Expression and function of dinkkopf 4 in oral squamous cell carcinoma and in vitro

doi:10.21203/rs.3.rs-17619/v1

Download PDF

Research

Expression and function of dinkkopf 4 in oral squamous cell carcinoma and in vitro

https://doi.org/10.21203/rs.3.rs-17619/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background Oral squamous cell carcinoma accounts for about 90% of malignant tumors of the head and neck, and its 5-year survival is less than 50%. The number of new cases of oral cancer worldwide is expected to increase by 62% in 2035. Wnt/β-catenin signal pathway plays a role in the tumorigenesis and progression of cancer. dinkkopf 4 is involved in a variety of cancers as a molecule in Wnt/β-catenin signal. To our knowledge, the study of DKK4 in OSCC has not been reported.

Methods The well differentiated oral squamous cell carcinoma and normal oral mucosa samples were collected from Department of Pathology of Xiangya Stomatological Hospital of Central South University. Human oral epithelial cell HOEC and human oral squamous cell carcinoma cell TSCC1 were cultured for experiments. The plasmid vector was constructed to inhibit the expression of DKK4 to form TSCC1-shDKK4 cells and TSCC1-NC cells were transfected with blank plasmid. Cell proliferation was detected by CCK-8 test. Apoptosis was detected by Annexin V-FITC/PI assay. Cell migration was detected by Transwell assay. IBM SPSS Statistics 24.0 and GraphPad Prism 8 were performed for statistical analysis and graphing.

Results We found that the expression of DKK4 and β-catenin increased in OSCC and in vitro (P<0.05). dinkkopf 4 may promote the expression of β-catenin in OSCC. The proliferation and migration of TSCC1-shDKK4 cells decreased and the apoptosis of TSCC1-shDKK4 cells increased (P<0.01).

Conclusions dinkkopf 4 may promote the proliferation and migration of OSCC cells and inhibit the apoptosis of OSCC cells in vitro by regulating Wnt/β-catenin signal pathway.

Cell Communication and Signaling

Dickkopf 4

β-catenin

Wnt/β-catenin signal pathway

oral squamous cell carcinoma

oral cancer

The incidence of oral cancer ranked 11th and its mortality ranked 16th in the world ^[1]. The number of new cases of oral cancer worldwide is expected to increase by 62% in 2035 ^[2]. According to the cancer data of the United States, the incidence and mortality of oral cancer in men increased gradually from 2010 to 2014, ranking 9th among male with systemic tumors ^[3]. The incidence of oral cancer rose to the 8th place in 2019, accounting for about 4% of all kinds of tumors in male ^[4]. Oral squamous cell carcinoma (OSCC) was the most common cancer in the head and neck, accounting for 90% of malignant tumors in the oral and oropharynx ^[5]. As a growing problem in the world, oral cancer was mainly prevalent in developing countries ^[6]. European cancer analysis showed that the 5-year survival rate of oral cancer was less than 50% ^[7]. The prognosis of cancer is related to early diagnosis, so it’s very important to prevent and detect OSCC early ^[2].

Wnt signal consists of classical Wnt/ β-catenin pathway, non-classical Wnt/Ca²⁺ pathway, planar cellular polarity pathway and protein kinase C pathway. Wnt/β-catenin signal pathway was the most widely studied Wnt pathway at present ^[8]. In the absence of Wnt signal, adenomatous polyposis coli (APC), Axin, glycogen synthase kinase 3β (GSK3β) and casein kinase 1α (CK1α) form β-catenin destruction complex ^[9]. Cytoplasmic APC/Axin/GSK3β/CK1α destruction complex regulates Wnt/β-catenin signal pathway by acting on β-catenin. Axin acts as a scaffold for the complex. GSK3β and CK1α target phosphorylation of N-terminal serine/threonine residues (Ser/Thr residues) of β-catenin binding to APC and Axin ^[8–10]. The phosphorylated β-catenin is recognized and ubiquitinated by the β-transducin repeat containing protein (β-TrCP) in the ubiquitin ligase complex, resulting in targeted degradation by 26S proteasome, preventing the activation of β-catenin target genes in the nucleus ^{[9, 10]}.

