Clinical heterogeneity and molecular characteristics in a group of Chinese patients with dysferlinopathy

doi:10.21203/rs.3.rs-1773084/v1

Download PDF

Research Article

Clinical heterogeneity and molecular characteristics in a group of Chinese patients with dysferlinopathy

https://doi.org/10.21203/rs.3.rs-1773084/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Background

Dysferlinopathy is an autosomal recessive muscular dystrophy caused by mutations in the dysferlin (DYSF) gene. This study presents the clinical features and mutational spectrum of a Chinese cohort.

Methods

We reviewed the clinical, pathological data and results of DYSF mutations of 26 Chinese patients with dysferlinopathy screened by immunohistochemistry staining and mutations in DYSF genes.

Results

Among 26 patients with dysferlinopathy, 18 patients (69.2%) presented as LGMD2B, 4 (15.4%) had a phenotype of Miyoshi myopathy (MM), and 4 (15.4%) presented as atypical asymptomatic hyperkalemia(hyperCKemia). 15 patients (57.7%) were originally misdiagnosed as inflammatory myopathy or other diseases. 15 novel mutations were identified among the 40 mutation sites identified in this cohort.

Conclusions

Dysferlinopathy is a clinically heterogeneous group of disorders with various phenotypes, and has a high proportion of novel mutations and a high rate of misdiagnosis before immunohistochemistry staining and genetic analysis.

dysferlin

LGMD2B

atypical asymptomatic hyperkalemia

muscle pathology

Dysferlinopathy is an autosomal recessive muscular dystrophy caused by mutations in the DYSF gene, which is located on chromosome 2p13 and spans a genomic region of over 230 kbp consisting of 55 exons (1, 2). It encodes the dysferlin, a transmembrane protein, involved in membrane repair (3), Ca2 + signaling pathway(4), cell adhesion(5), and T-tubule formation(6). Mutations in DYSF lead to abnormal muscle wasting and cause different clinical phenotypes mainly including limb-girdle muscular dystrophy type 2B (LGMD2B), and Miyoshi myopathy (MM)(7). Both LGMD2B and MM develop in young adults with a slow course and elevated levels of creatine kinase (CK). However, muscle weakness and atrophy were different in LGMD2B and MM, with the former mainly affecting the pelvic and shoulder girdle muscles, while the latter mainly affecting the posterior compartment of the leg(8). LGMD2B is the second more common form of LGMD in Western countries (9) and Japan (10). The epidemiology of LGMD2B in China is unclear and understudied.

This disease exhibits a variety of dystrophic features in muscle pathology, including fibrosis, necrosis, changes in fiber size, and sometimes inflammatory infiltrates(11), which are easily misdiagnosed as inflammatory myopathy. Western blot (WB) and immunohistochemistry (IHC) showed that highly reduced expression of dysferlin protein, which is still a mandatory criterion for a positive diagnosis (12). But since similar manifestations can also be seen in some other secondary deletion myopathies, gene diagnosis remains the gold standard (13). Few studies on dysferlinopathy have been made in the Chinese population, and the phenotypes and molecular characteristics remain to be investigated. In this study, we reviewed the clinical and molecular characteristics of 26 Chinese patients with dysferlinopathy screened by immunohistochemistry and genetic analysis and identified a high proportion of novel mutations which expands the genetic spectrum of dysferlinopathy.

Patient selection criteria and clinical evaluation

We retrospectively reassessed clinical data of 26 Chinese patients (including two patients previously reported)(14, 15) from unrelated families with muscle biopsy in our hospital followed up based on the following inclusion criteria: (1) loss or strong reduction of dysferlin expression evidenced by immunohistochemistry on muscle biopsy and (2) mutations identified in the DYSF gene (n=26). According to the local reference range, the CK levels were normalized as x-fold the upper limit of normal values.

Standard histological methods were used to examine muscle slices. Muscle biopsy specimens were taken from the patients' biceps brachii, quadriceps femoris, or gastrocnemius muscles after informed consent. Biopsied skeletal muscles were flash-frozen in isopentane chilled by liquid nitrogen. The histopathological analysis includes hematoxylin-eosin (HE), modified Gomori trichrome(MGT), succinate dehydrogenase (SDH),myosin ATPase, acid phosphatase(ACP), NADH-tetrazolium reductase (NADH-TR), oil red O (ORO), and periodic acid-Schiff (PAS). Morphological determination of muscle specimens was finished under light microscopy.

