Experimental Animals
The study was conducted on nine dogs aged 2-3 years and weighing 12-15 Kg. Under the influence of general anesthesia [23], acute full thickness skin wound of 3 cm diameter was made on the right side of the vertebral column in the chest area.
Study Groups:
The dogs were divided into three groups each one include three dogs, the wounds of all groups treated twice weekly for three successive weeks.
Group A (control group): the wounds of this group were subjected only to normal saline.
Group B (PRP treatment): the wounds were treated by autologous PRP where the edges of the wound were well covered, as was the wound itself.
Group C (PRF treatment): the wounds were treated by autologous PRF, by the same technique adopted in the second group.
Then leave the wounds of all groups to heal with the second intention.
Preparation of PRP by double centrifugation
The blood obtained from the dogs was put into biochemistry tubes containing citrate-phosphate-dextrose solution and centrifuged for 10 min at 1500 rpm. After centrifugation, 3 layers were obtained. The plasma layer at the top was collected in another centrifugation tube and subjected to a second centrifugation for 10 min at 3000 rpm, after which 2 layers were obtained; the upper layer was platelet-poor plasma (PPP) and the lower was PRP [24]. This final form of liquid PRP was applied to the wounds of the dogs.
Preparation of PRF
For each dog, the blood sample (1 tube of 15 ml each) was obtained from a jugular vein. The blood samples were taken without anticoagulant in dry glass tubes and were immediately centrifuged at 3,000 rpm for 10 minutes with a specific table centrifuge at room temperature. After centrifugation, the PRF clot was removed from the tube using sterile tweezers, separated from the RBC base using sterile scissors, and placed in a sterile cup [25].
The evaluation and comparison between the three treatment regimens was carried out through clinical vision, real time quantitative PCR and histopathological examination.
Evaluation of wound contraction rates
Clinical evaluation achieved through digital photographs which taken from wounds in the presence of ruler for measuring of wound healing rate at days 0, 7, 14 and 21 after injury. The wound healing rate in control, PRP and PRF-treated wounds was calculated according to the following equations:
WHR% = (iWA- fWA)/iWA x 100 [26].
Real time quantitative PCR
Skin section will be taken immediately from anaesthetized animals and placed in Cryo tubes and stored in RNA later solution (by 10 μL per 1 mg of tissue) (Qiagen-GmbH, Germany) at-80°C.
Total RNA was isolated using Easy Red TM kit (Intron Biotechnology, Korea) according to the instructions of the manufacturer, it was eluted in nuclease-free water, purity quantified spectrophotometrically at 260 and 280 nm, and kept at−80 °C until use. Ten µL RNA (2 µg) from each sample were taken for Synthesis of cDNA using RT2First Strand Kit (Qiagen-GmbH, Germany) according to the manufacturer instruction. Quantitative Real Time PCR amplifications were performed with RT2 SYBR Green master mix (Qiagen-GmbH, Germany), in the thermocycler Real time PCR (Applied Biosystem 7500 Fast Real time PCR,USA), under the following cycle conditions: 95°C for 10 min followed by 40 cycles of 95°C for 15 sec then 60°C for 1 min.
The fold-change for each gene calculated using the formula: 2(-ΔΔCT) [27]. The p values are calculated based on a Student’s t test of the replicate 2^(-Delta Ct) values for each gene in the control group and treatment groups and p values less than 0.05. Transcript quantities were normalized by RPS-5 as a house keeping gene. The following primers (Invitrogen, Thermo Fisher Scientific, USA) were used for cDNA amplification (table 1).
Table 1 List of primer sequence.
Target gene
|
Sequence 5-3
|
RPS-5
|
F: tcactggtgagaaccccct R: cctgattcacacggcgtag [28].
|
IL-10
|
F: cccgggctgagaaccacgac R: aaatgcgctcttcacctgctccac [29].
|
TGF-β
|
F: caaggatctgggctggaagtgga R: ccaggaccttgctgtactgcgtg [30].
|
Histopathological evaluation
Specimens for histopathological evaluation were obtained on day 21 after surgery; the specimens were fixed in 10% neutral buffered formalin. After 24 h of fixation, the skin tissues were gradually dehydrated and embedded in paraffin. Then, a microtome was used to cut the tissues into 5-μm-thick sections. Paraffin sections were stained by Hematoxylin and Eosin (H&E) for routine light microscopic examination and Masson’s trichrome stain to detect connective tissue maturation. The depth and organization of the green color can differentiate the maturity of collagen fibers [31]. The degree of collagen production, cellular infiltration, neovascularization, and re-epithelialization process including thickness of epithelium over the wound are the parameters involved in wound healing. Histopathological evaluation of these parameters allowed the detection of differences between control and treated groups.
Productive and economic measures
Body weight was recorded individually for each dog in each group at beginning and at the end of the experiment
Treatment cost was defined as cost of inputs used to treat disease [32]:
Control group receive only dressing (cost of dressing per day * number of days for each animal.
PRP receive dressing + PRP (PRP cost per day * number of days) for each animal.
PRF receive dressing + PRF (PRF cost per day * number of days) for each animal.
Statistical analysis:
The collected data in the present investigation are subjected to statistical analysis using one way analysis of variance (ANOVA) used to determine, wound dimensions, means of different variables as TGF, IL10, body weight changes and treatment cost. Correlation matrix was done to determine relationship between variables as body weight changes and treatment cost on TGF, IL10 and WHR % .Linear regression: The regression test used to determine the best way of the correlations between WHR%, TGF and IL 10 (dependent variable) with loss of weight and treatment cost (independent variable) the model of the functions was the logarithmic model. (t test) used to determine the significance of each relationship . Also, the adjusted coefficient of determination (R-2) was calculated to determine the degree of each relationship between dependent and independent variables [33].