Animal Study
In this study, 100 adult female mice and 10 adult male mice were included (Strain CD-1). Mice (8–10 weeks old, 20–50 g) were obtained from the Royan Institute, Tehran, Iran. All mice were kept on a 12-h light/12‐h dark cycle and had free access to food and water. The ethics committee of Islamic Azad University, Science and Research Branch, Tehran, Iran approved the study (IR.IAU.SRB.REC.1398.123). All experiments followed the National Institutes of Health guidelines for the care and use of laboratory animals.
During sperm and oocyte recovery, male and female mice were euthanised by cervical dislocation. Superovulation was induced in 80 female mice (6–8 weeks old, 20–25 g) using peritoneal injections of 7.5 IU PMSG (Folligon, Canada) and 7.5 IU hCG (Pregnenolone, Intervet) in the middle of the light cycle at a time interval of 46–48 h.
Approximately 13–16 h after hCG injection, the fallopian tube was separated from the ovary. Afterwards, oocytes were released from the ampulla, introduced into an HTF (Geneocell, Iran) medium that was supplemented with 15 mg/ml BSA (Sigma-Aldrich, Germany), collected, and counted under an inverted microscope. At least 12 oocytes were collected from each mouse.
In Vitro Fertilisation and culturing
Epididymides were removed from 10 adult fertile male mice and transferred to an HTF (Geneocell, Iran) medium supplemented with 15 mg/ml BSA (Sigma-Aldrich, Germany). The epididymides were then incubated for 1 h in an incubator at 37°C and 5% CO2, thus facilitating the release of the sperm from the epididymides into the medium. The capacitated sperm in the HTF (Geneocell, Iran) medium were added to an HTF medium droplet containing oocytes (2x106 spermatozoa/ml). Approximately 10 µl of the HTF (Geneocell, Iran) containing motile sperm was added to each IVF droplet. After oocytes and sperm were incubated for 5–7 h, the fertilisation rate was recorded. The fertilisation rate was determined by gently removing and pipetting the sperm and cumulus cells and then counting the number of ova with male and female pronuclei (2PNs). Then, the embryos were cultured by supplementing an HTF (Geneocell, Iran) medium with 4 mg/ml BSA (Sigma-Aldrich, Germany). The media were applied in 25 µl droplets covered with mineral oil (Life Global, Bulgaria). Roughly 22–25 h after insemination, two-, and four-cell embryos were observed. After washing and transferring these blastomeres to the HTF medium, 8-cell stage were observed.
Fertilisation Rate
From 80 female mice, 1000 oocytes were collected. Of these oocytes, 968 (96.8%) were in the MII stage. The fertilised oocytes, 2-cell stage embryos, 4-cell stage embryos, 8-cell stage embryos, and failed embryos were counted under a stereo microscope.
Experimental Groups and Transfections
Three groups were considered for experiment in 8 cell stage, also three solutions were prepared as follows: solution A included 15 µl antagomir (Cat. No. MNM01000) from ABM (ABM, Inc., Richmond, BC, Canada) and 135 µl HTF medium; The lyophilised antagomir was re-suspended in 50 µl of DNase and RNase-free water to make a 100-µM stock (1 µM working). Antagomirs are modified microRNA inhibitors with several modifications on the strands, thereby making them more resistant to degradation than normal inhibitors.
solution B includs 10 µl transfection reagent using ViaFect™ (Promega, Madison, WI, USA) and 140 µl HTF medium, and solution C included 15 µl DDW and 135 µl HTF medium (Geneocell, Iran). For the treatment groups, 5 µl of solution A and 5 µl of solution B (mixed for 20 min) were added to the culture drops(25 µl), each contains five embryos.
For the sham group, 5 µl of solution B and 5 µl of solution C were added to the culture drops. In the sham groups, culture drops received only the transfection reagent. At last, the control group received no treatment. Finally, all three groups were cultured up to the blastocyst stage.
mmu-let-7a-5p antagomirs were transfected into 8-cells stage embryo via ViaFect™ Transfection Reagent according to the manufacturer’s protocol. This reagent allows the high-efficiency transfection of blastocysts without compromising cell viability.
Blastocyst Transfer and Implantation Rate
Twenty recipient females were caged individually with vasectomised males on day 0 and were checked for the presence of vaginal plugs on day 1. In total, 100 blastocysts from the control group and 100 blastocysts from the treatment group were transferred to pseudopregnant mice (day 3). Each recipient mouse received 10 blastocysts in one uterine horn under anaesthesia using intraperitoneal injections of a Ketamine/Xylazine combination (40 mg/kg + 5 mg/kg, ip).
Blastocysts were evaluated for implantation 96 h after the embryo was transferred to the uterine horn of mice. Pregnant mice were sacrificed by cervical spine dislocation, and the uterine horn was removed so that the implantation rate of each group could be calculated.
RNA Extraction
RNA extraction from blastocysts and cDNA synthesis were performed using a BON embryo miRNA detection kit (Bonyakhteh, Tehran, Iran, Cat No # BN-0011.31) according to the manufacturer’s protocol. Two blastocysts were briefly lysed in 2.5 µl of a BON lysis buffer at room temperature for 5 min.
cDNA Synthesis
The expression of the mature miRNA and target mRNAs were detected via the poly(A)-tailed universal reverse transcription method (5). This was done using the BON-miR high sensitivity miRNA 1st strand cDNA synthesis kit according to the manufacturer’s instructions (BON209001, Bon Yakhteh, Iran). In the polyadenylation step, a run of AMP was added to the 3’-end of the RNA using E. coli poly(A) polymerase and rATP. A reaction mixture containing 2.5 µl total RNA, 0.5 µl rATP (10 mM), 0.2 µl poly(A) polymerase, 1 µl 10X poly(A) polymerase buffer, and DDW up to a final volume of 10 µl was incubated for 30 min at 37°C. Enzyme inactivation was accomplished by heating the mixture at 65°C for 20 min. After completing the polyadenylation reaction, 1 µl of a BON-RT adaptor (10 µM) was added to 10 µl poly(A)-tailed RNA and incubated at 75°C for 5 min, and then immediately put on ice. For the cDNA synthesis, a mixture containing 0.7 µl RT enzyme, 2 µl dNTP mix (100 mM), 4 µl 5X RT buffer, an 11-µl mixture of poly(A)-tailed RNA and BON-RT adaptor, and DDW up to a final volume of 20 µl was prepared.