Monoclonal antibody against dysferlin was used to perform immunohistochemistry on muscle biopsies (Abcam, Cambridge, United Kingdom; dilution 1:100).

Mutation analysis

Genomic DYSF mutation screening was conducted as described (16, 17).

Statistical analysis

All values were calculated using IBM SPSS Statistics 26.0. Values are presented as the mean ± standard error (SE) unless otherwise stated. ANOVA(ANalysis Of VAriance）was used to test the significance of differences in age of onset and serum creatine kinase (CK) level between the different types of dysferlinopathy. A value of P ≤ 0.05 was considered statistically significant (two-tailed).

Clinical Data

The 26 patients came from 9 provinces in China. Among the 26 patients, 12 were females and 14 were males [Table 1]. All patients had normal motor milestones. The average age of onset was 24.5 ± 6.5 years (range 16–37 years). 18 patients (69.2%) presented as LGMD2B, 4 (15.4%) as MM, and 4 (15.4%) as asymptomatic hyperCKemia. The corresponding average ages of onset for each of the three types were listed as 25.6 ±6.8(range 16–21 years)，21.8 ±5.1(range 17–29 years), and 22.0 ±6.1 (range 16–29 years)(p=0.41).

15 patients (57.7%) were misdiagnosed with inflammatory myopathy before immunohistochemistry staining of dysferlin protein (including 12 as LGMD2B, 2 as MM, and 1 as asymptomatic hyperCKemia), and 13 of them (86.7%) received corticosteroids, and some also received immunosuppressive drugs. Misdiagnosis of inflammatory myopathy was more frequent in the LGMD2B group (12 of 18 patients [66.7%]) vs the MM group (2 of 4 patients [50%]) and the hyperCKemia group (1 of 4 patients [25%]). 3 patients were misdiagnosed with viral myocarditis (3 of 4 patients [75%]), all of whom presented as asymptomatic hyperCKemia. The other misdiagnosis includes peripheral neuropathy (n=1), hepatopathy (n=1), and arthritis (n=1).

Serum CK level

The mean±SD minimal level of CK was 24.8±15.9 xN (range 4-62xN). CK levels tended to drop as the disease progressed (Figure 1). We discovered no correlation between CK levels and disease development in the three primary phenotypes (LGMD2B, MM, and asymptomatic hyperCKemia).The corresponding CK values of the three types are 22.8 ±12.1 xN (range 4.3–41.6 xN )，33.3 ±20.9 xN (range 8.4–59.3 xN)，23.6 ±25.4 xN (range 6.0–61.3 xN )(p=0.49).

Histological and immunohistochemical staining

A total of 26 muscle samples, corresponding to the 26 patients included, were available. The mean±SD age at biopsy was 29.3±9.0 years (range 16–52 years), and the mean±SD disease duration was 4.9±4.6 years (range 0–17 years). Samples were retrieved from biceps brachia (n=11), quadriceps (n=11), and gastrocnemius (n=4) muscles. Muscle biopsies from most patients showed markedly increased variation in fiber diameter, necrotic and regenerating fibers, splitting fibers, fibrosis, and adipose deposition to a variable degree. Ragged red fibers (RRF) and ragged blue fibers (RBF) were observed in 2 patients(Fig.2 A,B) and vacuolation in 1 patient. Immunohistochemical analysis of all patients showed a complete absence of dysferlin expression in 20 patients(Fig. 2C)compared with normal control group(Fig. 2D) and a strong reduction of dysferlin expression in 6 patients.Besides, Inflammatory cells infiltration occurred in 5 patients which makes it easily confused with inflammatory myopathy (Fig.2 E-I).

