Protective Effect of SIRT1-mediated NF-κB Signal Pathway against Necrotizing Enterocolitis in Neonatal Mice

doi:10.21203/rs.3.rs-1848307/v1

Download PDF

Research Article

Protective Effect of SIRT1-mediated NF-κB Signal Pathway against Necrotizing Enterocolitis in Neonatal Mice

https://doi.org/10.21203/rs.3.rs-1848307/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Objective

To discover the mechanism of Sirtuin1 (SIRT1)-mediated NF-κB pathway in the protection of necrotizing enterocolitis (NEC) in neonatal mice.

Methods

Neonatal mice were treated with EX527 (an inhibitor of SIRT1) and/or pyrrolidine dithiocarbamate (PDTC, an inhibitor of NF-κB). The survival rate of mice was recorded. Hematoxylin & eosin (HE) staining was performed to observe the pathological changes of intestines. Furthermore, western blotting, Enzyme-linked immuno sorbent assay (ELISA), and real-time quantitative polymerase chain reaction (qRT-PCR) were conducted to measure the protein and gene expression, while corresponding kits to detect the levels of oxidative stress indicators.

Results

PDTC increased the survival rate of NEC mice. When compared with the NEC + EX527 + PDTC group, the histological score of NEC was higher in the NEC + EX527 group but was lower in the NEC + PDTC group. SIRT1 expression in the intestines of NEC mice was down-regulated, with an increase in p65 nuclear translocation. Also, MDA increased and GPx decreased in the intestines of NEC mice, with the up-regulations of IL-6, IL-1β and TNF-α, as well as the down-regulations of ZO-1, occludin and claudin-4 in the intestines. However, changes above could be improved by PDTC, which would be further reversed by EX527.

Conclusion

SIRT1 could mitigate inflammation and oxidative stress response and improve the intestinal permeability by mediating NF-κB pathway, playing an important role in the alleviation of NEC.

Neonatal NEC

SIRT1

NF-κB

inflammation

oxidative stress

Neonatal necrotizing enterocolitis (NEC) is a kind of acute gastrointestinal conditions frequently seen in premature infants, and the prevalence in the very low birth weight infants (VLBWIs) has reached 5–12% ¹. Among the VLBWIs (< 1000 g), the mortality rate could be as high as 30–50%, which has not yet shown any significant changes in the past 20 years ². It has been generally believed that NEC results from a variety of factors, including premature delivery, ischemia, hypoxia, inappropriate feeding infection and ectopic implantation of intestinal bacteria ^{3, 4}. Treatment strategies for NEC include the rest of stomach and intestines, gastric decompression, intravenous injection of broad-spectrum antibiotics and general support ⁵. A great many literatures have suggested that NEC, as a kind of inflammatory disease in intestines, is frequently associated with the development of general inflammatory diseases, including sepsis, systemic inflammatory response syndrome (SIRS) and shock ^{6, 7}. As such, searching for the pathogenesis and developing the corresponding measures for prevention and treatment are the major issues in the current research.

SIRT1, as a member of sirtuin family (SIRT1-7) belonging to the mammalian class III histone deacetylases, is highly dependent on nicotinamide adenine dinucleotide (NAD) ⁸, which has been supported to regulate a variety of biological processes, including gene silencing and repair, energy metabolism, aging and inflammation ^9–11. EX527, an effective selective SIRT1 inhibitor, has been shown to inhibit SIRT1 deacetylase activity effectively ¹², and it has been applied in various animal models to explore the effect of SIRT1 inhibition on multiple diseases, including myocardial ischemia/reperfusion injury ¹³, high-fat diet (HFD)-induced hepatic fibrosis ¹⁴.

In addition, SIRT1 could modulate and interact with various target proteins, including peroxisome proliferator-activated receptor coactivator-1 (PGC-1α), FOXO, p53 and nuclear factor-κB (NF-κB) in response to deacetylation to promote mitochondrial biogenesis and oxidative metabolism ^15–17. Current studies have shown that Saccharomyces boulardii could modulate the necrotizing enterocolitis in neonatal mice through mediating the SIRT1/NF-κB pathway ¹⁸, suggesting the involvement of SIRT1 in the development of NEC via regulating the activity of NF-κB pathway. Commonly, NF-κB is a central signal transduction node that could affect the release of inflammatory factors and activation of lymphocytes ¹⁹. In particular, NF-κB signaling pathway has been widely recognized as the inflammatory target of SIRT1 ^{17, 20, 21}. On the other hand, pyrrolidine dithiocarbamate (PDTC, an NF-κB inhibitor) has also been investigated in a variety of neonate-related disease models ^{22, 23}. Therefore, NEC models were established according to the method in the previous literature in our study ²⁴ with the treatment of EX527 and/or PDTC, hoping to uncover the mechanism how SIRT1-mediated NF-κB pathway regulates the development of NEC in mice.

