accelerates the invasion, migration, and radioresistance of various tumor cell lines including lung, liver, and breast cancer after radiotherapy. In this study, we irradiated cervical cancer HeLa cells and lung cancer A549 cells and found that 4Gy ⁶⁰Co γ-irradiation induced EMT, characterized by decreased expression of the epithelial marker E-cadherin, and enhanced expression of the mesenchymal markers N-cadherin and vimentin. To our surprise, the expression of LPAR5 decreased in a dose-dependent manner for a short time at 2 ~ 4 h after irradiation, and then recovered expression, even increased significantly 24 hours after irradiation. We observed that knockdown of LPAR5 can significantly inhibit the proliferation and migration of tumor cells, while high expression of LPAR5 can increase the proliferation and inhibit apoptosis of tumor cells after irradiation. Similar to this study, researchers have demonstrated that LPAR5 plays an important role in melanoma invasion and metastasis[43]. Knockdown of LPAR5 promotes thyroid cancer (PTC) cell apoptosis and reduces proliferation through the PI3K-Akt pathway[35].

Through this study, we found that LPAR5 is an important molecule affecting migration of cervical cancer cells and lung cancer cells and is significantly associated with IR-induced EMT. Many studies have pointed out that LPA and its receptors play an important role in the process of tumor cell migration, the LPAR family triggers EMT and tumor progression through crosstalk with downstream signaling pathways such as NF-κB, MAPK/ERK, PI3K/AKT, TGF-β and Wnt/β-catenin, and other oncogenic signaling pathways [44–46].However, there are few studies on the role of LPAR5 in tumor progression. We found that knockdown of LPAR5 significantly inhibited IR-induced decrease of epithelial markers and elevation of mesenchymal markers, and overexpression of LPAR5 in HeLa cells and A549 cells significantly promoted EMT. LPAR5 had a significant effect on EMT phenotype, knockdown of LPAR5 significantly inhibited HeLa cell and A549 cell migration, and the above results suggest that LPAR5 is required for IR-induced EMT. Therefore, our data suggest that LPAR5 regulates IR-induced EMT.

We observed that 24 hours post IR treatment the expression of LPAR5 and p-ERK were upregulated, while the level of constitutive ERK remained no change. Although in previous studies LPAR5 was thought to interact with Gαq/11 and G12/13 to increase intracellular cAMP levels, and was involved in PI3K by interacting with Gαi/o -Akt pathway activation. However, a similar study indicated that activation of ERK1/ERK2 by LPAR5 via PKD-mediated phosphorylation of Ras and Rab interacting factor 1 [47]increased microglial migratory responses and increased expression and secretion of proinflammatory mediators [48]. Our results showed that p-ERK was significantly activated by LPAR5, and knockdown of LPAR5 significantly inhibited the IR-mediated increase of p-ERK, thereby blocking the IR-induced EMT mediated by p-ERK. Our results showed that p-ERK was significantly induced by LPAR5, and knockdown of LPAR5 significantly inhibited the IR-mediated increase of p-ERK, thereby blocking the IR-induced EMT mediated by p-ERK.

We show for the first time that LPAR5 can regulate Snail expression through the ERK pathway and mediate IR-induced EMT. The highly expressed LPAR5 upregulates the expression of Snail through the ERK pathway, thereby affecting the expression of MMP1 and MMP9.The ERK pathway is one of the major oncogenic signals in human cancers because its activation leads to an increase in proliferation, invasion, and metastasis [49–51]. The ERK pathway is often hyperactivated in tumors [52], acts as an inducer of cell migration and invasion through a Snail-mediated mechanism [53–56].MMPs can degrade various protein components in the extracellular matrix. At the same time, they can also disrupt the histological barrier of tumor cells and affect tumor migration, invasion, metastasis and angiogenesis [57–60], and MMPs are considered to be the main proteolytic enzymes in this process. We found that knockdown of LPAR5 significantly inhibited Snail, MMP1, and MMP9 elevated after IR treatment, thereby blocking IR-induced EMT. Based on our results and combined with previous reports and results, we believe that the LPAR5/ERK signaling pathway mediates IR-induced EMT through up-regulation of Snail. These findings provide strong evidence for the critical role of LPAR5 at the upstream to regulate the molecular network associated with IR-induced EMT, and which contribute the increased resistance of cancer cells to radiotherapy.

