Cell lines and cell culture
Colorectal cancer cell lines (HCT116 and SW620) were obtained from the Shanghai Institute of Cell Biology, Chinese Academy of Sciences (Shanghai, China). The cells were maintained at 37°C in a 5% CO2 incubator in McCOY's 5A medium (HCT116) or RPMI-1640 (SW620) supplemented with 10% FBS (Life Technologies). The cell lines were authenticated by Genetic Testing Biotechnology Corporation (Suzhou, China) using short tandem repeat (STR) profiling and routinely tested to exclude mycoplasma contamination.
Generation of SMARCA4 knockout cells
Lentiviral CRISPR/Cas9‐mediated SMARCA4 knockout vectors were constructed by cloning SMARCA4 guide RNA:
sgRNA1 F: 5’‐CACCGTCGCGCTCATCACGTACCTC‐3’;
R: 5’‐AAACGAGGTACGTGCTGAGCGCGAC‐3’;
sgRNA2 F: 5’‐CACCGTCACAGTGTCTGCCGACTGG‐3’;
R: 5’‐AAACCCAGTCGGCAGACACTGTGAC‐3’;
into the BsmBI site of the lentiviral vector LentiCRISPR V2. Lentivirus was produced by packaging in 293T cells. Stable pools of SMARCA4‐KO cells were generated by transducing HCT116 or SW620 cells with lentiviral CRISPR/Cas9 vectors and selected with 4 μg/ml puromycin. Surviving cells were cloned by limiting dilution and then used in experiments after validation by immunoblotting.
Culture of CRC patient-derived organoids
Fresh CRC tissue samples were processed as previously described [30], with several modifications. The tissue was cut into approximately 5 mm pieces, washed with ice-cold PBS at least ten times, and subsequently digested with Gentle Cell Dissociation Reagent (#07174, STEMCELL Technologies) for 60 min at 37°C on a rocking platform set at medium speed (~40 rpm). The cells were centrifuged at 290×g for 5 minutes, and the supernatant was collected. The cell pellet was suspended in Matrigel (#356231, growth factor reduced, Corning) and dispensed into 24-well culture plates (50 μl Matrigel/well). Then, 800 μl of Human Organoid Growth Medium (#06010, STEMCELL Technologies) was added to each well and incubated at 37°C in a 5% CO2 incubator. Media were changed every 2 or 3 days, and cells were passaged after 7-14 days.
Plasmid construction, recombinant protein expression, and purification
pGEX-6p-1 plasmids encoding PRMT1, wild-type or mutant (R1157W, R1157Q, R1243Q) SMARCA4-F4 (aa1009-1314) were transformed into E. coli BL21 and induced with IPTG at 25°C for 16 h. After induction, the bacterial cells were collected by centrifugation, suspended in cold PBS, and lysed by sonication. The GST-fusion proteins were affinity-purified with glutathione-Sepharose beads (GE Healthcare) according to the user’s manual and assessed by SDS–PAGE. The Flag-SMARCA4 full-length coding regions (wild-type or R1157W mutant) were cloned into the eukaryotic expression plasmid pCMV5. The SMARCA4 KO wild-type or mutant rescue plasmids were synonymously mutated in CRISPR/Cas9 sgRNA2 target sequences (CAAAGTGCCGATACAGTA instead of CAGTCGGCAGACACTGTG) and inserted into the lentiviral vector pLVX-IRES-mCherry. All plasmids constructed above were confirmed by DNA sequencing.
Microscale thermophoresis (MST), isothermal titration calorimetry (ITC) assays, and peptide pulldown assays
MST measurements were performed on a NanoTemper Monolith NT.115 (NanoTemper Technologies GMBH) at 60% LED and an MST power of 20%. The purified recombinant SMARCA4-F4 (aa1009-1314) wild-type and R1157W mutant proteins were labeled with NT-647 dyes. The concentration of the labeled proteins was 100 nM in PBS, 0.05% Tween-20, while the concentration of H4R3me2a peptide ranged from 10 nM to 500 μM. Measurements were performed at 25°C. Dissociation constants were calculated by NanoTemper Analysis 1.5.41 software using the mass action equation (Kd formula).
ITC measurements were carried out at 25°C using the MicroCal ITC-200 system (Malvern Instruments Ltd.). The H4R3me2a peptide and proteins were all subjected to extensive dialysis against ITC buffer (20 mM Na3PO4, pH 6.8, 200 mM NaCl, 1 mM TCEP). Peptide at a concentration of 1 mM was placed in the syringe, and proteins at a concentration of 50 μM were loaded into the ITC cell. Following the preinjection, the subsequent 19 injections of sample (2 μl each) were analyzed. The data were further processed using the numerical model implemented in the Origin 7.0 software package (Origin Lab).