Ethical statement

Pregnant C57BL/6J mice on day 12 after conception were received the ad lib consumption of food and water in the animal care facility. Mother animals naturally delivered. Throughout the entire experimental procedure, pups were kept with their mother. This study conformed to the Guide for the Care and Use of Laboratory Animals, 8th edition ²⁵, and all animal-related operations were conducted under the supervision of the Ethical Board for Laboratory Animals of our hospital.

Establishing the NEC models on neonatal mice

EX527, a kind of selective, effective SIRT1 inhibitor (CAS No.: 49843-98-3), and PDTC, an inhibitor of NF-κB (CAS No.: 5108-96-3), were all purchased from MCE (MedChemExpress, Monmouth Junction, NJ, USA). A total of 50 neonatal mice were divided randomly into Control group, NEC group, NEC + EX527 group, NEC + PDTC group and NEC+ EX527 + PDTC group, with 10 mice in each group. Pups on day four postpartum (p.p.) were submitted to the NEC protocol according to the previous study ²⁴. Briefly, neonatal mice were subjected to the gavage of 0.1 mL Neocate (Nutricia 400g Neocate Infant Spezialnahrung) and LPS-EB solution, followed by deprivation of oxygen for 10 min in 5% oxygen, twice per day, where the concentration of LPS-Neocate was set as 1:50 (LPS: Neocate). At two hours prior to model establishment, treatment was conducted for mice in the NEC + EX527 group, NEC + PDTC group and NEC+ EX527 + PDTC group. EX527 (diluted with PBS to a concentration of 10 mg/ml ²⁶ ) and PDTC (50 mg/kg ²⁷) were intraperitoneally injected for 3 d twice daily. The neonatal mice in the Control group did not receive any intervention (neither NEC induction nor treatment). Experimental procedures were shown in Figure 1A.

Collection of plasma samples

Mice were euthanized to obtain the blood samples, which were preserved in tubes supplemented with ethylenediamine tetraacetic acid (EDTA). Immediately after collection, samples were centrifuged at room temperature to isolate the plasma which was later preserved at -80°C for enzyme-linked immunosorbent assay (ELISA) with mouse IL-6 ELISA kit (sensitivity: < 2 pg/mL; range: 0.82 pg/mL-600 pg/mL, ab100712), mouse IL-1β ELISA Kit (sensitivity: 2 pg/mL; range: 0.2 pg/mL-200 pg/mL, ab229440), mouse TNF-α ELISA Kit (sensitivity: 9.1 pg/mL; range: 46.88 pg/mL-3000 pg/mL, ab208348). The kits above were provided by Abcam (USA).

Hematoxylin-Eosin (HE) staining

Following the collection of blood samples, intestines of mice were immediately collected for HE staining. In brief, intestines were placed in 10% formaldehyde for fixation for 24 h. Thereafter, samples were dehydrated in ethanol of gradient concentrations, cleared in xylene, embedded in paraffin and sliced into sections in thickness of 4 μm. Sections were de-paraffinized, hydrated, stained in hematoxylin at room temperature for 10 min, rinsed in tap water for 30 to 60 s, differentiated in 1% HCl-ethanol for 1 min, rinsed in tap water for 1 min, stained in eosin for 5-10 min. Subsequently, sections were dehydrated in ethanol of gradient concentrations, cleared in xylene and mounted in neutral balsam, and then placed under the microscope to observe the histological changes. The histological NEC severity was scored based on the presence of intact morphology (Grade 0), sloughing of epithelial cells at the tips of the villi (Grade 1), mid-villous necrosis (Grade 2), loss of villi or complete villous necrosis (Grade 3), complete destruction of the mucosa, transmural necrosis, and pneumatosis intestinalis (Grade 4).

Real-time quantitative polymerase chain reaction (qRT-PCR)

TRIzol reagent (Invitrogen, USA) was used to extract the total RNA from tissue samples, and with the obtained RNA, cDNA was prepared by using the SuperScript IV Reverse Transcription Enzyme (Invitrogen, USA) in following conditions: 50 mM Tris-HCl (pH 8.3), 4 mM MgCl₂, 10 mM DTT, 50 mM KCl, 0.5 mM dTTP, 0.4 MBq/mL [³H]-dTTP, 0.4 mM poly(A) oligo (dT)_12-18and enzymes in a 20 μL system at 37°C for 10 min. With cDNA in appropriate volume as template, PCR was conducted in 7500 System by using the SuperScript III Platinum SYBR Green One-Step qRT-PCR kit (Invitrogen, USA) and primers in Table 1. Expression of target genes was quantified by using the formula of 2^-^△△^Ct, with β-actin as endogenous control.

