Eight dogs were included in this study (Table 1). All dogs were privately owned adult Belgian Malinois aged between 6 and 10 years, resided in Hong Kong Island, with 4 males and 4 females, housed on the same property as guard dogs. Four dogs were born in Hong Kong (dogs 2,3,5,6), two in the Netherlands (dogs 4, 8), one in the United States of America (dog 1) and one in Sweden (dog 7). Two dogs (dog 2 and 3) were littermates, both born in Hong Kong and dog 5 was the progeny of dog 1.
Table 1
Signalment, origin, main test results and Leishmania treatment outcome of eight dogs living in the same kennel investigated for leishmaniosis.
Dog
|
Dog country of origin
|
Relationship with other dogs in kennel
|
Year of birth
|
Detection and anatomic location of Leishmania amastigotes by microscopy
|
ELISA
Serology
|
PCR result and tissue
|
Leishmania treatment/outcome
|
1
|
USA
|
Sire of dog 5
|
2011
|
Yes: Dermis
|
-
|
- (blood)*
|
Disease relapsed but now resolved
|
2
|
Hong Kong
|
Full brother of dog 3
|
2012
|
Yes: Spleen and liver
|
+**
|
+ (blood, spleen)
|
Disease relapsed but now resolved
|
3
|
Hong Kong
|
Full sister of dog 2
|
2019
|
No
|
-
|
- (blood and skin)
|
NA
|
4
|
Netherlands
|
None
|
2009
|
No
|
-
|
- (blood and skin)
|
NA
|
5
|
Hong Kong
|
Son of dog 1
|
2013
|
ND
|
-
|
- (blood)
|
NA
|
6
|
Hong Kong
|
None
|
2011
|
ND
|
-
|
- (blood)
|
NA
|
7
|
Sweden
|
None
|
2011
|
ND
|
-
|
- (blood)
|
NA
|
8
|
Hong Kong
|
None
|
2012
|
ND
|
-
|
- (blood)
|
NA
|
- negative result; + positive result; ND: Not done; NA Not applicable. |
* Dog 1 had two rounds of PCR testing on EDTA blood. Quantitative species Leishmania PCR performed by IDEXX Reference Laboratory, United Kingdom. Approximately five years later, PCR performed by Koret School of Veterinary Medicine, the Hebrew University, Israel. |
** Dog 2 had two rounds of ELISA serology. One performed by Texas A and M veterinary medical diagnostic laboratory. Second test performed 2 months later by Koret School of Veterinary Medicine, the Hebrew University, Israel. |
Four dogs exhibited cutaneous lesions (dogs 1, 2, 3, 4). Three dogs had ulcerative dermatitis affecting one toe (dog 1), two toes and pressure points (dog 2) and the left lateral stifle region (dog 4). One dog had chronic alopecia and hyperpigmentation over the caudodorsal skin (dog 3). One of the dogs with skin disease (dog 2) also had respiratory signs with nasal stertor and ulceration and swelling of the nasal vestibule, splenomegaly, lethargy and dullness, and chronic regenerative anaemia indicating systemic illness. Skin biopsies for histopathological assessment were obtained from all four dogs with cutaneous skin disease, as part of the diagnostic process by their attending veterinarians, and a biopsy of nasal mucosa was collected from dog 2 to investigate the concurrent nasal disease. Formalin fixed skin samples were processed routinely into paraffin blocks and stained with haematoxylin and eosin (H and E) and examined microscopically. Skin biopsies from dogs 2 and 4 with ulcerative dermatitis were also stained by Grocott’s methenamine silver (GMS), Periodic acid Schiff (PAS), Ziehl Neelsen (ZN), Gram and Giemsa staining. Cytological assessment of fine needle aspirates were obtained from ulcerative dermatitis lesions of dogs 2 and 4, with additional aspirates collected from the spleen and liver of dog 2 with systemic illness signs. Aspirates were stained with Wright’s Giemsa (WG) and examined microscopically.
Blood samples were collected from the cephalic vein of all eight dogs for Leishmania serology. Serum collected was stored at -70C before being sent to the Koret School of Veterinary Medicine, Hebrew University, Israel. The systemically ill dog (dog 2) had additional serology performed at the Texas A and M, Veterinary Medical Diagnostic Laboratory, College Station, Texas, USA.
PCR for Leishmania detection was performed on EDTA blood from all eight dogs, punch biopsies of skin collected from three of the dogs with skin disease (dogs 2,3,4) placed into sterile saline, paraffin embedded skin from dog number 1 with cutaneous disease, and aspirated splenic tissue, scraped off a stained glass slide from the systemically ill dog (dog 2). Leishmania species quantitative PCR on EDTA blood from dog 1 was also performed by IDEXX Reference Laboratories, UK, as part of the initial diagnostic workup of this case.