Mutational analysis

Among 26 patients, 25 patients had 2 mutations, either 1 homozygous (n=4) or 2 compound heterozygous (n=22) mutations identified in the DYSF gene, and 1 patient had only 1 heterozygous DYSF gene mutation. 40 different mutations were identified (including 15 not previously reported) [Table 1], including 17 missense (5 novel), 10 nonsense (4 novel), 7 exonic‑frameshifting mutations (insertions or deletions, 4 novel), 4 splice site mutations (0 novel), and 2 exon duplication mutations (2 novel). Exon29c.3112C>T was identified in more than one patient, and the patients who had the same mutations came from different provinces.

Dysferlinopathy is muscular dystrophy caused by mutations in DYSF gens, typically characterized by early adult-onset, a slow course, and a large increase in CK (18). This disease is the second most common LGMD in Europe and Japan but is underdiagnosed in China(19). Mutations in DYSF lead to different clinical phenotypes, mainly including LGMD2B and MM(20). LGMD2B mainly affects the proximal lower extremity muscle tissue in the youth; As the disease progresses, the scapular girdle and upper extremity muscles may also be affected, but the symptoms are mild; the ear, neck, and hand muscles are generally spared (21). MM is an adult-onset disorder characterized by early-onset gastrocnemius weakness, which is also accompanied by an increase in serum CK concentration(22). But the onset of MM was found to be earlier than that of LGMD2B in the Italian population (23). Other phenotypes associated with DYSF mutations have also been identified, including distal anterior myopathy (DACM) (also known as distal tibial onset distal myopathy), and proximal-distal phenotype (PD)(this phenotype may be a proximally rapidly progressive MM) (18, 24)and asymptomatic hyperCKemia. We didn’t observe DACM in our cohort with the highest proportion of LGMD2B, which was consistent with the domestic sample(19) and foreign studies(18).

LGMD2B is easily misdiagnosed as inflammatory myopathies, especially polymyositis (PM), which is very similar to LGMD2B in clinical manifestation and muscle pathology. Both LGMD2B and PM exhibit proximal muscle weakness and significantly elevated muscle enzymes and may show infiltration of immune cells in muscle pathology, but the treatment was different between them(21). PM is an immune disease that responds well to hormone therapy (25), but glucocorticoids have been reported to exacerbate muscle weakness in LGMD2B patients, and the damage to the muscle is irreversible (26). Studies have shown that injection of glucocorticoids into the patient's muscle cell membrane can damage the membrane stability (27), which may lead to an increase in the CK value. This instability also exacerbates the lack of fibrillin repair capacity (27), and for LGMD2B, the focus is on early symptomatic treatment and appropriate exercise, which can slow disease progression and improve motor function. Therefore, the early diagnosis of LGMD2B is closely related to the prognosis of patients. In our cohort, 5 patients showed inflammatory cell infiltration in muscle pathology. 12 LGMD2B patients (66.7%) in this group were misdiagnosed as polymyositis before biopsy, and 10 of them had received corticosteroid therapy, which may affect the level of CK. The CK level of patient 7 still repeatedly increased after corticosteroid therapy; in addition to corticosteroids, Patient 1 also took traditional Chinese medicine, but the CK level stayed at a high level (35.3 times the normal scope). Besides, 2 MM patients (50%) were misdiagnosed as polymyositis and had previously received corticosteroid therapy before the biopsy. Previous research had proposed a relationship between splicing mutations and inflammation, suggesting that splice-site mutations that disrupt dysferlin may produce an inflammation-related phenotype(28, 29). In our series, patient 1 with a splicing mutation showed muscle inflammation, confirming this finding. The two diseases can be differentiated by analyzing the expression of dysferlin in muscle tissues by IHC or WB. For patients with LGMD2B, IHC or WB analysis showed a lack of dysferlin in the involved muscle fibers, and MHC-I results were negative or low(30).

Besides inflammatory myopathies, dysferlinopathy patients with a history of exercise intolerance or asymptomatic hyperCKemia (18, 31) may be misdiagnosed as metabolic myopathy. CK levels fluctuated in patients with metabolic myopathy but usually stayed at a high level in patients with dysferlinopathy, except in the late stage of the disease because of muscle wasting. 3 patients of asymptomatic hyperCKemia (75%) in our cohort were misdiagnosed as viral myocarditis before. CK-MB is one of the diagnostic indicators of viral myocarditis. It has been reported that the CK-MB levels of children with viral myocarditis in the acute phase are about 3 times that of the normal control group (32) and CK levels can slightly increase, while in dysferlinopathy the CK but not the CK-MB levels usually increased significantly. Muscle damage in dysferlinopathy also results in an elevated level of liver enzymes (for example, ALT and AST) which may be confused with liver disease. Our study found that patients with asymptomatic hyperCKemia were easily misdiagnosed as myocarditis (75%) and liver disease (25%), indicating insufficient recognition of this disease in primary hospitals in China, especially for doctors of internal medicine.