Western blotting

Total proteins were collected from tissue samples, and the concentration was measured according to the Bicinchoninic Acid (BCA) Protein Quantification Kit (Thermo Scientific, Shanghai, China). Proteins were then separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto polyvinylidene difluoride (PVDF) membrane via the semi-dry transfer (Bio-Rad, USA), where the unoccupied sites were blocked in non-fat milk at room temperature, followed by washes in phosphate-buffered saline with Tween 20 (PBST). Proteins on the membrane were hybridized at room temperature for 1 h with anti-SIRT1 antibody (ab189494) at 1/1000 dilution, anti-NF-κB p65 antibody (ab32536) at 1/1000 dilution, anti-ZO1 tight junction protein antibody (ab216880) at 1 µg/mL, anti-Occludin antibody (ab167161) at 1/5000 dilution, anti-Claudin 4 antibody (ab53156) at 1/500 dilution, anti-β-actin antibody (ab8227) at 1 µg/mL and anti-Lamin B1 antibody-Nuclear Envelope Marker (ab16048) at 1 µg/mL (Abcam, USA), followed by 5 washes in PBST, 3 min/wash. Resulting immunoblots were further incubated with Goat anti-Rabbit IgG H&L (HRP) (ab97051) at 1/20000 dilution for 1 h at room temperature, followed by 5 washes in PBST, 3 min/wash. Target proteins were incubated with the horseradish peroxidase (HRP) substrate (Bio-Rad) to develop the bands. Relative content of target proteins was expressed by the ratio of band intensity of target protein to that of endogenous control (β-actin or Lamin B1).

Measurement of MDA and GPx activity in intestines

Malondialdehyde (MDA) activity in the intestines was determined by using the lipid peroxidation assay kit (sensitivity > 0.1 nmol/well, ab118970, Abcam, USA), while GPx activity was evaluated by using the glutathione peroxidase assay kit (sensitivity: 0.5 mU/mL, ab102530, Abcam, USA).

Statistical analysis

All data were subjected to the statistical analysis by using the SPSS 21.0 software (SPSS, Inc, Chicago, IL, USA). Survival rate was calculated by using the Kaplan-Meier method, followed by the log-rank test. Measurement data were expressed in form of mean ± standard deviation, while differences in comparison of the measurement data were testified via the One-way analysis of variance (ANOVA), followed by the Tukey’s HSD test for pairwise comparison. P < 0.05 suggested that the difference had statistical significance.

Comparison of the survival rates of mice among groups

From 4 d p.p., NEC was induced to observe the survival of neonatal mice in each group, and as a result, mice in all control groups survived to the date of euthanasia (10 d p.p.), with a survival rate of 100% (10/10). However, mice in the NEC group, NEC + EX527 group, NEC + PDTC group and NEC+ EX527 + PDTC group had the survival rates of 60% (6/10), 30% (3/10), 90% (9/10) and 60% (6/10), respectively. As demonstrated by Kaplan-Meier analysis and results of Log-rank test, the significant differences were observed in comparison of the survival rates among groups (c²= 14.58, P = 0.006, Figure 1B).

Pathology of intestines of mice in each group

The intestinal histopathological changes of mice in each group were observed via HE staining (Figure 2). In the Control group, intestinal villus and epithelium were in the intact structure, with no inflammatory cell infiltration. When compared to the NEC group, the severity of NEC was increased in the NEC + EX527 group, with the complete destruction of mucosa, transmural necrosis, aerocolia and intramural hemorrhage. However, mice in the NEC + PDTC group had alleviation in NEC, while those in the NEC + EX527 + PDTC group had the similar pathological changes, as compared with the NEC group. As indicated by the quantitative analysis, the histological scores of Control group, NEC group, NEC + EX527 group, NEC + PDTC group and NEC+ EX527 + PDTC group were 0.1 ± 0.32, 2.8 ± 0.79, 3.7 ± 0.48, 1.7 ± 0.67, 2.7 ± 0.82, respectively. By comparison with the Control group, the histological scores of NEC in other groups increased evidently (all P < 0.05). As compared to the NEC group and NEC+ EX527 + PDTC group, the histological scores of NEC in the mice of NEC + EX527 group increased significantly, but the significant decrease was seen in the mice of NEC + PDTC group (all P < 0.05). No significant differences were observed between NEC + EX527 + PDTC group and NEC group regarding the histological scores (P > 0.05).