Cell Culture

The cell lines used in this study (human alveolar type II epithelial carcinoma cell line A549 and human cervical cancer cell line HeLa) were maintained in our laboratory. HeLa cells and A549 cells were grown in DMEM (Hygclone) containing 10% FBS (Hygclone and PAN) and 1% penicillin-streptomycin. All cells were cultured at 37℃ under 5% CO2 in a humidified incubator. Cells were subjected to ⁶⁰Co γ-ray irradiation at a dose rate of 85.69 cGy min^–¹ at room temperature.

Plasmid, siRNA

The full sequence of LPAR5 was cloned into pcDNA3.1 to generate over expression plasmid.

For LPAR5 knockdown, two synthesized duplex RNAi oligos targeting human mRNA sequences from Sigma were used (si-LPAR5-1:5′- GCAGCUGCAUCUUCCUGAUGCUCAU-3′; si-LPAR5-2:CGCCUGCACUUGGUGGUCUACAGCU). A scrambled duplex RNA oligo (5′-UUCUCCGAACGUGUCACGU-3′) was used as RNA control. Transfected using Lipofectamine 2000 reagent (Invitrogen) with vector control, plasmid construct, siRNA negative control (siNC), or siRNAs according to the manufacturer’s instructions.

RNA extraction and quantitative RT-PCR analysis

Total RNAs were isolated using the TRIzol. 1ug RNA was reverse-transcribed into cDNA with ReverTra Ace qPCR RT Master Mix with gDNA Remover (TOYOBO; Code No.FSQ-301) according to the manufacturer’s instructions. Quantitative real-time PCR analysis was performed with 1μL cDNA using HUNDERBIRD SYBR qPCR Mix (TOYOBO; Code No.QPS-201). Actin was used as endogenous control.LPAR5 primers used for qRT-PCR,F:5′- GAGGTCTCTGCTGCTGAT-3′; R:5′- AGAACTGTTGGTTGAGGAG-3′

Western blot analysis and antibodies

Cells were ruptured with RIPA buffer containing 5 mM EDTA, PMSF, and phosphatase inhibitor cocktail. Cell extracts were centrifuged for 15 min at 12,000 × g and supernatants were then collected. About 40μg total proteins were resolved by SDS-polyacrylamide gel electrophoresis and transferred onto Nitrocellulose (NC) membranes, blocked with 5% non-fat milk at room temperature for 2 h, and incubated with primary antibodies. After washed three times, membrane was incubated with horseradish peroxidase (HRP)-conjugated secondary antibodies (1: 4000 dilution) for 1 h at room temperature and the blot was visualized by using SuperSignal^TMWest Pico Plus Chemiluminescent Substrate (ThermoFisher Scientific; TL275133). The primary detection antibodies were as follows: anti-E-cadherin (CST, 24E10, 1 : 1000); anti-N-cadherin (CST, D4R1H, 1 : 1000); anti-vimentin (Abcam, ab8978, 1 : 1000); anti-GAPDH (Santa Cruz, USA; sc-25778, 1 : 1000); anti-ERK (Abcam, ab17942, 1 : 1000); anti-Snail (CST, L70G2, 1 : 1000) ;anti-MMP1 (NeoMarbers, 1536P8C7C, 1 : 1000) andanti-MMP9 (Proteintech, 10375-2-AP, 1 : 1000) . The protein expression was detected with an enhanced chemiluminescent reagent (Thermo, MA, USA).

Proliferation assay

Cells (1.5× 10³) were seeded into 96-well plates and incubated the plates at 37 °C in a humidified 5% CO₂ atmosphere. Cellular proliferation was measured with Cell Counting Kit-8 (DOJINDO；SJ608). Briefly, 10 μL/well CCK8 solution was added at the indicated times and then the cells were incubated at 37 °C for 3 h. The absorbance at 450 nm value was recorded by the microplate reader.

Cell Migration Assays

Cell migration was examined by wound-healing assays. After treatment of cells, scratches were made using sterile 10 μL-pipette tips, and bright-field microphotographs were taken at different times. The percentages of cell migration were quantitated, by the ImageJ software, measuring the width of the cell-free zone immediately after making the scratch.

Cell apoptosis analysis

To assess cell apoptosis, after treated with trypsin, the cells were collected and washed with PBS twice. 4μL of PI(Propidium Iodide) 4μL of FITC(Fluorescein Isothiocyanate) (DOJINDO；AD10) were added after the cells were pelleted and resuspended in 400μL of 1× binding buffer. Apoptosis was detected by flow cytometry after 15 minutes of incubation in the dark at room temperature.