In addition to the typical dystrophic features, 2 patients in this dysferlinopathy group presented with several ragged red fibers (RRF) seen on histopathological MGT staining. Previous reports have also documented mitochondrial abnormalities in some patients with DYSF mutations, in which there is an accumulation of subsarcolemmal mitochondria in muscle fibers, including one patient with RRF and paracrystalline mitochondrial inclusions(33, 34). The mechanisms for the formation of mitochondria abnormalities observed in muscle pathology are undefined. Previous research showed that dysferlin has a ferlin Ca²⁺ domain with a variable affinity for Ca²⁺ and helps to regulate the level of cytoplasmic Ca²⁺ (33), which becomes abnormally high in the absence of dysferlin. Doug M. Turnbull(35) et al suggested that dysferlin gene mutations increased the concentration of cytoplasmic Ca²⁺, leading to mitochondrial aberrations. However, not only do mitochondria regulate cytoplasmic Ca²⁺ levels, but the abnormal elevation of Ca²⁺ would also affect mitochondria, and calcium influx into the cytoplasm would lead to fragmentation of the mitochondrial network and increase mitochondrial fission (36). Further studies are needed to investigate the mechanisms which may explore potential therapeutic strategies for dysferlinopathy.

Decreased expression of dysferlin supports the diagnosis of dysferlinopathy, but it should be noticed that the expression of dysferlin may also decrease secondary to mutations of other related genes, such as CAPN3 (causative gene for LGMD2A), so genetic analysis remains the definitive diagnostic criterion for dysferlinopathy. A wide range of DYSF mutations has been identified, including missense, nonsense, frameshift deletions/insertions, splice mutations, and large exonic deletions(9). The top three outcomes in the world patients dataset were missense (42.3%), splicing (13.7%), and frameshift (11.1%) (17). Missense mutations accounted for nearly half of the study in this cohort, and a comparison of the mutational spectrum with a large French cohort (37) suggested a possible difference, with null mutations being lower in the Chinese cohort (25% vs 76%), while missense mutations were more common in the Chinese cohort (43% vs 24%). Missense mutations have been suggested to cause more severe disease manifestations with higher CK levels(24). Most reported pathogenic variants for dysferlinopathy are point mutations and small insert/deletions(37), but large exonic deletions and duplications have also been described (38). Pathogenic variants identified in this study consist of 5 (5/18) canonical-splice, 8 (8/18) nonsense, 4 (4/18) missense, and 1 (1/18) frameshift mutation. Most of the mutation types are point mutations consistent with previous reports. Two mutations identified previously in Chinese patients: c. 937 + 1G > A6 and c. 3112C > T (20) were also retrieved in our study. Exon29c.3112C > T was identified in more than one patient, and the patients who had the same mutations came from different provinces, suggesting the mutation may be recurrent in China. The c.2997G > T variant was apparently the most common variant in the LGMD group(39), but no c.2997G > T variant was observed in our cohort. Previous studies involving other genotypes have shown no observed relationship between reduced expression levels and the severity of clinical symptoms. Therefore, the effect of genotype on protein levels, and thus on phenotype, should be further investigated for each variant (39). In addition, we also identified 15 novel mutations, expanding the molecular spectrum of dysferlinopathy, and highlighted the high proportion of novel mutations in Chinese patients with dysferlinopathy.

In summary, we reviewed the clinal and molecular characteristics of 26 Chinese patients with dysferlinopathy. This study showed clinical and genetic heterogeneity of dysferlinopathy and a high proportion of novel mutations in the Chinese population. We also found a high rate of misdiagnosis of dysferlinopathy in primary hospitals, suggesting more attention should be paid to the recognition of this disease.