Expression of SIRT1 and NF-κB p65 in the intestines of mice

Western blotting was conducted to observe the SIRT1 expression in the intestines of mice (Figure 3A), and consequently we found that the expression of SIRT1 in the NEC group was much lower than that in the Control group, while EX527 could further down-regulated SIRT1 (all P < 0.05). However, no significant changes were observed in the expression of SIRT1 in the intestines of mice in NEC group after treatment with PDTC (P > 0.05). Meanwhile, we noted that EX527, the inhibitor of SIRT1, could promote the nuclear translocation of NF-κB p65 in the intestines of NEC mice, which could be inhibited by PDTC (all P < 0.05). In comparison with the NEC + EX527 group, mice in the NEC+ EX527 + PDTC group also had a significant increase in the nuclear translocation of NF-κB p65 in intestines (all P < 0.05, Figure 3B).

Effect of SIRT1-mediated NF-κB pathway on the oxidative stress in the intestines of NEC mice

MDA (lipid oxidization) and GPx (antioxidative capacity) are markers of oxidative stress, which was then detected in the intestines (Figure 4). By comparison with the Control group, the MDA activity in mice of NEC group increased significantly, with a decline in the activity of GPx (all P < 0.05). Moreover, PDTC could mitigate the oxidative stress in the intestines of NEC mice, with a reduction in the MDA activity and an elevation in the GPx, and such changes could be reversed by EX527, the inhibitor of SIRT1 (all P < 0.05).

Effect of SIRT1-mediated NF-κB pathway on inflammatory factors in the plasma and intestines in NEC mice

The expression of inflammatory factors (IL-6, IL-1β and TNF-α) was firstly measured in the plasma of mice (Figure 5A-C) and NEC mice had significant up-regulations in the expression of inflammatory factors above (all P < 0.05), suggesting the aggravation of inflammation. However, PDTC could improve the inflammation of NEC mice, with significant decreased levels of IL-6, IL-1β and TNF-α in the plasma, which, however, was reversed by EX527 (all P < 0.05). To further clarify the anti-inflammatory effect of SIRT1-mediated NF-κB pathway on the NEC mice, we performed qRT-PCR to detect the expression of the above genes in the intestines, and, consequently, found the changes similar to those in the plasma (Figure 5D-F).

Effect of SIRT1-mediaed NF-κB pathway on the intestinal tight junctions in NEC mice

The expression of intestinal tight junction genes in mice, including ZO-1, Occludin and Claudin-4 (Figure 6) was determined, and the intestinal tight junctions were severely altered in NEC mice, concomitant with the down-regulations of the above gene and protein expression (all P < 0.05). As compared to the mice in the NEC group, those in the NEC + EX527 group showed significant down-regulations of ZO-1, occludin and claudin-4 in the intestines of mice, but those in the NEC + PDTC group showed up-regulations in factors above (all P < 0.05). Nevertheless, as compared to the NEC + EX527 group, mice in the NEC+ EX527 + PDTC group had significant reductions in the gene and protein expression of these junction genes in the intestines (all P < 0.05).