The Wnt ligand binds to the cysteine-rich domain (CRD) of the Frizzled (FZD) receptor, which binds to the low density lipoprotein receptor related protein (LRP5/6), recruiting Disheveled (Dsh) to the cell membrane,and initiating Wnt signal ^{[9, 11]}. GSK3β and CK1α phosphorylate the cytoplasmic domain of LRP5/6, and recruit Axin to the phosphorylated tail of LRP. The interaction between FZD and cytoplasmic protein Dsh results in the phosphorylation of Dsh by CK1α and binding to GSK3β. These interactions cause the inactivation of APC/Axin/GSK3β/CK1α complex and stabilization of cytoplasmic β-catenin, inhibiting the ubiquitination of β-catenin in the destructive complex ^{[8, 11]}. The destruction complex is saturated with phosphorylated β-catenin, resulting in the accumulation and transport of newly synthesized β-catenin into the nucleus ^[10]. β-catenin is translocated to the nucleus and interacts with T-cell factor/lymphocyte enhancer factor (TCF/LEF) to form β-catenin-TCF/LEF complex, activating the transcription of Wnt target genes ^[9]. β-catenin binds to DNA-binding TCF transcription factors in the nucleus. When Wnt is "off", TCFs interacts with Groucho transcriptional suppressors to prevent gene transcription. When Wnt is "on", binding to β-catenin transformed TCF into a transcriptional activator of target gene ^[10].

β-catenin, called Armadillo (ARM) in Drosophila, consists of 781 amino acid residues and a central region (residue 141–664). This region consists of 12 imperfect ARM repeats (R1-12), flanked by N-terminal domain (NTD) and C-terminal domain (CTD). NTD and CTD may be structurally flexible, while the central region forms a relatively rigid scaffold. The scaffold acts as a platform for the interaction of β-catenin binding protein in the cell membrane, cytoplasm and nucleus. The competition for β-catenin among different intracellular β-catenin binding protein is important for the regulation of classical Wnt signals. The conformational change of β-catenin helps to regulate its binding properties. NTD and CTD fold in the central region, affecting the binding to TCF/LEF ^[12]. The accumulation of cytoplasmic β-catenin increased the invasion and migration of OSCC cells ^{[13, 14]}. The expression of β-catenin is up-regulated in the cytoplasm/nucleus of oral potentially malignant disorders and OSCC, and gradually increased in the development of normal oral mucosa to OSCC, might being a sign of malignant transformation of OSCC ^{[15, 16]}. β-catenin is also related to tumor size, stage and invasive growth of OSCC ^{[17, 18]}.

Dickkopf (DKK) family consists of four secretory proteins DKK1, DKK2, DKK3 and DKK4, containing 255–350 amino acids and 2 conserved sequences of CRD. The CRD sequence of DKK4 is located in the regions of C24-73 and C128-201 ^[19]. The DKK family induces endocytosis of the Wnt/LRP5/6 complex by interacting with LRP5/6 receptors, inhibiting the activity of Wnt/β-catenin signal pathway ^{[8, 9]}. It was found that the expression of DKK3 in OSCC was higher than that in NOM, and DKK3 might promote the proliferation, invasion and metastasis of squamous cell carcinoma. However, the study of DKK4, another member of DKK family, in OSCC has not been reported ^{[20, 21]}.The expression of DKK4 is up-regulated in colorectal cancer, gastric cancer, pancreatic cancer, renal cell carcinoma, ovarian cancer, esophageal cancer and endometrial carcinoma^[19]. DKK4 enhances the migration, invasion and angiogenic potential of colon cancer cells ^[22]. There is a positive correlation between the expression of DKK4 and nuclear β-catenin in colorectal cancer. The increased expression of DKK4 may be a side effect of the activation of Wnt/β-catenin signal pathway ^[23]. DKK4 may be the target gene of Wnt/β-catenin pathway. Its overexpression in colorectal cancer may reflect the activation of Wnt/β-catenin signal as a downstream target of TCF/β-catenin, and affect the tumorigenesis and progression of colorectal cancer in other signal pathways ^{[22, 23]}.

