2.1 Ethical statement and organization of specimens
This study is approved by the Ethics Review Committee of First Affiliated Hospital of Zhengzhou University. All patients enrolled in this study were diagnosed with NHL for the first time, and tumor tissue and normal tissues were collected by biopsy, and the procedures during the tissues collection is in accordance with the Declaration of Helsinki. All patients signed a written informed consent form prior to participating in the study. Immediately after collection, the tissues were quickly frozen at -80 °C for further experiments and analysis.
2.2 Cell culture
Human NHL cell lines (Raji, NK-92MI, RL, Mino cells) and germinal center-B (GC-B) cells were procured from China Center for Type Culture Collection (CCTCC, Wuhan, China). All cells were cultured in Dulbeccos modified Eagles medium/Hams Nutrient mixture F12 (DMEM/F12, Gibco, Grand Island, NY, USA), which contained 10% fetal bovine serum (FBS, HyClone, Logan, UT, USA), 100 U/mL penicillin and 0.1 mg/mL streptomycin (Sigma, St. Louis, MO, USA). The cells were cultured in an incubator at 37 °C, in 5% CO2 with saturated humidity.
2.3 Cell transfection
Raji and Mino cells in the logarithmic growth phase were selected and seeded in 6-well plates with a cell density of 5 × 105/well. After cultured for 23 h, transfection was performed according to the instructions of Lipofectamine® 2000 transfection reagent (Invitrogen, Carlsbad, CA, USA). miR-103 mimics (miR-103: 5′-AGCAGCAUUGUACAGGGCUAUGA-3′), miR-103 inhibitors (miR-103 in: 5′-UCAUAGCCCUGUACAAUGCUGCU-3′), over-expressed OTUD7B plasmid, shRNAs targeting OTUD7B (shOTUD7B#1: GCTGCGGAAAGCTTTGTATGC; shOTUD7B#2: TTCTCCGAACGTGTCACGT) and their negative controls were transfected into NHL cells, respectively. The cells were collected after 48 h after transfection, and RNA or protein expression was detected by RT-PCR and Western blot to confirm successful transfection.
2.4 Quantitative reverse transcription-polymerase chain reaction (qRT-PCR)
Total tissue or cell RNA was extracted using TRIzol reagent (Invitrogen, Waltham, MA, USA). Nanodrop-spectrophotometer was used to detect RNA concentration and purity. According to the manufacturer's protocol, the PrimeScript-RT Kit (Madison, WI, USA) was used to synthesize complementary DNA (cDNA) from 1 µg of total RNA, and then SYBR Green Premix Ex Taq II (TaKaRa, Dalian, China) and ABI 7500 system ( Applied Biosystems, Foster City, CA, USA) was applied for qRT-PCR. The total volume of the PCR system was 30 µL and each sample contained 300 ng of cDNA. GAPDH was the internal reference for OTUD7B, and U6 was the internal reference for miR-103. The primer sequence information was shown in Table 1.
Table 1
Sequences used for qRT-PCR.
Primers Sequences |
miR-103 | F: CCCGCCAAGCCCTTACC R: GCCGTCGGTGATGCTTTTTTGG |
U6 | F: CTCGCTTCGGCAGCACA |
| R: AACGCTTCACGAATTTGCGT |
OTUD7B | F: TGGCTACCCTGGGGACTTTACTA |
| R: ACTGTCTGGGGAAGGTGGCATA |
GAPDH | F: TGTTGCCATCAATGACCCCTT |
| R: TGTTGCCATCAATGACCCCTT |
Abbreviation: qRT-PCR, reverse transcription-quantitative PCR; miR-103, microRNA-103; OTUD7B, OTU deubiquitinase 7B; U6: snRNA, small nuclear RNA; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; F, forward; R, reverse. |
2.5 Immunohistochemistry (IHC)
NHL tissues and normal tissues were fixed in 10% formaldehyde and embedded in paraffin. The sections were dewaxed and hydrated. Before immunohistochemical staining, the dewaxed sections were baked at 37 °C for 2 h, the endogenous peroxides were blocked by 1% H2O2 for 5 min and the sections were washed for 3 times, and the sections were blocked using immunostaining blocking solution for 1 h, then incubated with anti-OTUD7B antibody (1: 200 dilution, Abcam, Cambridge, UK, ab118387) overnight at 4 °C. Then the sections were washed with PBS and then incubated with biotin-linked antiserum for 1 h at room temperature. Next, the sections were washed again and stained with 3,3-diaminobenzidine (DAB) for 1 min. Then the sections were washed with double distilled water, stained with hematoxylin for 1 min, and observed under a microscope. Ultimately, the staining was scored by pathologists.