Quantification and statistical analysis

Data are presented as the mean ± SEMs or SDs. Statistical analyses were performed in GraphPad Prism 6 (GraphPad Software, Inc.) using unpaired two-tailed Student’s t-test to compare differences between two groups with significance of P < 0.05. One-way analysis of variance with multiple comparisons tests was used to compare three or more groups with significance of P < 0.05.

Acknowledgement

Funding: This study was supported by grants from the National Natural Science Foundation of China (No. 31870847).

Author contributions: X.Y.S. performed most of the experiments. H.Z.L., D.F.X., S.S.G. and X.H. have taken part in or assisted with the experiments and provided technical help. P.-K.Z., C.J.B. and H.G. contributed study concept, critical design and analyzed the experimental data. C.J.B. and P.-K.Z. conceived the project and analyzed the data. X.Y.S. and C.J.B drafted the initial manuscript, P.-K.Z. critically reviewed and revised the final manuscript.

Competing interests: The authors declare that they have no competing interests.

Data and materials availability: All data needed to evaluate the conclusions in the paper are present in the paper and/or the Supplementary Materials. Additional data related to this paper may be requested from the authors.

Mondini M, Levy A, Meziani L, Milliat F, Deutsch E. Radiotherapy-immunotherapy combinations - perspectives and challenges. Mol Oncol. 2020; 14(7):1529-1537.
Arina A, Gutiontov SI, Weichselbaum RR. Radiotherapy and Immunotherapy for Cancer: From "Systemic" to "Multisite". Clin Cancer Res. 2020; 26(12):2777-2782.
Huang RX, Zhou PK. DNA damage response signaling pathways and targets for radiotherapy sensitization in cancer. Signal Transduct Target Ther. 2020; 5(1):60.
Huang R, Zhou PK. DNA damage repair: historical perspectives, mechanistic pathways and clinical translation for targeted cancer therapy. Signal Transduct Target Ther. 2021; 6(1):254.
Theys J, Jutten B, Habets R, Paesmans K, Groot AJ, Lambin P, Wouters BG, Lammering G, Vooijs M. E-Cadherin loss associated with EMT promotes radioresistance in human tumor cells. Radiother Oncol. 2011; 99(3):392-397.
Nantajit D, Lin D, Li JJ. The network of epithelial-mesenchymal transition: potential new targets for tumor resistance. J Cancer Res Clin Oncol. 2015; 141(10):1697-713.
Huang R, Liu X, Li H, Ning H, Zhou PK. PRKCSH Alternative Splicing Involves in Silica-Induced Expression of Epithelial-Mesenchymal Transition Markers and Cell Proliferation. Dose Response. 2020; 18(2):1559325820923825.
Liu Z, Liang X, Li X, Liu X, Zhu M, Gu Y, Zhou P. MiRNA-21 functions in ionizing radiation-induced epithelium-to-mesenchymal transition (EMT) by downregulating PTEN. Toxicol Res (Camb). 2019; 8(3):328-340.
Yin H, Wang X, Zhang X, Zeng Y, Xu Q, Wang W, Zhou F, Zhou Y. UBE2T promotes radiation resistance in non-small cell lung cancer via inducing epithelial-mesenchymal transition and the ubiquitination-mediated FOXO1 degradation. Cancer Lett. 2020; 494:121-131.
Wang D, Liu Z, Yan Z, Liang X, Liu X, Liu Y, Wang P, Bai C, Gu Y, Zhou PK. MiRNA-155-5p inhibits epithelium-to-mesenchymal transition (EMT) by targeting GSK-3beta during radiation-induced pulmonary fibrosis. Arch Biochem Biophys. 2021; 697:108699.
Karnevi E, Rosendahl AH, Hilmersson KS, Saleem MA, Andersson R. Impact by pancreatic stellate cells on epithelial-mesenchymal transition and pancreatic cancer cell invasion: Adding a third dimension in vitro. Exp Cell Res. 2016; 346(2):206-15.
Saitoh M. Involvement of partial EMT in cancer progression. J Biochem. 2018; 164(4):257-264.