NEC is a kind of inflammatory disease caused by the imbalanced intestinal immune functions. Previous evidence has demonstrated that SIRT1 was down-regulated in the inflammatory mucosa of NEC patients ²⁸. Bai M et al. further discovered the reduced plasma expression of SIRT1 in the sample of NEC patients was associated with inflammation ²⁹. Similarly in this study, we also noted that SIRT1 was down-regulated in the intestines of NEC mice, and the administration of EX527, the inhibitor of SIRT1, could result in the death of NEC mice, with the aggravation of inflammation. According to the published literature, the level and activity of SIRT1 were decreased in chronic inflammatory conditions, with the occurrence of oxidative stress ³⁰. In terms of oxidative stress, it was first referred to the imbalance between oxidants and antioxidants, favoring oxidants, which could lead to damage. In particular, newborns were more vulnerable to oxidative stress and, as a direct result of this, to oxidative stress damage ³¹. Also, nicotinic acid was shown to increase the level of SIRT1 in lung and then mitigate I/R injury-caused oxidative stress and inflammation in the lung of rats ³². Besides, SIRT1 could prevent smoke-caused oxidative stress in the lung ³³, and the application of activator for SIRT1 could prevent the inflammation and oxidative stress in the lung of COPD rats ³⁴. EX527, the inhibitor of SIRT1, could antagonize the protective effect of miR-499-5p on the LPS-induced lung injury ³⁵. We, in this study, also noted that EX527 could aggravate the oxidative stress in the intestines of NEC mice, with an increase in the activity of MDA and a decrease in the activity of GPx, which, indirectly, suggested the inhibitory effect of EX527 on the oxidative stress injury. Intestinal mucosal barrier is of great significance for the maintenance of intestinal barrier which refers to the tight junctions (TJ) between the intestinal epithelial cells and other cells ³⁶^,³⁷. TJ is a kind of multifunctional complex constituted by more than 50 proteins, including transmembrane proteins (Claudin, Occludin and JAM) and cytoplasmic adhesive proteins (ZO protein family) ³⁸^,³⁹. Transmembrane proteins, as a kind of structural proteins, are mainly involved in the maintenance of barrier selective barrier function, while the damage of TJ proteins, as reported, is associated with a variety of gastrointestinal diseases, including NEC ²⁸^,⁴⁰. Of note, SIRT1 overexpression was reported to inhibit LPS-induced up-regulations of pro-inflammatory factors (IL-6, IL-8 and TNF-α) and the down-regulations of TJ proteins (ZO-1, ZO-2 and Claudin-4), suggesting that SIRT1 overexpression may mitigate the inflammation and dysfunction of intestinal epithelial barrier ²⁹. Previous literatures have shown that SIRT1 activation could alleviate the LPS-induced hypertonic status in the lung, with the up-regulations of TJ proteins, including occludin, claudin-5, ZO-1 and ZO-2 ⁴¹. Moreover, resveratrol, an activator of SIRT1, could ameliorate the disorder in the blood-brain barrier permeability by up-regulating the TJ proteins (ZO-1, occludin and claudin-5) in the brain injury ⁴². Consequently, SIRT1 inhibitor, in this study, was found to be able to down-regulate the expression of TJ proteins in the intestines of NEC mice, including ZO-1, occludin and claudin-4, thereby affecting the progression and prognosis of NEC.

NF-κB is a factor extensively found in the eukaryotes, consists of the members of Rel family in heterogenic or homogenic dimers, including NF-κB1(p50/p105), NF-κB2(p52/p100), p65(RelA), RelB and C-Rel ¹⁷. PDTC, as an inhibitor of NF-κB, may affect a variety of neonate-related diseases and, for instance could protect the neonatal rat ventricular cells from the AngII-caused injury ²³ and neonatal hypoxic-ischemic brain injury ²⁶^,⁴³. Intranasal PDTC treatment could reduce the release of pro-inflammatory factors in brain and provide the nerve protection after the brain ischemia/hypoxia attack in neonatal rats ⁴⁴. In addition, NF-κB is required for the activation, recruitment and differentiation of NEC-induced monocytes in the neonatal intestines ⁴⁵. In the NEC model established in newborn rats, NF-κB was up-regulated ⁴⁶. It has also been reported that LGALS3 silencing could block the TLR4/NF-κB pathway, thereby inhibiting the apoptosis and inflammation of intestinal epithelial cells in NEC ⁴⁷. Silencing prolyl hydroxylase 2 (PHD2) could also alter the effect of bone marrow mesenchyml stem cells (BM-MSCs) via the NF-κB-dependent mechanism ⁴⁸. APTBP, an anti-oxidative peptide, could improve the NEC inflammation by inhibiting ROS-NF-κB axis ⁴⁹. In this study, we found that PDTC could ameliorate the inflammation, oxidative stress and intestinal permeability in NEC mice. Mechanically, the N-termina domain of SIRT1 binds to the endogenous SIRT1, resulting in the reduced expression of pro-inflammatory factors, which may associate with the decreased activation of NF-κB caused by deacetylation of K310, the subunit of RelA/p65 ²⁰. We also found that EX527 could promote the nuclear translocation of NF-κB p65, suggestive of the activation of NF-κB. It has also been found that LPS could induce the acetylation of p65 significantly. Such a change could be reversed by nicotinamide riboside (NR), while the effect of NR on LPS-induced p65 acetylation could be offset by EX527 ⁵⁰. In our work, the therapeutic effect of PDTC on NEC neonatal mice could be abolished by EX527, suggesting that SIRT1 may have a role by mediating NF-κB pathway in NEC neonatal mice.

In conclusion, neonatal NEC mice models were presented with the significant down-regulations of SIRT1 and the up-regulation of nuclear translocation of NF-κB p65 in the intestines. PDTC, an inhibitor of NF-κB, could mitigate the inflammation, oxidative stress and intestinal permeability in NEC mice, which could be reversed by EX527, an inhibitor of SIRT1, suggesting that SIRT1 may play an important role in the alleviation of NEC by inhibiting the NF-κB pathway.

