Functional characterization of glycine oxidase from Bacillus licheniformis in Escherichia coli and transgenic plants

doi:10.21203/rs.3.rs-1826509/v1

Download PDF

Research Article

Functional characterization of glycine oxidase from Bacillus licheniformis in Escherichia coli and transgenic plants

https://doi.org/10.21203/rs.3.rs-1826509/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 02 Jan, 2023

Read the published version in Biotechnology Letters →

You are reading this latest preprint version

Objectives

To find glycine oxidase genes that can be applied to the breeding of glyphosate resistant crops.

Results

The GO gene was chemically synthesized and transformed into glyphosate-sensitive Escherichia. coli (E.coli). The GO gene was transformed into Arabidopsis and Rice through Agrobacterium-mediated transformation. The test results confirmed that transgenic plants containing GO genes are more resistant to glyphosate than wild-type plants. On solid MS medium containing 200µM glyphosate, transgenic Arabidopsis thaliana grew normally, while wild-type plants were stunted and root growth was restricted. In a solution containing 500 µM glyphosate, wild-type Rice showed severe yellowing, while transgenic Rice grew normally. In addition, when sprayed with 10mM glyphosate solution, wild-type rice withered and died, while transgenic rice grew well. The function of GO gene to glyphosate resistance and the application value of GO gene in the cultivation of glyphosate resistant crops are proved.

Conclusions

The glycine oxidase gene from Bacillus licheniformis enhances the resistance of E. coli, Arabidopsis and Rice to glyphosate.

Bacillus licheniformis

Glycine oxidase

Glyphosate resistance

Transgenic plants

Glyphosate has been used extensively on glyphosate-resistant crops as a broad-spectrum weed control agent. According to statistics in 2015, planting area of glyphosate-resistant crops accounted for half of the global genetically modified crops (Du 2020). Most of the grown transgenic glyphosate-resistant crops get the resistance through overexpressing EPSPS isolated from Agrobacterium sp. CP4, or a variant of EPSPS, as well as a mutated maize EPSPS. The theoretical disadvantage of this approach is that glyphosate remains in the plant and crop yield (Li and Cao 2018). Neither of glyphosate detoxification mechanisms has been shown to occur in higher plants to a significant degree (Pollegioni et al. 2011).

Another strategy is to introduce glyphosate degrading enzymes to degrade glyphosate into non-toxic products. Glycine oxidase (GO, EC 1.4.3.19) was cloned from Bacillus subtilis in 1998. GO can convert glyphosate into aminomethyl phosphonic acid (AMPA) and glyoxylate by cutting the carbon–nitrogen bond. These two substances are much less toxic than glyphosate. Predecessors (Pedotti et al. 2009) improved the catalytic ability of GO gene to the substrate glyphosate through rational protein design. The research results showed that the GO gene obtained by artificial evolution has good catalytic activity against glyphosate, which provides a mechanism for glyphosate resistance. Zhang et al. (2013) cloned the glycine oxidase gene from Bacillus cereus, and directed evolution to obtain a mutant with higher catalytic efficiency for glyphosate. Yao et al. (2015) improved the activity of B3S1 (GO from Bacillus cereus) through DNA shuffling, and the specific constant of mutant B4S7 increased by 3.9 times. The development of glyphosate-tolerant crops provides new information. These studies show that GO genes have more potential for glyphosate resistance.

To our knowledge there are no published reports of GO enzymes from Bacillus licheniformis. Therefore, the wild type GO gene (GenBank No: KC831746.1) from Bacillus licheniformis was chemically synthesize and transformed into glyphosate-susceptible E. coli to detect GO-imparted resistance. Furthermore, in order to evaluate its potential, we also transformed the gene into Arabidopsis and Rice, and demonstrated that transgenic plants exhibit significant glyphosate resistance when compared with the wild type.

Test strains, chemical reagents and plant materials

Glyphosate (acid-free form) was purchased from Sigma adrich (St. Louis, Missouri, USA). RNA isolation and Reverse Transcription System kit were purchased from Axygen Co. (China). E. coli strain DH5α, pYPX251 (p251) vector (GenBank No: AY178046), pCAMBIA1301 (GenBank No: AE234297) vector, and Agrobacterium tumefaciens GV3101, Arabidopsis (ecotype Columbia L.), Rice (zhonghua 11) were all prepared and maintained in our laboratory.