Dudas J, Ladanyi A, Ingruber J, Steinbichler TB, Riechelmann H. Epithelial to Mesenchymal Transition: A Mechanism that Fuels Cancer Radio/Chemoresistance. Cells-Basel. 2020; 9(2).
Bakir B, Chiarella AM, Pitarresi JR, Rustgi AK. EMT, MET, Plasticity, and Tumor Metastasis. Trends Cell Biol. 2020; 30(10):764-776.
Lambert AW, Weinberg RA. Linking EMT programmes to normal and neoplastic epithelial stem cells. Nat Rev Cancer. 2021; 21(5):325-338.
Terry S, Savagner P, Ortiz-Cuaran S, Mahjoubi L, Saintigny P, Thiery JP, Chouaib S. New insights into the role of EMT in tumor immune escape. Mol Oncol. 2017; 11(7):824-846.
Yu M, Bardia A, Wittner BS, Stott SL, Smas ME, Ting DT, Isakoff SJ, Ciciliano JC, Wells MN, Shah AM, et al. Circulating breast tumor cells exhibit dynamic changes in epithelial and mesenchymal composition. Science. 2013; 339(6119):580-4.
Qi LN, Xiang BD, Wu FX, Ye JZ, Zhong JH, Wang YY, Chen YY, Chen ZS, Ma L, Chen J, et al. Circulating Tumor Cells Undergoing EMT Provide a Metric for Diagnosis and Prognosis of Patients with Hepatocellular Carcinoma. Cancer Res. 2018; 78(16):4731-4744.
Lee SY, Jeong EK, Ju MK, Jeon HM, Kim MY, Kim CH, Park HG, Han SI, Kang HS. Induction of metastasis, cancer stem cell phenotype, and oncogenic metabolism in cancer cells by ionizing radiation. Mol Cancer. 2017; 16(1):10.
Jung JW, Hwang SY, Hwang JS, Oh ES, Park S, Han IO. Ionising radiation induces changes associated with epithelial-mesenchymal transdifferentiation and increased cell motility of A549 lung epithelial cells. Eur J Cancer. 2007; 43(7):1214-24.
Luo M, Wu C, Guo E, Peng S, Zhang L, Sun W, Liu D, Hu G, Hu G. FOXO3a knockdown promotes radioresistance in nasopharyngeal carcinoma by inducing epithelial-mesenchymal transition and the Wnt/beta-catenin signaling pathway. Cancer Lett. 2019; 455:26-35.
Su H, Jin X, Zhang X, Zhao L, Lin B, Li L, Fei Z, Shen L, Fang Y, Pan H, Xie C. FH535 increases the radiosensitivity and reverses epithelial-to-mesenchymal transition of radioresistant esophageal cancer cell line KYSE-150R. J Transl Med. 2015; 13:104.
Qiao L, Chen Y, Liang N, Xie J, Deng G, Chen F, Wang X, Liu F, Li Y, Zhang J. Targeting Epithelial-to-Mesenchymal Transition in Radioresistance: Crosslinked Mechanisms and Strategies. Front Oncol. 2022; 12:775238.
Kang J, Kim E, Kim W, Seong KM, Youn H, Kim JW, Kim J, Youn B. Rhamnetin and cirsiliol induce radiosensitization and inhibition of epithelial-mesenchymal transition (EMT) by miR-34a-mediated suppression of Notch-1 expression in non-small cell lung cancer cell lines. J Biol Chem. 2013; 288(38):27343-27357.
Chen Z, Gao H, Dong Z, Shen Y, Wang Z, Wei W, Yi J, Wang R, Wu N, Jin S. NRP1 regulates radiation-induced EMT via TGF-beta/Smad signaling in lung adenocarcinoma cells. Int J Radiat Biol. 2020; 96(10):1281-1295.
Chowdhury P, Dey P, De D, Ghosh U. Gamma ray-induced in vitro cell migration via EGFR/ERK/Akt/p38 activation is prevented by olaparib pretreatment. Int J Radiat Biol. 2020; 96(5):651-660.
Park HR, Jo SK, Jung U. Ionizing Radiation Promotes Epithelial-to-Mesenchymal Transition in Lung Epithelial Cells by TGF-beta-producing M2 Macrophages. In Vivo. 2019; 33(6):1773-1784.
Shao L, Zhang Y, Shi W, Ma L, Xu T, Chang P, Dong L. Mesenchymal stromal cells can repair radiation-induced pulmonary fibrosis via a DKK-1-mediated Wnt/beta-catenin pathway. Cell Tissue Res. 2021; 384(1):87-97.
Nagarajan D, Melo T, Deng Z, Almeida C, Zhao W. ERK/GSK3beta/Snail signaling mediates radiation-induced alveolar epithelial-to-mesenchymal transition. Free Radic Biol Med. 2012; 52(6):983-92.