Availability of data and materials: The data that support the findings of this study are available on request form the corresponding author. The data are not publicly available due to privacy.

Competing interests: The authors declare that they have no competing interests.

Funding: There was no funding in this study.

Acknowledgements: The authors appreciate the reviewers for their useful comments in this paper.

Meister AL, Doheny KK, Travagli RA. Necrotizing enterocolitis: It's not all in the gut. Experimental biology and medicine. 2020; 245: 85–95.
Alganabi M, Lee C, Bindi E, Li B, Pierro A. Recent advances in understanding necrotizing enterocolitis. F1000Research. 2019; 8.
Bellodas Sanchez J, Kadrofske M. Necrotizing enterocolitis. Neurogastroenterology and motility: the official journal of the European Gastrointestinal Motility Society. 2019; 31: e13569.
Yan X, Managlia E, Tan XD, De Plaen IG. Prenatal inflammation impairs intestinal microvascular development through a TNF-dependent mechanism and predisposes newborn mice to necrotizing enterocolitis. American journal of physiology Gastrointestinal and liver physiology. 2019; 317: G57-G66.
Rich BS, Dolgin SE. Necrotizing Enterocolitis. Pediatrics in review. 2017; 38: 552–59.
Riggle KM, Rentea RM, Welak SR, Pritchard KA, Jr., Oldham KT, Gourlay DM. Intestinal alkaline phosphatase prevents the systemic inflammatory response associated with necrotizing enterocolitis. The Journal of surgical research. 2013; 180: 21–6.
Harris MC, D'Angio CT, Gallagher PR, Kaufman D, Evans J, Kilpatrick L. Cytokine elaboration in critically ill infants with bacterial sepsis, necrotizing entercolitis, or sepsis syndrome: correlation with clinical parameters of inflammation and mortality. The Journal of pediatrics. 2005; 147: 462–8.
Tang BL. Sirt1 and the Mitochondria. Molecules and cells. 2016; 39: 87–95.
Chen C, Zhou M, Ge Y, Wang X. SIRT1 and aging related signaling pathways. Mechanisms of ageing and development. 2020; 187: 111215.
Alves-Fernandes DK, Jasiulionis MG. The Role of SIRT1 on DNA Damage Response and Epigenetic Alterations in Cancer. International journal of molecular sciences. 2019; 20.
Farghali H, Kemelo MK, Canova NK. SIRT1 Modulators in Experimentally Induced Liver Injury. Oxidative medicine and cellular longevity. 2019; 2019: 8765954.
Shi L, Zhang J, Wang Y, Hao Q, Chen H, Cheng X. Sirt1 Regulates Oxidative Stress in Oxygen-Glucose Deprived Hippocampal Neurons. Frontiers in pediatrics. 2020; 8: 455.
Tian L, Cao W, Yue R, Yuan Y, Guo X, Qin D, et al. Pretreatment with Tilianin improves mitochondrial energy metabolism and oxidative stress in rats with myocardial ischemia/reperfusion injury via AMPK/SIRT1/PGC-1 alpha signaling pathway. Journal of pharmacological sciences. 2019; 139: 352–60.
Kundu A, Dey P, Park JH, Kim IS, Kwack SJ, Kim HS. EX-527 Prevents the Progression of High-Fat Diet-Induced Hepatic Steatosis and Fibrosis by Upregulating SIRT4 in Zucker Rats. Cells. 2020; 9.
Thirupathi A, de Souza CT. Multi-regulatory network of ROS: the interconnection of ROS, PGC-1 alpha, and AMPK-SIRT1 during exercise. Journal of physiology and biochemistry. 2017; 73: 487–94.
Maiese K. Targeting the core of neurodegeneration: FoxO, mTOR, and SIRT1. Neural regeneration research. 2021; 16: 448–55.
Kauppinen A, Suuronen T, Ojala J, Kaarniranta K, Salminen A. Antagonistic crosstalk between NF-kappaB and SIRT1 in the regulation of inflammation and metabolic disorders. Cellular signalling. 2013; 25: 1939–48.
Zhang K, Zhang X, Lv A, Fan S, Zhang J. Saccharomyces boulardii modulates necrotizing enterocolitis in neonatal mice by regulating the sirtuin 1/NFkappaB pathway and the intestinal microbiota. Molecular medicine reports. 2020; 22: 671–80.
Lawrence T. The nuclear factor NF-kappaB pathway in inflammation. Cold Spring Harbor perspectives in biology. 2009; 1: a001651.
de Gregorio E, Colell A, Morales A, Mari M. Relevance of SIRT1-NF-kappaB Axis as Therapeutic Target to Ameliorate Inflammation in Liver Disease. International journal of molecular sciences. 2020; 21.
Yu Q, Dong L, Li Y, Liu G. SIRT1 and HIF1alpha signaling in metabolism and immune responses. Cancer letters. 2018; 418: 20–26.
Gui L, Lei X, Zuo Z. Decrease of glial cell-derived neurotrophic factor contributes to anesthesia- and surgery-induced learning and memory dysfunction in neonatal rats. Journal of molecular medicine. 2017; 95: 369–79.
Ma Y, Kong L, Nan K, Qi S, Ru L, Ding C, et al. Apolipoprotein-J prevents angiotensin II-induced apoptosis in neonatal rat ventricular cells. Lipids in health and disease. 2015; 14: 114.
Klinke M, Vincent D, Trochimiuk M, Appl B, Tiemann B, Bergholz R, et al. Degradation of Extracellular DNA Significantly Ameliorates Necrotizing Enterocolitis Severity in Mice. The Journal of surgical research. 2019; 235: 513–20.
In: th (ed.). Guide for the Care and Use of Laboratory Animals. Washington (DC), 2011.