Wnt/β-catenin signal pathway is involved in the tumorigenesis and progression of a variety of cancer, and it is abberant activated in OSCC without a clear mechanism ^{[8, 9]}. β-catenin plays a role in promoting tumorigenesis of OSCC ^[13–16]. The expression and mechanism of DKK4 varies in different cancers, and there was no relevant research reported in OSCC. This study aimed to investigate the expression and function of DKK4 in OSCC and in vitro.

Immunohistochemical staining

50 cases of well differentiated OSCC diagnosed by biopsy in the Department of oral pathology, Xiangya Stomatological Hospital of Central South University were collected as the experimental group, and 20 cases of normal oral mucosa (NOM) removed during the extraction of impacted teeth were collected as the control group. The prepared sections were stained with immunohistochemical detection kit (PV-9001, zsbio, China). The anti-DKK4 antibody (ab38589, Abcam, USA) and β-catenin antibody (AF6266, Affinity, USA) were diluted to 1:100. PBS phosphate buffer (IH0140, Leagene, USA) replaced the antibody as negative control group. The ImageJ 1.51K software (Wayne Rasband, National Institutes of Health, USA) and IHC Profile were conducted to detect the results of immunohistochemical staining ^[24].

Cell culture

Human normal oral epithelial cell (HOEC, Wuhan University, China) and human oral squamous cell carcinoma cell (TSCC1, Fudan University, China) were cultured in DMEM (SH30243.01, Hyclone, USA) containing 10% fetal bovine serum (16000-044, GIBCO, USA) in a incubator at 37 ℃ and 5% CO₂。

Real-time PCR

RNA was extracted according to the Real-time PCR kit (AQ131-01, TransGen, China). The mRNA sequences of DKK4, β-catenin and GAPDH were found from NCBI and primers were designed by clonemanager software (Table 1). The reverse transcription and Real-time PCR amplification were performed by the reverse transcription kit (# K1622, Fermentas, USA). The data were analyzed by ABI Prism 7300 SDS Software.

Table 1

Primers and sequences of GAPDH, β-catenin and DKK4
Primers	Sequences
h GAPDH-F	AATCCCATCACCATCTTC
h GAPDH-R	AGGCTGTTGTCATACTTC
h CTNNB1_F	TGGCAGCAACAGTCTTAC
h CTNNB1_R	GCCCTCATCTAATGTCTCAG
h DKK4-F	GCGATGAGAAGCCGTTCTGTG
h DKK4-R	CTTGTCCCTTCCTGCCTTGTG

Plasmid transfection

The pLkO.1-AcGFP-C1 (Addgen, USA) was used to construct DKK4 interfere plasmid vector. The specific RNAi sequence of DKK4 was designed by WI siRNA genes Selection Program (Table 2). The synthesized shRNA double strands were annealed, and the linearized vectors were recovered and transformed. The transformants grown on the plate were re-suspended in 10 µl LB culture medium, which was taken as a template for colony PCR identification. The cells were divided into two groups: TSCC1-shDKK4 (DKK4 RNAi plasmid) and TSCC1-NC (negative conntrol). The cells in logarithmic phase were digested by trypsin-EDTA (T1300-100, Solarbio, USA). Preparing the transfection solution, slowly added complex to the corresponding culture medium, shake well, put it in the incubator at 37 ℃ for 6 hours, and change it into the complete culture medium. 48 hours after transfection, cell precipitation was collected for follow-up experiment.

Table 2

RNAi sequence of DKK4
Target gene	Sequences
DKK4 (488–510)	GCAGCTTGATGAGCAAGAT
DKK4-F	CCGGGCAGCTTGATGAGCAAGATCTCGAGGAATACCTCATCTTTCCTCTTTTTTTC
DKK4-R	AATTGAAAAAAAGAGGAAAGATGAGGTATTCCTCGAG ATCTTGCTCATCAAGCTGCGGCCT

Western Blot

Protein samples were prepared and stored at-80 ℃. The electrophoretic gel was prepared and separated by electrophoretic separation. PVDF membrane (IPVH00010, Millipore, USA) was performed to transfer the film. ECL (NCI50, Thermo, USA) performed immunoblotting, GAPDH (AB0037, ABways, USA) 1, DKK4 (ab172613, abcam, USA) and β-catenin (ab32572, abcam, USA) were diluted to 1:1000, 1:1000, and 1:3000 respectively. The film was dried, scanned, and analyzed by Image J.