Design and chemical synthesis of GO gene of Bacillus licheniformis

According to the sequence on NCBI, GO gene have been synthesized by continuous polymerase chain reaction (PCR) method (Peng et al. 2006). PCR was carried out as described as Tian et al. (2011) (see primers in Supplementary Table 1). The amplified fragment was digested by BamHI and SacI, cloned into Simple pMD-18 and sequenced (Xu et al. 2010). Errors in the synthetic gene were corrected by the overlap extension PCR method(Xiong et al.2006).

In vitro glyphosate sensitivity assays

The wild GO gene was inserted into the BamHI-to-SacI site of p251. Recombinant p251 was transformed into DH5α to determine the gene resistance to glyphosate. Empty p251 was transformed into DH5α as a control. Two types of transformants were spread on M9 solid medium containing different glyphosate concentrations, and the DH5α strain carrying the empty vector plasmid was used as a control. At the same time, the positive transformants were also grown in liquid M9 medium to determine glyphosate resistance(Sun et al. 2005).

Plant expression vector construction and plant transformation

The Arabidopsis expression vector was constructed and transformed according to the description of Xu et al. (2010), and some modifications were made. A chloroplast transit sequence was added to the constructs to ensure the GO gene was targeted to the chloroplast. The DNA fragment encoding the chloroplast transit peptide (TSP) of Arabidopsis was amplified (primers were: 5’- GTCGACATGGCGCAAGTTAGCAGAATC-3’ and 5’-GGATCCCTCCGCCGT GGAAACACAAGAC-3’). The recombinant plasmid, D35S:TSP:GO:Nos was transformed into Agrobacterium GV3101 by electroporation, and subsequently transformed into Arabidopsis by a floral dip method.

Construction of the vector expressed in Rice was performed as described as above. The recombinant plasmid was introduced into Agrobacterium EHA105 by electroporation. Transgenic plants were obtained according to the method described by Tian et al. (2011).

Selection and RT-PCR detection of transgenic plants

After preliminary screening of hygromycin, the positive Arabidopsis and Rice plants were carried for two more generations in order to obtain homozygous transgenic plants. The homozygous transgenic plants were further confirmed by RT-PCR analysis. The cDNA obtaining of the GO gene and RT-PCR were performed as Zhu et al. described previously (2012). To improve the reliability of RT-PCR, the Arabidopsis actin gene, AtAc2 (GenBank No: NM12764) with the primers: 5’-GCACCCTGTTCTTCTTACCGAG-3’ and 5’-AGTAAGGTCACGTCCAGCAAGG-3’, and Rice actin gene (GenBank No: X16280) with primers 5′-TCCATCTTGGCATCTCTCAG-3′ and 5′-GTACCCGCATCAGGCATCTG-3′ were used as the internal standard. The GO gene fragment (300bp) was amplified by specific primers: 5′- GGATCCATGAGAAAGCGCTATGATACGATC − 3′ and 5′-- GAGCTCACCTGTGCACAGCCTCCTTTCG − 3′.

The glyphosate resistance of transgenic plants and measurement of chlorophylls content

Glyphosate resistance analysis was performed as Han et al. described (Han et al.2015). The plump wild-type (WT) and transgenic seeds were disinfected and sowed on solid MS medium containing 0, 200µM glyphosate, and grown for 12d. In order to study the stress of glyphosate on wild-type Arabidopsis and transgenic Arabidopsis, the total chlorophyll content was determined on the 20th day of Arabidopsis growth.

After accelerating germination under 37℃ for 24h in dark, uniformly-growing ones of Wild type and transgenic plants of Rice were transformed into solution containing 0, 250, and 500µM glyphosate, and grown for 7d. For glyphosate spray treatment of transgenic Rice, plants were cultured in a nutrient solution culture in a controlled-environment chamber (25°C, 16h light/8h dark cycle). After 3 weeks, the seedlings reaching 12–15 cm in height were sprayed with 10mM herbicide glyphosate at a dose of 2 mL/100 cm².

Chemical synthesis and sequence analysis of the full-length cDNA of GO gene

The gene was chemically synthesized using primers according to the original sequence. PCR amplification of the entire open reading frame of GO generated a single band of 1110 bp encoding a protein of 369 amino acids. DNA sequencing revealed some errors in the synthetic gene compared with the native gene (GenBank No: KC831746.1), which were corrected by overlap extension PCR.