LGMD2B, Limb-girdle Muscular Dystrophy Type 2B; MM, Miyoshi Myopathy; DACM, Distal anterior myopathy; PD, Proximal-Distal phenotype; WB, Western Blot; IHC, Immunohistochemistry; HE, Hematoxylin-Eosin; MGT, Modified Gomori Trichrome; SDH, Succinate Dehydrogenase; ACP, Acid Phosphatase; NADH-TR, NADH-Tetrazolium Reductase; ORO, Oil Red O; PAS, Periodic Acid-Schiff; RRF, Ragged Red Fibers; RBF, Ragged Blue Fibers; CK, Creatine Kinase

Ethics approval and consent

The studies involving human participants, human data, or human tissue were approved by the Ethics Committee of the Second Hospital of Hebei medical university (2018-R197）.We confirm all methods were carried out in accordance with relevant guidelines and regulations.

Consent for publication

Not applicable.

Availability of data and materials

The datasets generated and/or analyzed during the current study are not publicly available due to concerns regarding patient anonymity. but are available from the corresponding author on reasonable request.

Competing interests

The authors declare that they have no competing interests.

Funding

This study was supported by the Scientific research Foundation of the Second Hospital of Hebei Medical University (No. 2h201848).

Authors' contributions

NW writes and revises the paper; XH, SH, JH, SS, JT, and YL collect case data; HW and SM perform pathological staining; GJ designs the work and revises the paper; XS designs and supervises the work. All authors read and approved the final manuscript.

Acknowledgments

We are grateful to 26 patients and their families.