Lee CW, Rivera R, Gardell S, Dubin AE, Chun J. GPR92 as a new G12/13- and Gq-coupled lysophosphatidic acid receptor that increases cAMP, LPA5. J Biol Chem. 2006; 281(33):23589-97.
Choi JW, Herr DR, Noguchi K, Yung YC, Lee CW, Mutoh T, Lin ME, Teo ST, Park KE, Mosley AN, Chun J. LPA receptors: subtypes and biological actions. Annu Rev Pharmacol Toxicol. 2010; 50:157-86.
Yung YC, Stoddard NC, Chun J. LPA receptor signaling: pharmacology, physiology, and pathophysiology. J Lipid Res. 2014; 55(7):1192-214.
An S, Bleu T, Hallmark OG, Goetzl EJ. Characterization of a novel subtype of human G protein-coupled receptor for lysophosphatidic acid. J Biol Chem. 1998; 273(14):7906-10.
Liu L, He C, Zhou Q, Wang G, Lv Z, Liu J. Identification of key genes and pathways of thyroid cancer by integrated bioinformatics analysis. J Cell Physiol. 2019; 234(12):23647-23657.
Zhao WJ, Zhu LL, Yang WQ, Xu SJ, Chen J, Ding XF, Liang Y, Chen G. LPAR5 promotes thyroid carcinoma cell proliferation and migration by activating class IA PI3K catalytic subunit p110beta. Cancer Sci. 2021; 112(4):1624-1632.
Wu CY, Zheng C, Xia EJ, Quan RD, Hu J, Zhang XH, Hao RT. Lysophosphatidic Acid Receptor 5 (LPAR5) Plays a Significance Role in Papillary Thyroid Cancer via Phosphatidylinositol 3-Kinase/Akt/Mammalian Target of Rapamycin (mTOR) Pathway. Med Sci Monit. 2020; 26:e919820.
Lee SC, Fujiwara Y, Liu J, Yue J, Shimizu Y, Norman DD, Wang Y, Tsukahara R, Szabo E, Patil R, et al. Autotaxin and LPA1 and LPA5 receptors exert disparate functions in tumor cells versus the host tissue microenvironment in melanoma invasion and metastasis. Mol Cancer Res. 2015; 13(1):174-85.
Okabe K, Hayashi M, Yamawaki Y, Teranishi M, Honoki K, Mori T, Fukushima N, Tsujiuchi T. Possible involvement of lysophosphatidic acid receptor-5 gene in the acquisition of growth advantage of rat tumor cells. Mol Carcinog. 2011; 50(8):635-42.
Dong Y, Hirane M, Araki M, Fukushima N, Honoki K, Tsujiuchi T. Lysophosphatidic acid receptor-5 negatively regulates cell motile and invasive activities of human sarcoma cell lines. Mol Cell Biochem. 2014; 393(1-2):17-22.
Fukusumi T, Ishii H, Konno M, Yasui T, Nakahara S, Takenaka Y, Yamamoto Y, Nishikawa S, Kano Y, Ogawa H, et al. CD10 as a novel marker of therapeutic resistance and cancer stem cells in head and neck squamous cell carcinoma. Br J Cancer. 2014; 111(3):506-14.
Huang Z, Zhang Z, Zhou C, Liu L, Huang C. Epithelial-mesenchymal transition: The history, regulatory mechanism, and cancer therapeutic opportunities. MedComm (2020). 2022; 3(2):e144.
Liu YP, Zheng CC, Huang YN, He ML, Xu WW, Li B. Molecular mechanisms of chemo- and radiotherapy resistance and the potential implications for cancer treatment. MedComm (2020). 2021; 2(3):315-340.
Jongsma M, Matas-Rico E, Rzadkowski A, Jalink K, Moolenaar WH. LPA is a chemorepellent for B16 melanoma cells: action through the cAMP-elevating LPA5 receptor. Plos One. 2011; 6(12):e29260.
Kumari N, Reabroi S, North BJ. Unraveling the Molecular Nexus between GPCRs, ERS, and EMT. Mediators Inflamm. 2021; 2021:6655417.
Lappano R, Maggiolini M. G protein-coupled receptors: novel targets for drug discovery in cancer. Nat Rev Drug Discov. 2011; 10(1):47-60.
Almendro V, Garcia-Recio S, Gascon P. Tyrosine kinase receptor transactivation associated to G protein-coupled receptors. Curr Drug Targets. 2010; 11(9):1169-80.
Wang Y, Waldron RT, Dhaka A, Patel A, Riley MM, Rozengurt E, Colicelli J. The RAS effector RIN1 directly competes with RAF and is regulated by 14-3-3 proteins. Mol Cell Biol. 2002; 22(3):916-26.