DNA was extracted from the blood samples of all eight dogs using the Qiagen EZ1 Advanced XL automated system (QIAGEN GmbH, QIAGEN Strasse 1, 40724 Hilden, Germany). DNA was stored at -70C before being sent to the Hebrew University in Israel.
The presence of Leishmania DNA in samples was tested using two PCR protocols for amplification of different targets. A 265 bp fragment of the Leishmania internal transcribed spacer 1 (ITS1) region of the L. infantum rRNA operon was amplified by real-time PCR using primers ITS-219 F (AGCTGGATCATTTTCCGATG) and ITS-219R (ATCGCGACACGTTATGTGAG) and then evaluated by high resolution melt (HRM) analysis as previously described [3]. In addition, a 120 bp of the Leishmania kinetoplast DNA (kDNA) minicircle was amplified by real-time PCR using primers JW11 (CCTATTTTACACCAACCCCCAGT) and JW12 (GGGTAGGGGCGTTCTGCGAAA) and then evaluated by melt curve analysis as previously described [3, 4]. All positive PCR products were sequenced using the BigDye Terminator v3.1 Cycle Sequencing Kit and an ABI PRISM 3100 Genetic Analyzer (Applied Biosystems, Foster City, CA, USA), at the Center for Genomic Technologies, Hebrew University of Jerusalem, Israel. DNA sequences were evaluated with the ChromasPro software version 2. 1.1 (Technelysium Pty Ltd., Australia) and compared for similarity with sequences available in GenBank®, using BLAST program (http://www.ncbi.nlm.nih.gov/BLAST/).
Serology for anti-leishmanial antibodies was performed by the enzyme-linked immunosorbent assay (ELISA) using L. infantum antigen, as described previously [5].
Clinical Cases
Dog no. 1, born in the USA, presented with as a referral case, with a 1–2 month history of relapsing ulcerative skin disease affecting a single nailbed in the right foreleg, which partially responded to 30 day treatment with prednisolone (0.25 mg/kg SID, generic, China), cephalexin (16 mg/kg, BID, Stada Pharmaceuticals (Asia) Limited, Hong Kong) and itraconazole (5 mg/kg, SID, Europharm Lab Co LTD, Hong Kong) (Table 1). The lesion relapsed and punch biopsies of the nail lesion were collected 60 days from initial presentation, and cephalexin (16 mg/kg, BID) was continued for an additional 30 days. The biopsy revealed granulomatous dermatitis with abundant, intracytoplasmic organisms consistent with Leishmania amastigotes seen on histology (Fig. 1). Amastigotes were ovoid or round, 2.5–5.0 to 1.5–2.0 um in diameter, with a small nucleus and kinetoplast. Leishmania species quantitative PCR on EDTA blood was negative (IDEXX Reference Laboratories, UK) but PCR and DNA sequencing performed at the Hebrew University in Israel on DNA extracted from paraffin embedded tissue from the nail bed stored for six years was positive confirming leishmaniosis caused by L. infantum. Allopurinol (generic, China) treatment commenced at the unusually high dose of 30 mg/kg SID for 6 months, and thereafter the dosage was reduced in another unusual protocol to 30 mg/kg SID for 7 days each month, for 7 months, and the dog was placed on a low purine diet (Royal Canin). The dog’s skin lesion healed within three months, but against veterinary advice, treatment ceased and 12 months after it was discontinued the dog relapsed with bleeding associated with ulcerative dermatitis at the nail beds of both hind legs. Biopsy was declined by the owner and allopurinol (generic, China) treatment recommenced at 30 mg/kg SID for 6 months. A second ELISA serology and PCR on blood, conducted five years after the initial diagnosis, when the dog was clinically well and had no cutaneous lesions, were negative for leishmaniosis.
Table 1. Signalment, origin, main test results and Leishmania treatment outcome of eight dogs living in the same kennel investigated for leishmaniosis.