Liu J, Aoki M, Illa I, Wu C, Fardeau M, Angelini C, et al. Dysferlin, a novel skeletal muscle gene, is mutated in Miyoshi myopathy and limb girdle muscular dystrophy. Nat Genet. 1998;20(1):31–6.
Bashir R, Britton S, Strachan T, Keers S, Vafiadaki E, Lako M, et al. A gene related to Caenorhabditis elegans spermatogenesis factor fer-1 is mutated in limb-girdle muscular dystrophy type 2B. Nat Genet. 1998;20(1):37–42.
Bansal D, Miyake K, Vogel SS, Groh S, Chen C-C, Williamson R, et al. Defective membrane repair in dysferlin-deficient muscular dystrophy. Nature. 2003;423(6936):168–72.
Kerr JP, Ziman AP, Mueller AL, Muriel JM, Kleinhans-Welte E, Gumerson JD, et al. Dysferlin stabilizes stress-induced Ca2 + signaling in the transverse tubule membrane. Proc Natl Acad Sci U S A. 2013;110(51):20831–6.
de Morrée A, Flix B, Bagaric I, Wang J, van den Boogaard M, Grand Moursel L, et al. Dysferlin regulates cell adhesion in human monocytes. J Biol Chem. 2013;288(20):14147–57.
Klinge L, Harris J, Sewry C, Charlton R, Anderson L, Laval S, et al. Dysferlin associates with the developing T-tubule system in rodent and human skeletal muscle. Muscle & nerve. 2010;41(2):166–73.
Laval SH, Bushby KMD. Limb-girdle muscular dystrophies–from genetics to molecular pathology. Neuropathol Appl Neurobiol. 2004;30(2).
Ten Dam L, Frankhuizen WS, Linssen WHJP, Straathof CS, Niks EH, Faber K, et al. Autosomal recessive limb-girdle and Miyoshi muscular dystrophies in the Netherlands: The clinical and molecular spectrum of 244 patients. Clin Genet. 2019;96(2):126–33.
Guglieri M, Magri F, D'Angelo MG, Prelle A, Morandi L, Rodolico C, et al. Clinical, molecular, and protein correlations in a large sample of genetically diagnosed Italian limb girdle muscular dystrophy patients. Human mutation. 2008;29(2):258–66.
Tagawa K, Ogawa M, Kawabe K, Yamanaka G, Matsumura T, Goto K, et al. Protein and gene analyses of dysferlinopathy in a large group of Japanese muscular dystrophy patients. Journal of the neurological sciences. 2003;211(1–2):23–8.
Gallardo E, Rojas-García R, de Luna N, Pou A, Brown RH, Illa I. Inflammation in dysferlin myopathy: immunohistochemical characterization of 13 patients. Neurology. 2001;57(11):2136–8.
Anderson LV, Davison K, Moss JA, Young C, Cullen MJ, Walsh J, et al. Dysferlin is a plasma membrane protein and is expressed early in human development. Hum Mol Genet. 1999;8(5):855–61.
Nilsson MI, Laureano ML, Saeed M, Tarnopolsky MA. Dysferlin aggregation in limb-girdle muscular dystrophy type 2B/Miyoshi Myopathy necessitates mutational screen for diagnosis [corrected]. Muscle & nerve. 2013;47(5):740–7.
Tang J, Song X, Ji G, Wu H, Sun S, Lu S, et al. A novel mutation in the DYSF gene in a patient with a presumed inflammatory myopathy. Neuropathology. 2018.
Yan H-Y, Xie Y-N, Han J-Z, Song X-Q. Mutation at a new allele of the dysferlin gene causes Miyoshi myopathy: A case report. J Musculoskelet Neuronal Interact. 2021;21(3):397–400.
Izumi R, Niihori T, Takahashi T, Suzuki N, Tateyama M, Watanabe C, et al. Genetic profile for suspected dysferlinopathy identified by targeted next-generation sequencing. Neurol Genet. 2015;1(4):e36.
Zhong H, Yu M, Lin P, Zhao Z, Zheng X, Xi J, et al. Molecular landscape of DYSF mutations in dysferlinopathy: From a Chinese multicenter analysis to a worldwide perspective. Hum Mutat. 2021;42(12):1615–23.
Nguyen K, Bassez G, Krahn M, Bernard R, Laforêt P, Labelle V, et al. Phenotypic study in 40 patients with dysferlin gene mutations: high frequency of atypical phenotypes. Archives of neurology. 2007;64(8):1176–82.
Xi J, Blandin G, Lu J, Luo S, Zhu W, Beroud C, et al. Clinical heterogeneity and a high proportion of novel mutations in a Chinese cohort of patients with dysferlinopathy. Neurol India. 2014;62(6):635–9.
Zhao Z, Hu J, Sakiyama Y, Okamoto Y, Higuchi I, Li N, et al. DYSF mutation analysis in a group of Chinese patients with dysferlinopathy. Clin Neurol Neurosurg. 2013;115(8):1234–7.