In vitro glyphosate sensitivity assays

DH5α cells transformed with empty p251 plasmid were fully inhibited on M9 plates containing 200mM glyphosate. However, DH5α cells transformed with p251-GO plasmid were much less inhibited and grew well on 200mM glyphosate plates(Fig. 1).

The growth curves of E. coli DH5α harboring either p251 or p251-GO are shown in Fig. 2. After 24 h of incubation, the growth of cells harboring p251 was strongly inhibited (> 95%) by 200 mM glyphosate, whereas the OD of cultures harboring p251-GO was approximately 37% of the control values without glyphosate.

Plant transformation and RT-polymerase chain reaction detection

Expression cassettes comprising a double CaMV35S promoter, chloroplast transit sequence, and GO coding region were cloned into the T-DNA region of a binary vector (Fig. 3a). Through hygromycin screening, we have obtained 25 independent transgenic plant lines. And three overexpression lines (named Go1, Go3, and Go7) were chosen for further experiments.

RT-PCR was performed to examine the transcript levels of the GO gene. In the T2 generation, the expression levels of GO mRNA were high in the three overexpression lines. Furthermore, the transcript was not detected in the wild-type plants (Fig. 3b, c). No obvious effects on growth and development were observed in GO transgenic plants under normal growth conditions.

Glyphosate resistance analysis of transgenic Arabidopsis plants

Wild-type and transgenic plants grew the same on a control medium without glyphosate; on a medium containing 200µM glyphosate, transgenic Arabidopsis thaliana developed normally, while wild-type Arabidopsis developed stunted and restricted root growth (Fig. 4; Fig. 5). Previous studies have shown that sublethal concentrations of glyphosate cause chlorotic symptoms in the leaves of transg-enic tobacco expressing OsEPSPs gene (Zhou et al. 2006). Therefore, measuring the total chlorophyll content of Arabidopsis 20d of growth (the leaves of wild-type Arabidopsis showed slight yellowing), the chlorophyll content of the transgenic line was higher than that of the wild-type Arabidopsis (Fig. 6). These results indicate that the transgenic Arabidopsis showed higher resistance to glyphosate than the wild-type Arabidopsis.

Glyphosate resistance analysis of transgenic Rice plants

We have gotten 33 independent transgenic plant lines of Rice. And three overexpression lines (named Gor3, Gor8, and Gor21) were chosen for glyphosate resistant experiments. It was found that WT and transgenic plants grew identically in the solution without glyphosate. In the solution containing 250µM glyphosate, the growth of control plants were inhibited, however, transgenic plants displayed minimal signs of phytotoxic effects, showing normal development. At 500µM glyphosate, the wild-type Rice almost died with severe etiolation (Fig. 7).

As shown in Fig. 8, after spraying to leaves of four week old Rice plants three times with 10 mM glyphosate, most of the leaves of the wild-type Rice plants wilted, became overly dehydrated and then died. Only some leaves of the transgenic plants and others grew well with normal morphology.