Plastira I, Bernhart E, Goeritzer M, Devaney T, Reicher H, Hammer A, Lohberger B, Wintersperger A, Zucol B, Graier WF, et al. Lysophosphatidic acid via LPA-receptor 5/protein kinase D-dependent pathways induces a motile and pro-inflammatory microglial phenotype. J Neuroinflammation. 2017; 14(1):253.
Guo YJ, Pan WW, Liu SB, Shen ZF, Xu Y, Hu LL. ERK/MAPK signalling pathway and tumorigenesis. Exp Ther Med. 2020; 19(3):1997-2007.
Xie Y, Ma J, Yang M, Fan L, Chen W. Extracellular signal-regulated kinase signaling pathway and silicosis. Toxicol Res (Camb). 2021; 10(3):487-494.
Abouzed TK, Althobaiti F, Omran AF, Eldomany EB, El-Shazly SA, Alharthi F, Elkattawy AM, Kahilo K, Dorghamm DA. The chemoprevention of spirulina platensis and garlic against diethylnitrosamine induced liver cancer in rats via amelioration of inflammatory cytokines expression and oxidative stress. Toxicol Res (Camb). 2022; 11(1):22-31.
Yu C, Hu K, Nguyen D, Wang ZA. From genomics to functions: preclinical mouse models for understanding oncogenic pathways in prostate cancer. Am J Cancer Res. 2019; 9(10):2079-2102.
Chen PS, Shih YW, Huang HC, Cheng HW. Diosgenin, a steroidal saponin, inhibits migration and invasion of human prostate cancer PC-3 cells by reducing matrix metalloproteinases expression. Plos One. 2011; 6(5):e20164.
Randle DD, Clarke S, Henderson V, Odero-Marah VA. Snail mediates invasion through uPA/uPAR and the MAPK signaling pathway in prostate cancer cells. Oncol Lett. 2013; 6(6):1767-1773.
Kwegyir-Afful AK, Bruno RD, Purushottamachar P, Murigi FN, Njar VC. Galeterone and VNPT55 disrupt Mnk-eIF4E to inhibit prostate cancer cell migration and invasion. Febs J. 2016; 283(21):3898-3918.
Martinez-Martinez D, Toledo LM, Baquero P, Ropero S, Angulo JC, Chiloeches A, Lasa M. Downregulation of Snail by DUSP1 Impairs Cell Migration and Invasion through the Inactivation of JNK and ERK and Is Useful as a Predictive Factor in the Prognosis of Prostate Cancer. Cancers (Basel). 2021; 13(5).
Churg A, Wang R, Wang X, Onnervik PO, Thim K, Wright JL. Effect of an MMP-9/MMP-12 inhibitor on smoke-induced emphysema and airway remodelling in guinea pigs. Thorax. 2007; 62(8):706-13.
Roscilli G, Cappelletti M, De Vitis C, Ciliberto G, Di Napoli A, Ruco L, Mancini R, Aurisicchio L. Circulating MMP11 and specific antibody immune response in breast and prostate cancer patients. J Transl Med. 2014; 12:54.
Wang JF, Gong YQ, He YH, Ying WW, Li XS, Zhou XF, Zhou LQ. High expression of MMP14 is associated with progression and poor short-term prognosis in muscle-invasive bladder cancer. Eur Rev Med Pharmacol Sci. 2020; 24(12):6605-6615.
Xu DM, Han PH, Chen L, Li TT, Yang XH, Guo R. Knockdown of MMP16 inhibits cell proliferation and invasion in chordoma in vitro. J Biol Regul Homeost Agents. 2020; 34(6):2263-2270.

SunXYLPAR5.pdf

Download PDF

Version 1

posted

You are reading this latest preprint version

LPAR5 confers cancer cells radioresistance associated with EMT activation via ERK/ Snail pathway

Status:

Version 1

Abstract

Figures

Introduction

Results

Transcriptome-wide RNA-seq assay to identify early responsive targets determining sensitivity of cancer cells to radiotherapy

Bidirectional alterations of LPAR5 expression induced by radiation

Knockdown of LPAR5 inhibits cancer cells growth and metastasis and promotes apoptosis

Overexpression of LPAR5 attenuates apoptosis and proliferation inhibition induced by radiation

LPAR5 plays critical role in radiation-induced EMT

LPAR5 promoted radiation-induced EMT through ERK/ Snail axis

Discussion

MATERIALS AND METHODS

Declarations

References

Supplementary Files

Status:

Version 1