Microarray datasets and online tools used for integrated bioinformatic analysis. Four human NSCLC mRNA expression datasets were downloaded from the Gene Expression Omnibus database (GEO, https://www.ncbi.nlm.nih.gov/geo/). Detail information of samples was shown as follows: GSE19804: tumor (60 cases) and adjacent normal lung tissue specimens (60 cases) obtained from nonsmoking female non-small cell lung carcinoma (NSCLC) patients in Taiwan. GSE18842: NSCLC samples (46 cases) and control tissues (45 cases). GSE27262: tumor and adjacent normal tissue pairs from 25 stage I lung adenocarcinoma patients. GSE43458: never-smoker adenocarcinomas (40 cases) and never-smoker controls (30 cases). The microarray data of GSE19804, GSE18842, GSE27262 was based on Affymetrix Human Genome U133 Plus 2.0. Data of GSE43458 was based on Affymetrix Human Gene 1.0 ST Array. GEO2R was used to identify DEGs between NSCLC tissues and normal samples. Heat maps were drew by HemI. Venn Diagram showed the intersections of DEGs obtained from different datasets ( http://bioinfogp.cnb.csic.es/tools/venny/index.html/). Gene expression profiles among 59 normal lung tissue cases and 533 NSCLC samples were downloaded from The Cancer Genome Atlas (TCGA, https://cancergenome.nih.gov/). Data from GTEx (The Genotype-Tissue Expression Project) were obtained using online Gene Expression Profiling Interactive Analysis (GEPIA, http://gepia.cancer-pku.cn/). mRNA expression levels of SPINK1 in normal and tumor tissues among different cancers were analysed by In Silico Transcriptomics online databases (IST, http://ist.medisapiens.com/). Functional enrichment analysis of the DEGs, including Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analyses were accomplished by an online tool ( http://www.funrich.org/ ).
ELISA. Serum of 20 normal controls, 38 NSCLC patients, and 11 pleural effusion of NSCLC patients in Chongqing Hospital of Traditional Chinese Medicine during 2018.02-2018.06 were collected. This study was conducted in accordance with the principles of good clinical practice and apporved by the Ethics Committee of Chongqing Medical University. SPINK1 concentrations were detected by ELISA (BOSTER,EK1241) according to the reference manual.
Cell culture. Normal human bronchial epithelial cell line HBE, human non-small cell lung cancer cell line H1299, human squamous cell carcinoma cell line SK-MES-1 and human large cell lung cancer cell line H460 were maintained in complete culture medium (RPMI 1640 with 10% fetal bovine serum (FBS), 100 units/mL penicillin, and 100 µg/mL streptomycin). Human non-small cell lung cancer cell line A549 were routinely cultured with F-12K medium (10% FBS). All cell lines were grown at 37 °C in an atmosphere with 5% CO2. Cell number were determined using a Neubauer hemocytometer.
RNA interference and exogenous addition of SPINK1. Small interfering RNAs targeting SPINK1 and the negative control were obtained from TSINGKE (Shanghai, China). The target sequences were as follows:
si-NC: 5’-TTCTCCGAACGTGTCACGT-3’;
si-SPINK1-1: 5’-GCCAGACUUCUAUCCUCAUTT-3’. Cells were seeded in corresponding culture plates and cultured with antibiotics-free medium overnight. Next day the growth medium was removed and cells were transfected with siRNAs (50 nM) using Lipofectamine 2000 (Invitrogen) according to the manufacturer's protocol when cell density was increased to 50–70%. rhSPINK1 was purchased from R&D (#7496-PI-010).
RNA extraction and quantitative real-time PCR. Total RNA was extracted using IsoPlus reagent (Takara Bio, Japan) following the manufacturer’s protocol and then 1 µg RNA was reverse transcribed with random primers using a PrimeScript™ RT reagent Kit (Takara Bio, Japan). cDNA was amplified using SYBR green master mix (TaKaRa Bio, Japan) on an ABI 7500 Fast RealTime PCR system
(Sigma-Aldrich, St. Louis, MO, USA). GAPDH was amplified as an internal reference. Primers were as follows:
SPINK1-F, TGTGTGT GGGACTGATGGAA;
SPINK1-R,AGGCCCAGATTTTTGAATGA;
GAPDH-F,ACGGCAAATTCAACGGCACAGTCA; GAPDH-R,TGGGGGCATCGGCAGAAGG.