(TABLE IS ATTACHED AS AN ADDITIONAL FILE DUE TO LANDSCAPE FORMAT BEING REQUIRED)
Dog 2 was born in and had never travelled outside of Hong Kong (Table 1). Information about the sire was unavailable but the dam, born in America, had died at the time of the dog’s presentation and was suspected by the attending veterinarian to have a disease with similar manifestations to leishmaniosis but no laboratory testing, treatment or post mortem were performed. Dog 2 initially presented with ulcerative skin disease affecting a single nailbed in the left forelimb), which failed to respond to cephalexin (13 mg/kg BID for 5 days, Stada Pharmaceuticals (Asia) Limited, Hong Kong) but partially responded to 28 days with enrofloxacin (6mg/kg SID, Dechra Veterinary Products (Australia) Pty Ltd, Australia) and itraconazole (5 mg/kg, Europharm Lab Co LTD, Hong Kong). Six months later, ulcerative dermatitis appeared on two right fore digits and both metacarpal pads. Lesions responded well to the same treatment regimen with enroflaxacin and itraconazole for 21 days, but 4 to 6 months later, ulcerative dermatitis reappeared on the left hind and right forelimb digits, the right hock, accompanied by ulceration and swelling of the nasal vestibule with nasal stertor and lymphadenomegaly of the popliteal, prescapular and submandibular lymph nodes. Incisional biopsies revealed pyogranulomatous inflammation within the nasal mucosa (Fig. 2) and skin lesion, with low numbers of structures suspicious for amastigotes. GMS, PAS, ZN, and Gram and Giemsa staining did not provide additional information. The lesions resolved following treatment with prednisolone (1mg/kg BID for 44 days, tapered to 0.75 mg/kg BID for 2 weeks, Mavlab Pty Ltd, Australia), cephalexin (13 mg/kg, BID, 17 days, Stada Pharmaceuticals (Asia) Limited, Hong Kong), itraconazole (5 mg/kg SID for 35 days, Europharm Lab Co LTD, Hong Kong), but ulceration of the nares recurred four months later along with lethargy, dullness and splenomegaly. Blood count showed a mild regenerative, normocytic, hypochromic anaemia (PCV: 31% reference range 37–54%; reticulocytes 128.1 x 109/L reference range 11–92 x 109/L; MCHC 321 g/L reference range 330–360 g/L), with 18 nucleated RBC/100 white blood cells and a left shift of neutrophils (9 neutrophilic bands/100 WBC) with a mild increase in plasma proteins (81 g/L reference range 59–78 g/L). Serum biochemistry changes included mild hyperglobulinaemia (43 g/L reference range 19–36 g/L) and hypoalbuminaemia (30 g/L reference range 32–44 g/l). There was mildly increased ALP (104 U/L reference range 17–100 U/L), AST: (95.1 U/L reference range 15–57) and CK (769 U/L reference range 48–261 U/L). Spleen and liver cytology by fine needle aspirates showed granulomatous to pyogranulomatous splenitis and hepatitis with abundant Leishmania amastigotes within macrophages in both organs (Fig. 2). Urinalysis was unremarkable.
Indirect fluorescent antibody test (IFAT) performed at the Texas A and M veterinary medical diagnostic laboratory detected a titre > = 2048 for antibodies against L. infantum ELISA serology and PCR on blood taken two months later and performed at the Hebrew University, as well as splenic tissue scraped from a cytology slide, were positive for leishmaniosis. The ELISA result had an optical density (OD) of1.436 (cut off 0.4 OD) and PCR which detected the ITS-1 spacer using the ITS219 F/R primers, produced sequences from the blood and spleen which were 100% similar to one another and had 100% identity to L. infantum (MN503527.1)_(Table 1).
Dog 2 was treated with allopurinol (16 mg/kg BID for 30 days) reduced to 10 mg/kg, BID, which is ongoing, and subcutaneous meglumine antimoniate (Glucantime, Merial, France) at 80 mg/kg in the morning and 40 mg/kg in the evening for 4 weeks.
The remaining six ‘in contact’ dogs (dogs 3,4,5,6,7,8) were seronegative for Leishmania by ELISA and their PCR from blood and skin samples was negative. At the time of sampling, two dogs (dogs 3 and 4) had chronic skin disease and four dogs (dogs 5,6,7,8) were clinically healthy. Dog 3 was born in Hong Kong and was a full sister of the systemically unwell, Leishmania-positive dog (dog 2). This dog had a chronic history of alopecia with hyperpigmentation on the dorsum of the thorax and rump region, which clinically resembled flea allergy dermatitis. Skin punch biopsies collected from alopecic regions were PCR negative for Leishmania and lacked amastigotes on histology, and the histological diagnosis was chronic hyperplastic dermatitis. Dog 4 was born in the Netherlands, and presented with chronic, pyogranulomatous, ulcerative dermatitis on the left stifle, but histology and cytology failed to demonstrate amastigotes or any infectious agents on hematoxylin and eosin, GMS, PAS, ZN, Giemsa, Gram staining, and PCR from a skin biopsy was negative for Leishmania.