Peptide pulldown assays were performed as described previously [31].
RNA isolation and qRT–PCR analysis
Total RNA was extracted from cells using TRIzol reagent (Invitrogen). Synthesis of complementary DNAs (cDNAs) was completed using a HiScript 1st Strand cDNA Synthesis Kit (Vazyme Biotech, China). Quantitative RT–PCR was performed using AceQ qPCR SYBR Green Master Mix (Vazyme Biotech) according to the manufacturer’s protocols. Experiments were performed using a StepOnePlusTM Real-Time PCR System (Thermo Scientific). Relative mRNA levels of target genes were normalized to the expression of the reference gene GAPDH, and each reaction was performed in triplicate. The primer sequences for RT–PCR are listed in Table S2.
Western blot analysis
Cellular proteins were extracted using cell lysis buffer for Western blots (P0013, Beyotime). All proteins were separated by SDS–PAGE, followed by semidry electroblotting onto PVDF membranes (Roche). Primary antibodies against SMARCA4 (ab110641, 1:1000, Abcam), Flag tag (AE005, 1:1000, Abclonal), EGFR (ab52894, 1:1000, Abcam), TNS4 (ab99887, 1:1000, Abcam), GST tag (AE001, 1:1000, Abclonal), SNF5 (#191735, 1:1000, Cell Signaling Technology), ARID1A (#12354, 1:1000, Cell Signaling Technology), ARID1B (#92964, 1:1000, Cell Signaling Technology), BAF57 (#33360, 1:1000, Cell Signaling Technology), and GAPDH (A19056, 1:1000, Abclonal) were used. HRP-conjugated goat anti-rabbit IgG (AS014, 1:10000, Abclonal) and goat anti-mouse IgG (AS003, 1:10000, Abclonal) were used as the secondary antibodies. Blots were exposed to X-ray film after development using High-sig Western ECL Blotting Substrate (Tanon, Shanghai), and the films were scanned as image files using an Epson Perfection V700 Photo Scanner.
Chromatin immunoprecipitation (ChIP) assay
ChIP assays were performed with HCT116 cells as described previously [32]. Normal rabbit IgG (A7016, Beyotime) served as a control. The final ChIP DNAs were analyzed by quantitative real-time PCR with primers that encompassed the promoter region of genes of interest. The primer sequences are listed in Table S3.
CCK8, colony formation and migration assays
Cell proliferation was assessed using the CCK-8 (Vazyme Biotech) assay. Cells were seeded into 96-well plates at a concentration of 1000 cells/well. At different time points (0, 24, 48, and 72 h) following incubation at 37°C, the CCK-8 assay was carried out by adding 10 µl CCK-8 reagent to each well. Cell proliferation was determined by measuring the absorbance at 450 nm using a microplate reader (Safire, TECAN). For the colony formation assay, cells were seeded in triplicate at a density of 1000 cells per well in six-well plates. After culturing for approximately 2 weeks, the colonies were fixed with methanol and stained with 0.1% crystal violet (Sangon Biotech, China). Migration assays were performed with a pore size of 8 µm (Corning, USA) in Transwell chamber. A total of 1×105 cells were seeded into the upper chamber, and medium supplemented with 20% FBS was added to the bottom chamber. After incubation for 24 h, the cells remaining on the upper surface that did not pass through the membranes were removed carefully with a cotton swab. Cells that migrated through the membranes were fixed in 100% methanol for 10 min, stained with 0.1% crystal violet for 15 min and washed with PBS. Values for migration were evaluated by counting five fields per membrane under a microscope (Nikon) at 100× magnification.
ATPase assays and nucleosome sliding assays
The ATPase assays were performed as described previously with modifications [33]. The 20 μl reactions contained 50 mM Tris (pH 7.5), 50 mM NaCl, 8 mM MgCl2, 0.5 mM PMSF, 2 mM ATP, 2 mM DTT, and 1 μg of a 1 kb DNA fragment. The reaction was initiated by adding 1 μl of 10 mCi/ml [γ-32P] ATP (3000 Ci/mmole; PerkinElmer) and 1 μg of SMARCA4 wild-type or mutant proteins. The reactions were then incubated at 30°C for the indicated times (0, 15, 30, 60, 90 min) and were stopped by the addition of 5 μl of 500 mM EDTA. One microliter of the reaction mixture was spotted onto PEI-cellulose TLC plates (Merck), and chromatography was run in 0.5 M LiCl, 1 M formic acid. The ratio of inorganic phosphate to ATP at each time point was quantified using a Molecular Dynamics Phosphorimager (Amersham Biosciences) and ImageQuant TL software.