CCK-8 cell proliferation

The TSCC1-shDKK4 and TSCC1-NC cells were treated in two groups. The supernatants were discarded by 1000 rpm centrifugation for 5 min. The cells were resuscitated with fresh complete culture medium, and inoculated into 96 well cell culture plate (191–6381, Crystalgen Incorporated, China) 5000 cells per well. 10 µl CCK-8 reaction solution (C0037, Beyotime, China) was added to each well after being cultured at 37 ℃ and 5% CO2 incubator for 0 h, 24 h, 48 h and 72 h. The culture plate was incubated for 2–4 hours. The absorbance at 450 nm was determined by enzyme labeling instrument (RT-6000, Rayto, China).

Annexin V-FITC/PI cell apoptis

After treated for 48 hours, TSCC1-shDKK4 and TSCC1-NC cells were collected, trypsin digested and suspended according to the Annexin V-FITC/PI apoptosis kit (BMS500FI-20, Invitrogen, USA). Annexin V-FITC (Ex = 488 nm, Em = 530 nm) was detected by FITC detection channel and PI was detected by PI detection channel (Ex = 535 nm, Em = 615 nm) on the flow cytometry (C6, BD, USA).

Transwell migration

The suspension of TSCC1-shDKK4 and TSCC1-NC cells were performed to the transwell migration experiment with transwell nesting (3422, Costar, American) and matrigel basement membrane matrix (356234, Biocoat, USA). 600–800 µl medium containing 10% serum was added to the lower chamber, and 100–150 µl cell suspension was added to the upper chamber. The fluorescence inverted microscope (IX71, OLYMPUS, Germany) was performed to count and photograph after drying the chamber.

Statictics

The IBM SPSS Statistics 24.0 was performed to statistical analysis and the GraphPad Prism 8 was used to graph figures. The χ² test was performend to compare the expression of DKK4 and β-catenin in different groups. The Spearman rank was performed to analyze correlation between DKK4 and β-catenin. The double-tailed Student's test was performed to calculate cell experimental results. P < 0.05 was considered to be significantly diffenrent.

Increased expression of DKK4 and β-catenin in OSCC tissues and cell lines

The expression of DKK4 was positive in 88% (44/50) of OSCC samples and 55% (11/20) of NOM samples. The positive rate of DKK4 in OSCC was significantly higher than that in NOM (P < 0.01). The expression of β-catenin was positive in 96% (48/50) of OSCC samples and 10% (2/20) of NOM samples. The positive rate of β-catenin in OSCC was significantly higher than that in NOM (P < 0.01). The results of Real-time PCR showed that the expression of DKK4 mRNA in TSCC1 cells was significantly higher than that in HOEC cells (P < 0.001), and the expression of β-catenin mRNA in TSCC1 cells was significantly higher than that in HOEC cells (P < 0.001) (Fig. 1).There was no correlation between the expression of DKK4 and β-catenin and the age and sex of OSCC patients (P > 0.05). No correlation was found between the expression of DKK4 and β-catenin in OSCC and NOM (P > 0.05).

DKK4 increased expression of β-catenin

The results of immunohistochemistry showed that the expression of DKK4 in OSCC was higher than that in NOM, so a plasmid vector was constructed to inhibit the expression of DKK4 to form TSCC1-shDKK4 cells as the experimental group. TSCC1-NC cells were transfected with blank plasmid as control group. The results of Rearl-time PCR showed that the expression of DKK4 mRNA in TSCC1-shDKK4 cells was significantly lower than that in TSCC1-NC cells (P < 0.001), and the expression of β-catenin mRNA in TSCC1-shDKK4 cells was significantly lower than that in TSCC1-NC cells (P < 0.001) (Fig. 2). The results of Western Blot demonstrated that the expression of DKK4 protein in TSCC1-shDKK4 cells was significantly lower than that in TSCC1-NC cells (P < 0.001), and the expression of β-catenin protein in TSCC1-shDKK4 cells was significantly lower than that in TSCC1-NC cells (P < 0.001) (Fig. 3).