2.6 Cell proliferation assay
The cells of each group in the exponential growth phase were collected and prepared into single cell suspension (1 × 104/ml), then inoculated on 96-well plates with 100 µL cell suspension per well, with 3 replicate wells in each group. Subsequently, 10 µL of CCK-8 solution (Beyotime Biotechnology, Shanghai, China) were added to the wells, and a blank control well only containing the medium and CCK-8 solution was set. After 2 h of incubation, a microplate reader at a wavelength of 450 nm was employed to determine and record the absorbance (A) values of each well. Ultimately, the plate was measured at intervals of 24 h for 5 days.
2.7 Apoptosis Experiment
Annexin V-fluoroisothiocyanate (FITC)/PI double staining kit (Sungene Biotech, TianJin, China) was used to detect the apoptosis of NHL cells. 24 h after cell transfection, the cells were collected, and the cell density was adjusted to 2 × 106 cells/well, and the culture was continued for 24 h. After that the cells were centrifuged and the supernatant was discarded, and the cells were washed with pre-cooled PBS twice, and the cells were resuspended with 1 × Binding buffer. Following that, 5 µL AnnexinV-FITC and 5 µL PI solution were added to the cell suspension, mixed thoroughly and incubated at room temperature for 15 min. Finally, flow cytometry analyses (Cytomics FC 500; Beckman Coulter) was employed to detect the apoptosis rate according to the instructions of the kit.
2.8 Transwell experiment
Transwell experiment was carried out using Transwell chamber (Millipore, Billerica, USA). After that, the Matrigel was added to the Transwell chamber membrane and the chambers were placed in a 24-well plate for cell invasion experiments (in cell migration experiments, Matrigel was not used). NHL cells were harvested and adjusted to a cell density of 1 × 105/mL with serum-free medium, and 200 µL cell suspension was added into the Transwell chamber. Meanwhile, 800 µL medium containing 10% FBS was added to the wells in the incubator, and the cells were cultured at 37 °C for 24 h. Thereafter, the chamber was removed, and the cells migrated or invaded in the wells of the 24-well plate were counted.
2.9 Western blot
Cells were lysed with a RIPA lysis (Pierce, Rockford, IL, USA), and then centrifuged to collect the supernatant. The protein samples were separated by SDS-PAGE and then electrophoretically transferred to a nitrocellulose (NC) membrane. The proteins were then blocked with 5% skim milk at room temperature for 2 h, and then the primary antibody was added to incubate the NC membrane at 4 °C overnight. After that the membrane was washed with TBST for 3 times, and the secondary antibody was added to incubate the NC membrane at room temperature for 2 h. Next, the membrane was washed with TBST for 3 times, and ECL chemiluminescence reagent (Millipore, Bedford, MA, USA) was used to develop the bands. The antibodies used in this study was purchased from Abcam (Cambridge, UK): anti-OTUD7B antibody (1: 500, ab118387), anti-p65 antibody (1: 1000, ab16502), and anti-Bcl-2 antibody (1: 1000, ab185002), anti-XIAP antibody (1: 500, ab28151), anti-CIAP2 (1: 1000, ab32059), anti-Livin antibody (1: 500, ab97350), anti-survivin (1: 1000, ab97350).
2.10 Dual luciferase reporter assay
Bioinformatics was utilized to predict the potential binding sites between 3′-UTR of OTUD7B and miR-103. The OTUD7B 3′-UTR wild sequence or OTUD7B 3′-UTR mutant sequence was inserted into the pmiRGLO dual-luciferase miRNA target expression reporter (Promega, Madison, WI, USA). 293T cells were seeded on 24-well plates (5 × 105 cells / well) and 24 h later, the cells were co-transfected with luciferase reporters and miR-103 mimic or negative control mimic using with Lipofectamine® 2000 (Invitrogen, Carlsbad, CA, USA). The luciferase activity was detected 48 h after transfection with Dual-Luciferase Reporter Assay System (Promega, Madison, WI, USA) in accordance with the manufacturer's instructions.
NF-κB luciferase reporter plasmid (Beyotime Institute of Biotechnology, Nantong, Jiangsu, China) with OTUD7B plasmid or OTUD7B shRNA were co-transfected into NHL cells using Lipofectamine® 2000 (Invitrogen, Carlsbad, CA, USA) according to manufacturer's instructions. After 24 h, luciferase activity was measured using the luciferase kit (Beyotime, Hangzhou, China).
2.11 Data analysis
All experiments were repeated 3 times, and the data obtained were expressed as x ± s. SPSS17.0 software (SPSS Inc., Chicago, IL, USA) was used for statistical analysis. Independent sample t test was employed to compare the two groups. P < 0.05 indicated that the difference was statistically significant.