Le K, Chibaatar Daliv E, Wu S, Qian F, Ali AI, Yu D, et al. SIRT1-regulated HMGB1 release is partially involved in TLR4 signal transduction: A possible anti-neuroinflammatory mechanism of resveratrol in neonatal hypoxic-ischemic brain injury. International immunopharmacology. 2019; 75: 105779.
Nurmi A, Goldsteins G, Narvainen J, Pihlaja R, Ahtoniemi T, Grohn O, et al. Antioxidant pyrrolidine dithiocarbamate activates Akt-GSK signaling and is neuroprotective in neonatal hypoxia-ischemia. Free radical biology & medicine. 2006; 40: 1776–84.
Bein A, Eventov-Friedman S, Arbell D, Schwartz B. Intestinal tight junctions are severely altered in NEC preterm neonates. Pediatrics and neonatology. 2018; 59: 464–73.
Bai M, Lu C, An L, Gao Q, Xie W, Miao F, et al. SIRT1 relieves Necrotizing Enterocolitis through inactivation of Hypoxia-inducible factor (HIF)-1a. Cell cycle. 2020; 19: 2018–27.
Hwang JW, Yao H, Caito S, Sundar IK, Rahman I. Redox regulation of SIRT1 in inflammation and cellular senescence. Free radical biology & medicine. 2013; 61: 95–110.
D'Angelo G, Chimenz R, Reiter RJ, Gitto E. Use of Melatonin in Oxidative Stress Related Neonatal Diseases. Antioxidants. 2020; 9.
Wu NC, Wang JJ. Niacin Pretreatment Attenuates Lung Ischemia and Reperfusion-Induced Pulmonary Barrier Function Impairment by Reducing Oxidative Stress and Activating SIRT1 in an Isolated-Perfused Rat Lung Model. Transplantation proceedings. 2018; 50: 2834-38.
Yao H, Sundar IK, Ahmad T, Lerner C, Gerloff J, Friedman AE, et al. SIRT1 protects against cigarette smoke-induced lung oxidative stress via a FOXO3-dependent mechanism. American journal of physiology Lung cellular and molecular physiology. 2014; 306: L816-28.
Wang XL, Li T, Li JH, Miao SY, Xiao XZ. The Effects of Resveratrol on Inflammation and Oxidative Stress in a Rat Model of Chronic Obstructive Pulmonary Disease. Molecules. 2017; 22.
Yang F, Yan J, Lu Y, Wang D, Liu L, Wang Z. MicroRNA-499-5p targets SIRT1 to aggravate lipopolysaccharide-induced acute lung injury. Free radical research. 2021; 55: 71–82.
Buckley A, Turner JR. Cell Biology of Tight Junction Barrier Regulation and Mucosal Disease. Cold Spring Harbor perspectives in biology. 2018; 10.
Sawada N. Tight junction-related human diseases. Pathology international. 2013; 63: 1–12.
Kim S, Kim GH. Roles of claudin-2, ZO-1 and occludin in leaky HK-2 cells. PloS one. 2017; 12: e0189221.
Reinhold AK, Rittner HL. Barrier function in the peripheral and central nervous system-a review. Pflugers Archiv: European journal of physiology. 2017; 469: 123–34.
Seo S, Miyake H, Alganabi M, Janssen Lok M, O'Connell JS, Lee C, et al. Vasoactive intestinal peptide decreases inflammation and tight junction disruption in experimental necrotizing enterocolitis. Journal of pediatric surgery. 2019; 54: 2520–23.
Fu C, Hao S, Xu X, Zhou J, Liu Z, Lu H, et al. Activation of SIRT1 ameliorates LPS-induced lung injury in mice via decreasing endothelial tight junction permeability. Acta pharmacologica Sinica. 2019; 40: 630–41.
Qian C, Jin J, Chen J, Li J, Yu X, Mo H, et al. SIRT1 activation by resveratrol reduces brain edema and neuronal apoptosis in an experimental rat subarachnoid hemorrhage model. Molecular medicine reports. 2017; 16: 9627–35.
Huang J, Liu W, Doycheva DM, Gamdzyk M, Lu W, Tang J, et al. Ghrelin attenuates oxidative stress and neuronal apoptosis via GHSR-1alpha/AMPK/Sirt1/PGC-1alpha/UCP2 pathway in a rat model of neonatal HIE. Free radical biology & medicine. 2019; 141: 322–37.
Wang Z, Zhao H, Peng S, Zuo Z. Intranasal pyrrolidine dithiocarbamate decreases brain inflammatory mediators and provides neuroprotection after brain hypoxia-ischemia in neonatal rats. Experimental neurology. 2013; 249: 74–82.
Managlia E, Liu SXL, Yan X, Tan XD, Chou PM, Barrett TA, et al. Blocking NF-kappaB Activation in Ly6c(+) Monocytes Attenuates Necrotizing Enterocolitis. The American journal of pathology. 2019; 189: 604–18.
Jing Y, Peng F, Shan Y, Jiang J. Berberine reduces the occurrence of neonatal necrotizing enterocolitis by reducing the inflammatory response. Experimental and therapeutic medicine. 2018; 16: 5280–85.
Sun L, Sun M, Ma K, Liu J. Let-7d-5p suppresses inflammatory response in neonatal rats with necrotizing enterocolitis via LGALS3-mediated TLR4/NF-kappaB signaling pathway. American journal of physiology Cell physiology. 2020; 319: C967-C79.
Chen H, Zhang H, Zheng Y, Min X, Luo Y, Zhou W, et al. Prolyl hydroxylase 2 silencing enhances the paracrine effects of mesenchymal stem cells on necrotizing enterocolitis in an NF-kappaB-dependent mechanism. Cell death & disease. 2020; 11: 188.
Zhang L, Fan J, He J, Chen W, Jin W, Zhu Y, et al. Regulation of ROS-NF-kappaB axis by tuna backbone derived peptide ameliorates inflammation in necrotizing enterocolitis. Journal of cellular physiology. 2019; 234: 14330–38.
Hong G, Zheng D, Zhang L, Ni R, Wang G, Fan GC, et al. Administration of nicotinamide riboside prevents oxidative stress and organ injury in sepsis. Free radical biology & medicine. 2018; 123: 125–37.