DKK4 promotes proliferation and migration of OSCC cells and inhibits apoptosis

The results of CCK-8 assay showed that the proliferation of TSCC1-shDKK4 cells in 72 h was significantly lower than that of TSCC1-NC cells (P < 0.001) (Fig. 4). The results of apoptosis assay showed that the number of apoptosis in TSCC1-shDKK4 cells was significantly higher than that in TSCC1-NC cells (P < 0.001) (Fig. 5).The results of transwell migration assay demonstrated that the number of migration in TSCC1-shDKK4 cell was significantly lower than that of TSCC1-NC cell migration (P < 0.01).

It was demonstrated that DKK4 inhibits the growth, migration and invasion of hepatoma cells in vitro, and reduces the tumorigenicity in mouse ^{[25, 26]}. Pendas-Franco et al. found that DKK4 enhances the migration, invasion and angiogenic potential of colorectal cancer cells in vitro ^[22]. Hirata et al. identified that DKK4 promotes the proliferation, migration and invasion of renal cancer cells in vitro, and promotes tumor growth in nude mice ^[27]. Wang et al. reported that DKK4 promoted the invasion of ovarian cancer cells in vitro ^[28]. We found that the positive expression rate of DKK4 in OSCC tissues was significantly higher than that in NOM tissues (P < 0.01) and the expression of DKK4 mRNA in TSCC1 cells was higher than that in HOEC cells (P < 0.01). The expression of DKK4 in OSCC was similar to that in colorectal cancer, renal cell carcinoma and ovarian cancer, but opposite to that in hepatocellular carcinoma ^{[22, 25, 27, 28]}. We found that the decreased expression of DKK4 inhibits the proliferation and migration of OSCC cells in vitro, and promotes apoptosis (P < 0.01). The expression and role of DKK4 varies in different cancers. To our knowledge, there was no relevant research reported on DKK4 in OSCC. The research showed that the DKK4 up-regulated in OSCC and promoted the proliferation and migration, inhibiting the apoptosis of OSCC cells. DKK4 may act as an oncogene in OSCC.

The β-catenin was found to accumulate in the cytoplasm of OSCC cells ^[14]. It was found that β-catenin was significantly correlated with tumor size, stage, invasive growth, overall survival and disease-free survival of OSCC ^{[17, 18, 29]}. Duan et al. showed that β-catenin promoted the proliferation, colony formation and tumorigenesis of tongue cancer ^[30]. Chaw et al. reported that the cytoplasmic/nuclear expression of β-catenin increased in moderate and severe dysplasia of oral mucosa and OSCC ^[15]. Fujii et al. demonstrated that the expression of cytoplasmic β-catenin protein increased with the progression of OSCC ^[16]. We found that the positive expression rate of β-catenin in OSCC tissues was significantly higher than that in NOM tissues (P < 0.01). The expression of β-catenin mRNA in TSCC1 cells was higher than that in HOEC cells (P < 0.01). Similar to previous studies, the expression of β-catenin increased in OSCC tissues and in vitro, supporting the role of β-catenin in promoting progression of OSCC.

Wnt signal pathway is involved in a variety of cellular behaviors, including cell proliferation, stem cell maintenance and differentiation, and the coordination of cell movement ^[11]. Wnt/β-catenin signal pathway is one of the most widely studied Wnt signal pathways. When the Wnt/β-catenin signal pathway is "off", the cytoplasmic APC/Axin/GSK3β/CK1α destruction complex phosphorylated β-catenin. The phosphorylated β-catenin is recognized and ubiquitinated by β-TrCP, and is degraded by proteasome, preventing the activation of target genes in the nucleus ^[8–10]. When Wnt ligands bind to FZD and LRP5/6 coreceptors, Dsh is recruited to the cell membrane to initiate Wnt/β-catenin signal ^{[8, 9, 11]}. The interaction between FZD and Dsh results in the phosphorylation of Dsh by CK1α and binding to GSK3β. The cytoplasmic APC/Axin/GSK3β/CK1α destruction complex is inactivated, and the β-catenin is accumulated in the cytoplasm and transported to the nucleus ^{[8, 10]}. The β-catenin entering the nucleus interacts with TCF/LEF to form β-catenin-TCF/LEF complex, activating the transcription of Wnt target gene ^[9]. As the central transcriptional activator of Wnt/β-catenin signal pathway, the expression of cytoplasmic β-catenin is the key of Wnt/β-catenin signal pathway ^[17]. Abberant activation of Wnt/β-catenin signal pathway is observed in many human cancers ^[9]. There are some somatic inactivation mutation of Wnt/β-catenin signal molecules in head and neck squamous cell carcinoma ^[31].