Xu C, Chen J, Zhang Y, Li J. Limb-girdle muscular dystrophy type 2B misdiagnosed as polymyositis at the early stage: Case report and literature review. Medicine (Baltimore). 2018;97(21):e10539.
Li L, Jing Z, Cheng L, Liu W, Wang H, Xu Y, et al. Compound heterozygous DYSF variants causing limb-girdle muscular dystrophy type 2B in a Chinese family. J Gene Med. 2020;22(11):e3272.
Cagliani R, Magri F, Toscano A, Merlini L, Fortunato F, Lamperti C, et al. Mutation finding in patients with dysferlin deficiency and role of the dysferlin interacting proteins annexin A1 and A2 in muscular dystrophies. Human mutation. 2005;26(3):283.
Ueyama H, Kumamoto T, Horinouchi H, Fujimoto S, Aono H, Tsuda T. Clinical heterogeneity in dysferlinopathy. Intern Med. 2002;41(7):532–6.
Anh-Tu Hoa S, Hudson M. Critical review of the role of intravenous immunoglobulins in idiopathic inflammatory myopathies. Semin Arthritis Rheum. 2017;46(4):488–508.
Hoffman EP, Rao D, Pachman LM. Clarifying the boundaries between the inflammatory and dystrophic myopathies: insights from molecular diagnostics and microarrays. Rheum Dis Clin North Am. 2002;28(4):743–57.
Sreetama SC, Chandra G, Van der Meulen JH, Ahmad MM, Suzuki P, Bhuvanendran S, et al. Membrane Stabilization by Modified Steroid Offers a Potential Therapy for Muscular Dystrophy Due to Dysferlin Deficit. Mol Ther. 2018;26(9):2231–42.
McNally EM, Ly CT, Rosenmann H, Mitrani Rosenbaum S, Jiang W, Anderson LV, et al. Splicing mutation in dysferlin produces limb-girdle muscular dystrophy with inflammation. Am J Med Genet. 2000;91(4):305–12.
Chaouch A, Brennan KM, Hudson J, Longman C, McConville J, Morrison PJ, et al. Two recurrent mutations are associated with GNE myopathy in the North of Britain. J Neurol Neurosurg Psychiatry. 2014;85(12):1359–65.
Nagaraju K, Rawat R, Veszelovszky E, Thapliyal R, Kesari A, Sparks S, et al. Dysferlin deficiency enhances monocyte phagocytosis: a model for the inflammatory onset of limb-girdle muscular dystrophy 2B. Am J Pathol. 2008;172(3):774–85.
Okahashi S, Ogawa G, Suzuki M, Ogata K, Nishino I, Kawai M. Asymptomatic sporadic dysferlinopathy presenting with elevation of serum creatine kinase. Typical distribution of muscle involvement shown by MRI but not by CT. Intern Med. 2008;47(4):305–7.
Chen J, Deng Y. Diagnostic Performance of Serum CK-MB, TNF-α and Hs-CRP in Children with Viral Myocarditis. Open Life Sci. 2019;14:38–42.
Gayathri N, Alefia R, Nalini A, Yasha TC, Anita M, Santosh V, et al. Dysferlinopathy: spectrum of pathological changes in skeletal muscle tissue. Indian J Pathol Microbiol. 2011;54(2):350–4.
Liu F, Lou J, Zhao D, Li W, Zhao Y, Sun X, et al. Dysferlinopathy: mitochondrial abnormalities in human skeletal muscle. Int J Neurosci. 2016;126(6):499–509.
Vincent AE, Rosa HS, Alston CL, Grady JP, Rygiel KA, Rocha MC, et al. Dysferlin mutations and mitochondrial dysfunction. Neuromuscul Disord. 2016;26(11):782–8.
Han X-J, Lu Y-F, Li S-A, Kaitsuka T, Sato Y, Tomizawa K, et al. CaM kinase I alpha-induced phosphorylation of Drp1 regulates mitochondrial morphology. J Cell Biol. 2008;182(3):573–85.
Krahn M, Béroud C, Labelle V, Nguyen K, Bernard R, Bassez G, et al. Analysis of the DYSF mutational spectrum in a large cohort of patients. Human mutation. 2009;30(2):E345-E75.
Krahn M, Borges A, Navarro C, Schuit R, Stojkovic T, Torrente Y, et al. Identification of different genomic deletions and one duplication in the dysferlin gene using multiplex ligation-dependent probe amplification and genomic quantitative PCR. Genet Test Mol Biomarkers. 2009;13(4):439–42.
Izumi R, Takahashi T, Suzuki N, Niihori T, Ono H, Nakamura N, et al. The genetic profile of dysferlinopathy in a cohort of 209 cases: Genotype-phenotype relationship and a hotspot on the inner DysF domain. Hum Mutat. 2020;41(9):1540–54.