While the herbicide-resistant genetically modified crops bring huge benefits to agricultural production, their safety has also aroused people’s concerns (Vicini et al.2019. The resistance genes of existing commercial crops are mainly existing commercial glyphosate-resistant crops, employing a microbial (Agrobacterium sp. CP4) or a mutated (TIPS) form of EPSPs that is not inhibited by glyphosate (Ye et al. 2010). This mechanism does not eliminate or degrade glyphosate. Therefore, it will become very meaningful to find a new gene source that can degrade glyphosate. The GO gene has entered people's field of vision because of its substrate with a molecular structure similar to that of glyphosate. Unfortunately, there is no endogenous GO in plants, so it is necessary to transfer exogenous GO genes to achieve the goal. GO gene can degrade glyphosate into AMPA and glyoxylic acid, reducing glyphosate residue. Unfortunately, there is no endogenous GO in plants, so it is necessary to introduce exogenous GO genes to achieve the goal. For example, Lu (2011) used a metagenomic library to screen for herbicide degradation genes and obtained the glycine oxidase gene (GOA, Genbank accession number: GU479460). The gene has good substrate affinity and substrate selectivity for glyphosate. Zhang et al (2016) cloned glycine oxidase from Bacillus licheniformis and improved the catalytic activity of glyphosate through error-prone PCR and two rounds of DNA shuffling. In addition, the glyphosate oxidase is obtained through directed evolution of glycine oxidase and coupled with spore-luminol, which improves the sensitivity and high selectivity of glyphosate detection (Qin et al 2020). These studies have shown the degradation efficiency of the GO gene to glyphosate.In order to make the GO gene more resistant to glyphosate in plants, we chemically synthesized the GO gene from Bacillus licheniformis. On this basis, the GO gene was optimized for plants preferentially, which was mediated by Agrobacterium. The GO gene was transferred into Arabidopsis and Rice, and the transgenic lines were identified and screened by hygromycin (30mg/ml), PCR detection and glyphosate resistance analysis. Obtained overexpression transgenic glyphosate resistant Arabidopsis lines (Go1, Go3 and Go7) and Rice lines (Gor3, Gor8 and Gor21). The results confirmed that the obtained transgenic lines showed high resistance to glyphosate, and the chlorophyll content of transgenic Arabidopsis was significantly higher than that of wild-type Arabidopsis (Fig. 6). Especially in the later stages of development, transgenic Arabidopsis has a longer root system, stronger leaves and better development (Fig. 4; Fig. 5). In addition, genetically modified Rice also has the same performance. Under high-concentration glyphosate (10mM) spraying, most of the wild-type Rice withered and died, while the transgenic Rice planted leaves grew well and developed normally (Fig. 7; Fig. 8). These results indicate the function of GO gene for glyphosate resistance, and the selected lines can provide materials for the next step of research.

Acknowledgments

This work was supported by Shanghai Municipal Agricultural System Youth Talent Growth Plan (2016, 1-30); Shanghai Academic Technology Research Leader (20XD1432200; 19XD1432300).

Competing Interests

The authors declare that they have no conflict of interest.

Author contributions

HHJ, FJZ, GHLand QQL conceived or designed research. HHJ and FJZ conducted experiments and analyzed data. HHJ and FJZ wrote the paper. All authors read and approved the manuscript.

Ethics approval

This article does not contain any studies with human participants or animals performed by any of the authors.