The expression of DKK4 is increased in colorectal cancer, gastric cancer, pancreatic cancer, renal cell carcinoma, ovarian cancer, esophageal cancer and endometrial carcinoma ^[19]. Pendas-Franco et al. speculated that the overexpression of DKK4 in colorectal cancer may be the result of the activation of Wnt/β-catenin signal pathway, and DKK4 may be the downstream target gene of β-catenin-TCF/LEF, which is up-regulated due to the activation of Wnt/β-catenin signal pathway ^[22]. Matsui et al. also thought that DKK4 is the downstream target of Wnt/β-catenin signal pathway, and the overexpression of DKK4 may be a side effect of the activation of Wnt/β-catenin signal ^[23]. Baehs et al. identified that Wnt/β-catenin signal pathway can fine-tune the activity of β-catenin by regulating the expression of DKK4 under physiological conditions, forming a DKK4-dependent negative feedback loop, which is closed in colorectal cancer, resulting in the growth advantage of colorectal cancer cells ^[32]. In renal cell carcinoma and ovarian cancer, DKK4 is thought to promote the proliferation, migration and invasion of cancer cells by activating Wnt/JNK signal pathway ^{[27, 28]}. These are not consistent with the conclusion that the DKK family simply inhibits the Wnt/β-catenin signal pathway ^{[8, 9]}.

In view of the differences in the expression and function of DKK4 in various cancers and the vague mechanism of Wnt/β-catenin signal in OSCC, we analyzed the expression and function of DKK4 in OSCC and in vitro. It was showed that the expression of DKK4 and β-catenin in the cytoplasm of OSCC tissues was higher than that in NOM tissues. The expression of mRNA and protein of β-catenin decreased after inhibiting the expression of DKK4 in TSCC1 cells. There was no correlation between the DKK4 and β-catenin in immunohistochemistry, the results may be related to the shortage of sample size, the semi-quantitative standard of immunohistochemistry, the antibody and the OSCC tissue. However, RT-PCR and Westtern blot experiments showed that DKK4 may promote the expression of β-catenin in OSCC. DKK4 may affect the Wnt/β-catenin signal pathway by regulating β-catenin, and then lead to the tumorigenesis and progression of OSCC. Increased expression of DKK4 in OSCC might promote the proliferation and migration, and inhibite the apoptosis in vitro by involving in Wnt/β-catenin signal pathway.

The expression of DKK4 and β-catenin was increased in OSCC. DKK4 promoted the proliferation and migration, and inhibited the apoptosis of OSCC in vitro. DKK4 may promote the expression of β-catenin and affect the tumorigenesis and progression of OSCC by regulating Wnt/β-catenin signal pathway.

OSCC

Oral squamous cell carcinoma

APC

Adenomatous polyposis coli

GSK3β

Glycogen synthase kinase 3β

CK1α

Casein kinase 1α

Ser/Thr residues

Serine/threonine residues

β-TrCP

β-transducin repeat containing protein

CRD

Cysteine-rich domain

FZD

Frizzled

LRP

Low density lipoprotein receptor related protein

Dsh

Disheveled

TCF/LEF

T-cell factor/lymphocyte enhancer factor

ARM

Armadillo

NTD

N-terminal domain

CTD

C-terminal domain

DKK

Dickkopf

NOM

normal oral mucosa

Ethics approval and consent to participate: This study was approved by the Ethics Committee of Xiangya Stomatological Hospital of Central South University (No. 20190035).

Consent for publication: Not applicable.

Availability of data and materials: The datasets used and analysed during the current study are available from the corresponding author on reasonable request.

Competing interests: The authors declare that they have no competing interests.

Funding: Not applicable.

Authors' contributions: XC designed, conducted the experiment and drafted the manuscript, ZY participated in the experiment, JH participated in the experiment and manuscript. All authors read and approved the final manuscript.

