Ethical approval
This research conforms to and acts in accordance with the Enhancing the QUAlity and Transparency Of health Research (EQUATOR) guidelines (http://www.equatornetwork.org/). All fresh human tissue specimens were collected with informed consent on the basis of the request of the Ningbo First Hospital Scientific Research Ethics Committee from December 2018 to August 2019.
Human tissue collection
Chinese-Han fresh ovarian tissue specimens, including benign ovarian tumour specimens (BOTs, n=55) from patients who underwent laparoscopic surgery and epithelial ovarian carcinoma (EOC, n=63) and relevant contralateral normal ovarian tissue (CNOs, n=41) specimens from patients who underwent surgery for pathologically confirmed epithelial ovarian carcinoma, were collected from the Department of Gynaecology and Obstetrics (Ningbo First Hospital) from October 2018 to August 2019 for protein and mRNA testing. The relevant contralateral normal ovarian tissues were obtained from the noninvaded ovary on the contralateral side. According to the 2014 classification of the International Federation of Gynaecology and Obstetrics (FIGO), carcinoma patients were in stage I to IV. None of the patients were cured with any neoadjuvant chemotherapy or targeted therapy before radical operation.
Cell culture
The human EOC cell line A2780 was purchased from Guangzhou Jennio Biotech Co., Ltd. and maintained in cell culture. Cells were cultured with DMEM (Gibco) containing 10% foetal calf serum (HyClone, USA) and double antibiotics (100 μg/ml streptomycin and 100 Units/ml penicillin) (HyClone). The cells were incubated in a humidified atmosphere with 5% CO2 at 37°C. The cell lines were authenticated.
T-cadherin is overexpressed in EOC cell lines
The pcDNA3.1 and pcDNA‑T‑cadherin (pcDNA‑T‑cad) plasmids were purchased and transfected into A2780 cell lines using Lipofectamine® 2000 according to the manufacturer's instructions. After 48 h of transfection, T‑cadherin expression was detected by Western blotting.
Expression levels of the T-cadherin gene in ovarian tissues and cell lines were analysed by qRT-PCR
Total RNA levels in tissues or cultured cells were measured by real-time RT-PCR via the SYBR Green fluorescence signal detection kit according to the manufacturer's protocol. cDNA was amplified by qPCR as previously described[15]. Gene expression was normalized by endogenous housekeeping gene GAPDH level. The primer pair sequences for human T-cadherin were as follows: 5'‑TTCAGCAGAAAGTGTTCCATAT‑3' (forward) and 5'‑GTGCATGGACGAACAGAGT‑3' (reverse). The human glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene was used as an internal reference using the following primers: 5’-GGTGGTCTCCTCTGACTTCAACA-3’ (forward) and 5’-GTTGCTGTAGCCAAATTCGTTGT-3’ (reverse). The 2-ΔΔCt method was used to calculate the relative gene expression levels (fold changes), and all the tests were performed at least three times[16].
Protein extraction and Western blotting
Total protein was extracted from fresh tissue samples according to the manufacturer's instructions. The protein concentration was determined using the BCA Protein Assay Kit (SinoBio Biotech, China). Each equivalent sample protein was electrophoresed in 10% SDS-PAGE polyacrylamide gels and transferred to polyvinylidene fluoride (PVDF) membranes (Millipore, Bedford, MA, USA). The membrane was sealed with 5% nonfat milk at room temperature for 2 hours and incubated with monoclonal antibodies, including anti‑T‑cad (1:1,000; Abcam, Cambridge, MA, USA), anti‑MMP-2 and anti‑GAPDH at 4°C overnight. Subsequently, using the corresponding HRP-conjugated secondary antibodies, the membranes were incubated at room temperature for 2 h. After washing, proteins were quantified by the ChemiDoc XRS system (Bio-Rad, Philadelphia, USA). GAPDH was used as an internal control.
Transwell migration and invasion assays
Using 24-well Transwell chambers (8 µm; Corning Inc., USA), the cell migration assay was performed. At 48 h after transfection, 200 μl of suspension containing 4x105 cells was added to the upper compartments in serum-free medium, and culture medium containing 10% FBS and 1% BSA was added to the lower chamber. After incubating at 37°C in humidified air for 24 h with 5% CO2 and 95% O2, the cells that migrated into the lower chamber were fixed with methanol for 2 min and stained with 1% crystal violet. Finally, microscopy with a CCD camera was used to photograph and count the cells. For the cell invasion assay, the procedures of the cell invasion experiment were similar to those of the cell migration experiment, except the Transwell chambers were coated with 24 μg/μl Matrigel (R&D Systems, USA).
Cell viability and colony formation assays
MTT assays were used to measure cell viability in A2780 cells daily over the following 5 days. Briefly, A2780 cells at a density of 1x104 were inoculated into each well in 96-well plates and cultured with 10 μl MTT at a concentration of 0.5 mg/ml (Promega, USA) at 37°C for 4 h. Then, 150 μl dimethylsulfoxide (DMSO; Sigma, USA) was added to dissolve the purple formazan crystals for 1 h. Ultimately, an ELISA reader (Bio‑Rad, Berkeley, CA, USA) was used at a wavelength of 595 nm to read the absorbance of each well. Each trial was performed in triplicate and repeated three times.
Cell proliferation assays
The proliferation ability of A2780 cell lines was detected by CCK-8 assay (Dojindo, Japan). Untransfected, transfected, and empty transfected A2780 cells were adjusted to a cell concentration of 5x103 cells/ml and then inoculated with 100 µl diluted cell fluid per well in a 96-well plate with three identical wells per sample and time point. After culturing for 0, 24, 48 and 72 hours, 10 μL of CCK-8 solution was added to each well and incubated continuously for 2 hours at 37°C. Finally, the absorbance was measured at a wavelength of 450 nm by a fully automated microplate reader (Bio-Rad Laboratory, Irvine, CA, USA).
Cell apoptosis assays
Non-transfected, transfected and empty vector-transfected A2780 cells were collected, and serum-free medium was used to prepare a single cell suspension at a density of 3x104 cells/ml. A 10 ml cell suspension was added to each well of the 6-well plate, and 0.25% trypsin digestion was performed. After 48 h of culture, an annexin V-FITC and propidium iodide (PI) double staining apoptosis kit (Dojindo, Japan) was applied according to the manufacturer's instructions. Apoptosis signals were detected by flow cytometry. Annexin V-FITC-positive cells were defined as apoptotic cells.
Paclitaxel sensitivity assays
To evaluate growth rates, A2780 cells were plated into 96-well plates at a density of 1x104 cells/well. Growth medium (DMEM/10% FCS) with or without paclitaxel (1.8 µM; LC lab, Woburn, USA) was used to culture the cells overnight. The cells were cultured for another 4 days, rinsed gently with PBS, separated in PBS with 0.25% trypsin/1 mM EDTA, and counted with a Coulter counter. To evaluate the survival rate of cells adhered on 96-well plates, an MTT assay was applied after exposure to paclitaxel for 0 h, 24 h, 48 h, 72 h, and 96 h.
Statistical analysis
All data are represented by the mean ± standard deviation (SD). One-way ANOVA was used for statistical comparison. Pearson’s χ2 test or Fisher’s exact test was used to determine the significant difference in clinical characteristics and T-cadherin expression. SPSS 16.0 software was used for statistical analysis (SPSS Inc., Chicago, USA). P values <0.05 were considered significant.