Du S (2020) Genetic transformation and resistance evaluation of glyphosate resistance gene in Brassica napus L. Dissertation, University of Huazhong Agricultural
Han HJ, Zhu B, Fu XY, Tian YS et al (2015) Overexpression of D-amino acid oxidase from Bradyrhizobium japonicum, enhance resistance to glyphosate in Arabidopsis. Plant Cell Rep 34(12):2043–2051
Lu Y (2011) Cloning of herbicide-degradation genes from soil metagenomic libraries. Dissertation, University of Jilin
Liu F, Cao YP (2018) Expression of the 5-enoylpyruvylshikimate-3-phosphate synthase domain from the Acremonium sp. aroM complex enhances resistance to glyphosate. Biotechnol Lett 40:855–864. https://doi.org/10.1007/s10529-018-2529-0
Nishiya Y, Imanaka T (1998) Purification and characterization of a novel glycine oxidase from Bacillus subtilis. FEBS Lett 438(3):263–266. https://doi.org/10.1016/S0014-5793(98)01313-1
Pline WA, Ryan Viator R, John W, Wilcut JW, Wells R (2002) Reproductive abnormalities in glyphosate-resistant cotton caused by lower CP4-EPSPS levels in the male reproductive tissue. Weed Sci 50(4):438–447. https://doi.org/10.1614/0043-1745(2002)050 [0438:RAIGRC]2.0.CO;2
Peng RH, Xiong AS, Yao QH (2006) A direct and efficient page-mediated overlap extension pcr method for gene multiple-site mutagenesis. Appl Microbiol Biotechnol 73(1):234–240. https://doi.org/10.1007/s00253-006-0583-3
Pedotti M, Rosini E, Molla G, Moscheti T et al (2009) Glyphosate resistance by engineering the flavoenzyme glycine oxidase. J Biol Chem 284(52):36415–36423. https://doi.org/10.1074/jbc.M109.051631
Pollegioni L, Schonbrunn E, Siehl D (2011) Molecular basis of glyphosate resistance–different approaches through protein engineering. FEBS J 278(16):2753–2766. https://doi.org/10.1111/j.1742-4658.2011.08214.x
Qin Y, Wu G, Guo Y, Ke D, Hu Y (2020) Engineered glyphosate oxidase coupled to spore-based chemiluminescence system for glyphosate detection. Anal Chim Acta 1133:39–47. https://doi.org/10.1016/j.aca.2020.07.077
Rey MW, Ramaiya P, Nelson BA, Shari DB et al (2004) Complete genome sequence of the industrial bacterium Bacillus licheniformis and comparisons with closely related bacillusspecies. Genome Biol 5(10):R77. https://doi.org/10.1186/gb-2004-5-10-r77
Sun YC, Chen YC, Tian ZX, Li FM et al (2005) Novel aroa with high tolerance to glyphosate, encoded by a gene of pseudomonas putida 4g-1 isolated from an extremely polluted environment in china. Appl Environ Microbiol 71(8):4771–4776. https://doi.org/10.1128/AEM.71.8.4771-4776.2005
Tian YS, Xu J, Xiong AS, Peng RH et al (2011) Improvement of glyphosate resistance through concurrent mutations in three amino acids of the ochrobactrum 5-enopyruvylshikimate-3-phosphate synthase. Appl Environ Microbiol 77(23):8409–8414. https://doi.org/10.1128/AEM.05271-11
Vicini JL, Reeves WR, Swarthout JT, Karberg KA (2019) Glyphosate in livestock: feed residues and animal health. J Anim Sci 97(11):4509–4518. https://doi.org/10.1093/jas/skz295
Xiong AS, Yao QH, Peng RH, Duan H et al (2006) Pcr-based accurate synthesis of long dna sequences. Nat Protoc 1(2):791–797. https://doi.org/10.1038/nprot.2006.103
Xu J, Tian YS, Peng RH, Xiong AS et al (2010) Atcpk6, a functionally redundant and positive regulator involved in salt/drought stress tolerance in Arabidopsis. Planta 231(6):1251–1260. https://doi.org/10.1007/s00425-010-1122-0
Ye GN, Hajdukiewicz P, Broyles D, Rodriguez D, Xu CW, Nehra N, Staub JM (2010) Plastid-expressed 5-enolpyruvylshikimate – 3-phosphate synthase genes provide high level glyphosate tolerance in tobacco. Plant J 25(3):261–270. https://doi.org/10.1046/j.1365-313x.2001.00958.x
Yao P, Lin Y, Wu G, Lu Y et al (2015) Improvement of glycine oxidase by DNA shuffling, and site-saturation mutagenesis of F247 residue. Int J Biol Macromol 79:965–970. https://doi.org/10.1016/j.ijbiomac.2015.05.030
Zhou M (2006) Identification of a glyphosate-resistant mutant of Rice 5-enolpyruvylshikimate 3-phosphate synthase using a directed evolution strategy. Plant Physiol 140(1):184–195. https://doi.org/10.1104/pp.105.068577
Zhu B, Peng RH, Fu XY, Jin XF et al (2012) Enhanced transformation of TNT by Arabidopsis plants expressing an old yellow enzyme. PLoS ONE 7(7):e39861. http://doi.org/10.1371/journal.pone.0039861
Zhan T, Zhang K, Chen YY, Wu G, Zhang L, Yao P, Shao Z, Liu Z et al (2013) Improving glyphosate oxidation activity of glycine oxidase from Bacillus cereus by directed evolution. PLoS ONE 8(11):e79. https://doi.org/10.1371/journal.pone.0079175
Zhang K, Guo YM, Yao P, Lin Y, Kumar A, Liu Z, Wu G, Zhang L (2016) Characterization and directed evolution of BliGO, a novel glycine oxidase from Bacillus licheniformis. Enzyme Microb Technol 85:12–18. https://doi.org/10.1016/j.enzmictec.2015.12.012

SupplementaryTable.docx

Download PDF

Journal Publication

published 02 Jan, 2023

Read the published version in Biotechnology Letters →

Editorial decision: Major revisions
20 Sep, 2022
Reviewers agreed at journal
19 Aug, 2022
Reviewers invited by journal
13 Jul, 2022
Editor assigned by journal
06 Jul, 2022
First submitted to journal
05 Jul, 2022

You are reading this latest preprint version

Functional characterization of glycine oxidase from Bacillus licheniformis in Escherichia coli and transgenic plants

Status:

Journal Publication

Version 1

Abstract

Figures

Introduction

Materials And Methods

Results

Discussion

Declarations

References

Supplementary Files

Status:

Journal Publication

Version 1