Acknowledgements: Not applicable.

Global Burden of Disease Cancer C, Fitzmaurice C, Dicker D, Pain A, Hamavid H, Moradi-Lakeh M, MacIntyre MF, Allen C, Hansen G, Woodbrook R, et al: The Global Burden of Cancer 2013. JAMA Oncol 2015, 1:505-527.
Shield KD, Ferlay J, Jemal A, Sankaranarayanan R, Chaturvedi AK, Bray F, Soerjomataram I: The global incidence of lip, oral cavity, and pharyngeal cancers by subsite in 2012. CA Cancer J Clin 2017, 67:51-64.
Cronin KA, Lake AJ, Scott S, Sherman RL, Noone AM, Howlader N, Henley SJ, Anderson RN, Firth AU, Ma J, et al: Annual Report to the Nation on the Status of Cancer, part I: National cancer statistics. Cancer 2018, 124:2785-2800.
Siegel RL, Miller KD, Jemal A: Cancer statistics, 2019. CA Cancer J Clin 2019, 69:7-34.
Chi AC, Day TA, Neville BW: Oral cavity and oropharyngeal squamous cell carcinoma--an update. CA Cancer J Clin 2015, 65:401-421.
Warnakulasuriya S: Global epidemiology of oral and oropharyngeal cancer. Oral Oncol 2009, 45:309-316.
De Angelis R, Sant M, Coleman MP, Francisci S, Baili P, Pierannunzio D, Trama A, Visser O, Brenner H, Ardanaz E, et al: Cancer survival in Europe 1999-2007 by country and age: results of EUROCARE--5-a population-based study. Lancet Oncol 2014, 15:23-34.
Liu F, Millar SE: Wnt/beta-catenin signaling in oral tissue development and disease. J Dent Res 2010, 89:318-330.
Yao H, Ashihara E, Maekawa T: Targeting the Wnt/beta-catenin signaling pathway in human cancers. Expert Opin Ther Targets 2011, 15:873-887.
Clevers H, Nusse R: Wnt/beta-catenin signaling and disease. Cell 2012, 149:1192-1205.
Holstein TW: The evolution of the Wnt pathway. Cold Spring Harb Perspect Biol 2012, 4:a007922.
Valenta T, Hausmann G, Basler K: The many faces and functions of beta-catenin. EMBO J 2012, 31:2714-2736.
Iwai S, Yonekawa A, Harada C, Hamada M, Katagiri W, Nakazawa M, Yura Y: Involvement of the Wnt-beta-catenin pathway in invasion and migration of oral squamous carcinoma cells. Int J Oncol 2010, 37:1095-1103.
Iwai S, Katagiri W, Kong C, Amekawa S, Nakazawa M, Yura Y: Mutations of the APC, beta-catenin, and axin 1 genes and cytoplasmic accumulation of beta-catenin in oral squamous cell carcinoma. J Cancer Res Clin Oncol 2005, 131:773-782.
Chaw SY, Abdul Majeed A, Dalley AJ, Chan A, Stein S, Farah CS: Epithelial to mesenchymal transition (EMT) biomarkers--E-cadherin, beta-catenin, APC and Vimentin--in oral squamous cell carcinogenesis and transformation. Oral Oncol 2012, 48:997-1006.
Fujii M, Katase N, Lefeuvre M, Gunduz M, Buery RR, Tamamura R, Tsujigiwa H, Nagatsuka H: Dickkopf (Dkk)-3 and beta-catenin expressions increased in the transition from normal oral mucosal to oral squamous cell carcinoma. J Mol Histol 2011, 42:499-504.
Lee CH, Hung HW, Hung PH, Shieh YS: Epidermal growth factor receptor regulates beta-catenin location, stability, and transcriptional activity in oral cancer. Mol Cancer 2010, 9:64.
Odajima T, Sasaki Y, Tanaka N, Kato-Mori Y, Asanuma H, Ikeda T, Satoh M, Hiratsuka H, Tokino T, Sawada N: Abnormal beta-catenin expression in oral cancer with no gene mutation: correlation with expression of cyclin D1 and epidermal growth factor receptor, Ki-67 labeling index, and clinicopathological features. Hum Pathol 2005, 36:234-241.