The nucleosome sliding assay was performed as previously described with several modifications [34, 35]. A 255 bp DNA template from the Widom 601 positioning sequence [36] was assembled into mononucleosomes by the “salt jump” method in the presence of core histones isolated from HeLa cells[37]. Mononucleomes (100 ng DNA) were incubated with wild-type or mutant SMARCA4 proteins (100 ng) in 40 μl reactions containing 20 mM HEPES-NaOH (pH 7.9), 50 mM MgCl2, 1 mM DTT, 0.1 mM PMSF, 0.1 mg/mL BSA, 3% glycerol, 0.02% NP-40, 0.02% Triton X-100, 2 mM ATP at 30°C for 0, 30, 60, or 90 min. Reactions were quenched by the addition of 20 mM EDTA and 1% glycerol. Samples were resolved by 6% native polyacrylamide/0.5×TBE gel electrophoresis and visualized by SYBR green staining (Invitrogen).
DNase I chromatin accessibility analysis
The DNase I chromatin accessibility assay was performed as previously described [38, 39]. The isolated chromatin was digested with DNase I (NEB) at 3 U/100 µL for 8 min at room temperature. DNA was lightly sonicated (10 cycles of 30 s on/20 s off) using a Bioruptor Plus (Diagenode). The purified DNA was used for qRT–PCR, and the results were analyzed according to the formula 100/2Ct (DNase I) − Ct (no DNase I). The primer sequences for qRT–PCR are listed in Table S4.
In vivo drug studies
To establish cell line-derived xenograft (CDX) mouse models, 6-week-old BALB/c female nude mice were obtained from the Model Animal Research Center of Nanjing University (Nanjing, China). All animal experimental procedures were approved by Animal Ethical and Welfare Committee of Nanjing University. Approximately 5×106 SMARCA4 wild-type or R1157W mutant HCT116 cells were injected subcutaneously into the right flank of each mouse. The mice were randomized into 4 groups (6 mice/group) when the tumor volume reached approximately 80 mm3 (volume= 0.52 × length × width2), at which point drug dosing every day was initiated. GSK-PTi (GSK3368715, HY-128717A, MCE) [40] and BBAi-1 (BRM/BRG1 ATP inhibitor-1, HY-119374, MCE) [41] were dissolved in 10% DMSO, 90% saline (containing 20% SBE-β-CD). GSK-PTi (25 mg/kg) and BBAi-1 (2.5 mg/kg) were administered orally. Body weight and tumor volume of the mice were measured every two days. Treatments were continued for 14 days, after which all mice were euthanized for analysis. Tumor tissues were weighed and prepared for immunoblotting or immunohistochemical staining. Tumor growth inhibition (TGI) rate was measured using the formula: TGI (%) = [1 − (Vt − V0 in treated group)/Vt − V0 in vehicle group)] × 100 where Vt is the volume on each day and V0 is the volume at the beginning of the treatment.
Clinical samples and immunohistochemistry (IHC)
Fresh, matched CRC tissues and adjacent normal tissues used for biological analyses and organoid establishment were obtained from Jiangsu Province Hospital of Chinese Medicine (Nanjing, China). All patients gave written informed consent for participation in this study. The study on fresh clinical samples was approved by the ethics committee of Jiangsu Province Hospital of Chinese Medicine.
IHC was performed by Nanjing Microworld Biotechnology Co., Ltd. using paraffin-embedded, formalin-fixed tumor tissues removed from the tumor-bearing nude mice at the end of the study. Sections were incubated with antibodies specific for PRMT1 (Proteintech, 11279-1, 1:100), H4R3me2a (PTMBio, PTM667, 1:100), EGFR (Abcam, ab52894, 1:200), TNS4 (Abcam, ab99887, 1:200) and SMARCA4 (Abcam, ab110641, 1:100). Immunocomplexes were visualized using a 2-Solution DAB Kit (Invitrogen).
Combination inhibitor treatment for synergy in vitro
HCT116 and SW620 cells were treated with GSK-PTi, BBAi-1, or a combination of GSK-PTi and BBAi-1 for 6 days in 96-well plates, and cell viability was measured by CCK-8 assay. To determine the presence of a possible synergistic effect of GSK-PTi and BBAi-1, combination index (CI) was calculated by CompuSyn Version 1.0 software. CI < 0.85 indicates synergy, and CI > 1.2 indicates antagonism.
Statistical analysis
All experiments were performed in triplicate, and the results are presented as the mean ± standard deviation, unless otherwise indicated. Statistical analyses were conducted using GraphPad Prism 7.0 software (GraphPad Software, San Diego, CA, USA). Significant differences between two groups were evaluated using two-tailed independent Student’s t-tests or Fisher’s exact test. P < 0.05 was considered significant.