Table 1

Clinical and mutational data obtained in the cohort
Patient no.	Sex	Age at onset	disease duration	fold	Phenot-ype	Zygos-ity	Mutation type	Nucleotide changes
1	M	26	2	35.3	LGMD2B	Het	Canonical-splice	c.144 + 1G > A
1	M	26	2	35.3	LGMD2B	Het	splice	c.1273 + 5G > C
2	M	18	0.1	11༎6	HyperCK	Hom	missense	c.965T > C
3	M	16	0.5	6	HyperCK	Het	missense	c.3026A > G*
3	M	16	0.5	6	HyperCK	Het	nonsense	c.3112C > T
4	M	25	0.1	61.3	HyperCK	Het	nonsense	c.3112C > T
4	M	25	0.1	61.3	HyperCK	Het	nonsense	c.3988C > T
5	M	29	0	15.4	HyperCK	Het	missense	c.3286C > A*
5	M	29	0	15.4	HyperCK	Het	nonsense	c.5826C > A*
6	F	24	7	18.3	LGMD2B	Het	canonical-splice	c.937 + 1G > A
6	F	24	7	18.3	LGMD2B	Het	missense	c.2974T > C
7	M	25	10	6.9	LGMD2B	Hom	missense	c.1165G > A
8	M	16	6	19.4	LGMD2B	Het	nonsense	c.4756C > T
8	M	16	6	19.4	LGMD2B	Het	frameshift	c.5316dupC*
9	F	16	10	20.6	LGMD2B	Het	nonsense	c.610C > T
9	F	16	10	20.6	LGMD2B	Het	duplication	exon22-29 suspected duplication mutation*
10	M	27	4	30.3	LGMD2B	Het	missense	c.2418C > A*
10	M	27	4	30.3	LGMD2B	Het	missense	c.5525G > A
11	F	21	1	26.7	LGMD2B	Hom	missense	c.5296G > A
12	M	18	4	49.6	LGMD2B	Het	canonical-splice	c.937 + 1G > A
12	M	18	4	49.6	LGMD2B	Het	missense	c.5509G > A
13	F	18	1	36.3	LGMD2B	Het	missense	c.3725G > A
13	F	18	1	36.3	LGMD2B	Het	missense	c.4742G > A
14	F	33	2	32	LGMD2B	Het	missense	c5197A > G
14	F	33	2	32	LGMD2B	Het	missense	c.5258A > G*
15	F	35	1	15	LGMD2B	Het	nonsense	c.673C > T*
15	F	35	1	15	LGMD2B	Het	missense	c.5795T > A*
16	F	27	3	26.7	LGMD2B	Het	nonsense	c.156G > A*
16	F	27	3	26.7	LGMD2B	Het	missense	c.5570A > G
17	M	35	8	19.1	LGMD2B	Het	frameshift	c.1375dupA
17	M	35	8	19.1	LGMD2B	Het	frameshift	c.3648delA*
18	F	31	17	4.3	LGMD2B	Het	missense	c.755C > T
18	F	31	17	4.3	LGMD2B	Het	duplication	Exon41-52suspected duplication mutation*
19	F	26	10	7.6	LGMD2B	Het	frameshift	c.808_811del*
19	F	26	10	7.6	LGMD2B	Het	nonsense	c.3112C > T
20	M	37	15	16.1	LGMD2B	Het	frameshift	c.3216_3217delCT
20	M	37	15	16.1	LGMD2B	Het	missense	c.5032T > C
21	M	18	6	34.5	LGMD2B	Hom	frameshift	c.4979_4998delGTGAGACGGTCGTCGACCTGinsA*
22	M	29	4	35.8	MM	Het	canonical-splice	c.2643 + 1G > A
22	M	29	4	35.8	MM	Het	missense	c.3352G > A*
23	F	21	5	29.6	MM	Het	missense	c.2974T > C
23	F	21	5	29.6	MM	Het	frameshift	c.5606dupG
24	M	17	1	59.3	MM	Het	nonsense	c.610C > T
24	M	17	1	59.3	MM	Het	nonsense	c.4228C > T
25	F	20	7	8.4	MM	Het	nonsense	c.3112C > T
25	F	20	7	8.4	MM	Het	nonsense	c.1480G > T
26	F	28	3	11.6	LGMD2B	Hom	canonical-splice	c.937 + 1G > A
* novel mutation; Het, heterozygous; Hom, homozygous; LGMD2B, limb-girdle muscular dystrophy type 2B; MM, Miyoshi Myopathy; HyperCK, asymptomatic hyperCKemia.

No competing interests reported.

Download PDF

Editorial decision: Major revision
18 Jul, 2022
Reviews received at journal
09 Jul, 2022
Reviewers agreed at journal
28 Jun, 2022
Reviewers invited by journal
27 Jun, 2022
Editor assigned by journal
27 Jun, 2022
Editor invited by journal
27 Jun, 2022
Submission checks completed at journal
27 Jun, 2022
First submitted to journal
19 Jun, 2022

You are reading this latest preprint version

Clinical heterogeneity and molecular characteristics in a group of Chinese patients with dysferlinopathy

Status:

Version 1

Abstract

Background

Methods

Results

Conclusions

Figures

Introduction

Methods

Results

Discussion

Abbreviations

Declarations

References

Tables

Additional Declarations

Status:

Version 1