Cai X, Yao Z, Li L, Huang J: Role of DKK4 in Tumorigenesis and Tumor Progression. Int J Biol Sci 2018, 14:616-621.
Katase N, Nishimatsu SI, Yamauchi A, Yamamura M, Terada K, Itadani M, Okada N, Hassan NMM, Nagatsuka H, Ikeda T, et al: DKK3 Overexpression Increases the Malignant Properties of Head and Neck Squamous Cell Carcinoma Cells. Oncol Res 2018, 26:45-58.
Al-Dhohorah T, Mashrah M, Yao Z, Huang J: Aberrant DKK3 expression in the oral leukoplakia and oral submucous fibrosis: a comparative immunohistochemical study. Eur J Histochem 2016, 60:2629.
Pendas-Franco N, Garcia JM, Pena C, Valle N, Palmer HG, Heinaniemi M, Carlberg C, Jimenez B, Bonilla F, Munoz A, Gonzalez-Sancho JM: DICKKOPF-4 is induced by TCF/beta-catenin and upregulated in human colon cancer, promotes tumour cell invasion and angiogenesis and is repressed by 1alpha,25-dihydroxyvitamin D3. Oncogene 2008, 27:4467-4477.
Matsui A, Yamaguchi T, Maekawa S, Miyazaki C, Takano S, Uetake T, Inoue T, Otaka M, Otsuka H, Sato T, et al: DICKKOPF-4 and -2 genes are upregulated in human colorectal cancer. Cancer Sci 2009, 100:1923-1930.
Varghese F, Bukhari AB, Malhotra R, De A: IHC Profiler: an open source plugin for the quantitative evaluation and automated scoring of immunohistochemistry images of human tissue samples. PLoS One 2014, 9:e96801.
Fatima S, Lee NP, Tsang FH, Kolligs FT, Ng IO, Poon RT, Fan ST, Luk JM: Dickkopf 4 (DKK4) acts on Wnt/beta-catenin pathway by influencing beta-catenin in hepatocellular carcinoma. Oncogene 2012, 31:4233-4244.
Chi HC, Liao CH, Huang YH, Wu SM, Tsai CY, Liao CJ, Tseng YH, Lin YH, Chen CY, Chung IH, et al: Thyroid hormone receptor inhibits hepatoma cell migration through transcriptional activation of Dickkopf 4. Biochem Biophys Res Commun 2013, 439:60-65.
Hirata H, Hinoda Y, Majid S, Chen Y, Zaman MS, Ueno K, Nakajima K, Tabatabai ZL, Ishii N, Dahiya R: DICKKOPF-4 activates the noncanonical c-Jun-NH2 kinase signaling pathway while inhibiting the Wnt-canonical pathway in human renal cell carcinoma. Cancer 2011, 117:1649-1660.
Wang S, Wei H, Zhang S: Dickkopf-4 is frequently overexpressed in epithelial ovarian carcinoma and promotes tumor invasion. BMC Cancer 2017, 17:455.
Liu LK, Jiang XY, Zhou XX, Wang DM, Song XL, Jiang HB: Upregulation of vimentin and aberrant expression of E-cadherin/beta-catenin complex in oral squamous cell carcinomas: correlation with the clinicopathological features and patient outcome. Mod Pathol 2010, 23:213-224.
Duan Y, Fan M: Lentivirus-mediated gene silencing of beta-catenin inhibits growth of human tongue cancer cells. J Oral Pathol Med 2011, 40:643-650.
Cancer Genome Atlas N: Comprehensive genomic characterization of head and neck squamous cell carcinomas. Nature 2015, 517:576-582.
Baehs S, Herbst A, Thieme SE, Perschl C, Behrens A, Scheel S, Jung A, Brabletz T, Goke B, Blum H, Kolligs FT: Dickkopf-4 is frequently down-regulated and inhibits growth of colorectal cancer cells. Cancer Lett 2009, 276:152-159.

Download PDF

Version 1

posted

You are reading this latest preprint version

Expression and function of dinkkopf 4 in oral squamous cell carcinoma and in vitro

Status:

Version 1

Abstract

Figures

Background

Materials And Methods

Results

Discussion

Conclusion

Abbreviations

Declarations

References

Status:

Version 1