Table 1 Primers for qRT-PCR in this work

Gene	GenBank Accession	Sequence (5’-3’)	Length (bp)	Amplicon Size
TNF-α	NM_013693	Forward: CCCTCACACTCAGATCATCTTCT	23	61
		Reverse: GCTACGACGTGGGCTACAG	19
IL-1β	NM_008361	Forward: GCAACTGTTCCTGAACTCAACT	22	89
		Reverse: ATCTTTTGGGGTCCGTCAACT	21
IL-6	NM_031168	Forward: TAGTCCTTCCTACCCCAATTTCC	23	76
		Reverse: TTGGTCCTTAGCCACTCCTTC	21
ZO-1	BC013769	Forward: ACCACCAACCCGAGAAGAC	19	710
		Reverse: CAGGAGTCATGGACGCACA	19
Occludin	NM_008756	Forward: TTGAAAGTCCACCTCCTTACAGA	23	129
		Reverse: CCGGATAAAAAGAGTACGCTGG	22
Claudin-4	NM_009903	Forward: GTCCTGGGAATCTCCTTGGC	20	112
		Reverse: TCTGTGCCGTGACGATGTTG	20
β-actin	NM_007393	Forward: GGCTGTATTCCCCTCCATCG	20	154
		Reverse: CCAGTTGGTAACAATGCCATGT	22

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Protective Effect of SIRT1-mediated NF-κB Signal Pathway against Necrotizing Enterocolitis in Neonatal Mice

Status:

Version 1

Abstract

Objective

Methods

Results

Conclusion

Figures

Introduction

Materials And Methods

Results

Discussion

Declarations

References

Tables

Additional Declarations

Status:

Version 1