Viability assay. The Cell Counting Kit-8 (CCK-8) assay was employed to quantify the vitality of cells. Cells were seeded into 96-well plates at a concentration of 2 × 104 cells/mL and cultured with antibiotics-free medium overnight. The next day cells were transfected with siRNA (50 nM). Then 10 µL CCK8 reagent (Solarbio, China) were added to each well at 0, 24, 48, and 72 hours respectively. Cells were incubated for 2.5 hours in the dark at 37 °C. The absorbance at 450 nm was measured by Biotek reader (ELx800, USA).
Growth curve. 2 × 104 A549 cells were seeded into 24-well plates and transfected with si-NC and si-SPINK1-1 (50 nM). Total numbers of cells were determined by trypsinization and cell counting using a Neubauer hemocytometer at 0 h, 48 h,72 h and 96 h post transfection.
Flow cytometric analysis of cell cycle distribution. 3 × 105 cells were seeded in six-well plates and treated with siRNAs (50 nM) as described perviously. Cells were collected by trypsinization at 48 hours after transfection and washed with cold PBS followed by fixation in 70% ethanol for 12 hours at -20℃. After washing with PBS for three times, cells were incubated in PBS with 0.1 mg/mL RNase (Solarbio, China) at 37 °C for 30 minutes. Then, cells were stained with PI (25 µg/ml, Sigma, USA) in the dark for 10 minutes. The stained nuclei were counted by flow cytometry and the cell cycle profile was analysed by the FlowJo software.
Flow cytometric analysis of apoptosis. 1.5 × 105 cells were seeded in 12-well plates and transfected with corresponding siRNAs (50 nM) as described previously. Change culture medium with serum-free culture medium supplemented with 0.3% BSA 24 h post transfection. Total cells were collected by trypsinization at 60 hours after transinfection and washed with cold PBS for twice. Collected cells were double stained with FITC-Annexin V and PI using FITC Annexin V Apoptosis Detection Kit (BD Biosciences) according to the protocols. The stained cells were analyzed by BD FACSJazz flow cytometer (BD Biosciences), and the data was analyzed using Cell Quest software (BD Biosciences).
Western blot. Total protein was extracted using radioimmunoprecipitation assay (RIPA) lysis buffer (Beyotime, China) supplemented with 1 mM PMSF (Beyotime, China) and phosphatase inhibitor cocktail A and B (Beyotime, China), quantified using the Enhanced BCA Protein Assay Kit (Beyotime, China), and denatured by boiling with SDS-PAGE Sample Loading Buffer (Beyotime, China) for 10 minutes. Protein samples (40 µg) were separated by 12% SDS-PAGE, and transferred onto polyvinylidene difluoride (PVDF, 0.20 µm) membranes (Millipore, Bedford, MA). The membranes were blocked with 5% bovine serum albumin in Tris-buffered saline containing 0.1% Tween-20 at 37℃ for 2 h and then incubated with primary antibodies at 4℃ overnight. The primary antibodies were as follows : SPINK1 (sc-37440, 1:500, Santa Cruz, CA ), GAPDH (#5174, 1:8000, CST, USA); p-MEK1/2 (#2338, 1:1000, CST, USA); MEK1/2 ( #8727, 1:1000, CST, USA); pERK (#4370, 1:1000, CST, USA); Erk1/2 (#9102, 1:1000, CST, USA); pPI3K (#4228, 1:500, CST, USA); PI3K (#4292, 1:800, CST, USA); pAkt (Ser473)(#4060, 1:500, CST, USA); Akt (#4691, 1:800, CST, USA); LC3 (#12741, 1:1000, CST, USA); P62 (#3912, 1:1000, CST, USA); ATG7 (#8558, 1:800, CST, USA); CDK4 (#12790, 1:1000, CST, USA); Bax (#5023, 1:1000, CST, USA); BCL2 (#196495, Abcam, USA). The membranes were washed for 30 minutes with TBST and subsequently incubated with the corresponding secondary antibody (#656120, HRP goat anti rabbit, 1:10000, Invitrogen; #A32723, HRP goat anti mouse, 1:10000, Invitrogen) for 1 h at 37℃. Membranes were then washed another three times for 30 minutes with TBST. Protein bands were visualized using Super Signal electrochemiluminescence (#34580, Thermo Scientific) and quantitated with image Pro Plus 6.0, and the data were normalized to GAPDH.
Statistical analysis. Data represent three independent experiments and are presented as mean ± SD (n = 3). GraphPad Prism software (version 5.01) was applied for statistical analysis. Unpaired t tests were used for data with a normal distribution. Differences with p < 0.05 were considered statistically significant.*P < 0.05; **P < 0.01; ***P < 0.001.