The cDNA synthesis process started with an initial adaptor annealing at 25°C for 10 min, cDNA synthesis at 42°C for 60 min, and the heat inactivation of RT enzymes at 70°C for 10 min. cDNAs were stored at -80°C. The BON-RT adaptor is a degenerate primer. The last nucleotide at the 3’-end is A, G, C, or T, whereas the 3’-penultimate nucleotide is either A, G, or C. The two variable nucleotides were flanked by an oligo(dT), followed by a stuffer sequence for increasing the length of the adaptor and a common reverse primer at the 5’-end.
Real-Time PCR
A quantitative real-time PCR process was used for the relative quantification of mmu-let-7a-5p and Snord70 and was performed using the specific forward primers and a common reverse primer (Table 1). To increase the specificity of the forward primer, a G:T mismatch was introduced at the 3’-end penultimate; in this way, the forward primer was distinguished from the other members of the let-7 family. The melting temperature (Tm) of mmu-let-7a-5p primer was increased by adding GGC to the 5’-end of the forward primers. The specificity of the forward primers was checked by BLASTN, SSEARCH (www.miRBase.org) and primer blast (www.ncbi.nlm.nih.gov).
Table 1
Primer sequences for quntification of mmu-let-7a-5p and Snord70, as well as their mature sequences. The underlined letters indicated a mismatched base pair.
Primer/Gene | Mature sequence (5'→3') | Primer (5'→3') |
---|
Snord70 | …UGAUUUAACAAAAAUUCGUCACUACCACUGAGACAACAAUGAA | TGATTTAACAAAAATTCGTCAC |
mmu-let-7a-5p | UGAGGUAGUAGGUUGUAUAGUU | GGCTGAGGTAGTAGGTTGTAGA |
Common Reverse | | GAGCAGGGTCCGAGGT |
The target mRNAs were quantified via specific forward and reverse primers using the SYBR green real-time PCR assay. The primer sequences are shown in Table 2.
Table 2
Primer sequences an their related product size for quntification of the target mRNAs and Actb reference gene.
Gene | Forward Primer(5'→3') | Reverse Primer (5'→3') | Length (bp) |
---|
Actb | GTACCACCATGTACCCAGGC | AACGCAGCTCAGTAACAGTCC | 247 |
Igf1 | GCTGGTGGATGCTCTTCAGT | TCCGGAAGCAACACTCATCC | 125 |
Il1a | ACGTCAAGCAACGGGAAGAT | AAGGTGCTGATCTGGGTTGG | 124 |
Itgb3 | GGGCGTTGTTGTTGGAGAG | GCCTCACTGACTGGGAACTC | 198 |
Tgfb1 | AGGGCTACCATGCCAACTTC | CCACGTAGTAGACGATGGGC | 168 |
The qPCR reactions were performed according to the BON-miR qPCR kit’s instructions (Bonyakhteh, Teran, Iran) in a MIC real-time PCR system (Bio Molecular Systems, Australia). Briefly, 6.5 µl 2X miRNA qPCR master mix, 0.5 µl common reverse primer (1 µM), 0.5 µl forward primer (1 µM), and 1 µl cDNA were added. Then, DDW was added up to a final volume of 13 µl. The real-time PCR program started with an initial denaturation step at 95°C for 2 min. This was followed by 40 cycles of denaturation at 94°C for 5 sec and annealing at 60°C for 35 sec. All reactions were performed in triplicate. The primer specificities of Snord70 and mmu-let-7a-5p were verified through a melting curve analysis and agarose gel electrophoresis. The PCR efficiencies for all primer pairs were calculated in 10-fold serial dilutions of cDNA by plotting the Ct (y-axis) versus log cDNA dilution (x-axis) according to the previous protocol (13).
According to previous studies on mouse blastocyst implantation, Snord70 (also known as snoRNA234), was selected as a suitable reference gene for relative quantification of mmu-let7a-5p (14, 15).
mRNA Targets of mmu-let-7a-5p
We selected experimentally validated mRNA targets of mmu-let-7a-5p using the DIANA-TarBase v8, which provides high-quality manually curated experimentally validated miRNA: gene interactions. According to this database, four transcripts [insulin-like growth factor 1 (Igf1), interleukin 1 alpha (Il1a), integrin beta 3 (Itgb3), and transforming growth factor beta 1 (Tgfb1)] were targeted by mmu-let-7a-5p.
Data Analysis
In order to determine possible associations between the control, sham and treatments, the real time PCR data has been analyzed using "pcr" package in R (4.0.3) software (16). The level of treatment effectiveness is reported as, foldchange, odd ratio and p-value. A two-tailed p-value of < 0.05 was considered statistically significant. Furthermore, rate of embryo development from the 8-cell stage to the blastocyst and also effectiveness of the treatment between the test groups has been statistically analysed using “lsmeans” and “oddratio” packages in R (4.0.3) software through performing logistic regression. The results have been reported as p-value and oddratios. p-value of < 0.05 was considered statistically significant.