Role of Nrf2/ARE Signalling in Cadmium induced Alterations inNMDA ReceptorMediatedPostsynaptic Signalling inRat Hippocampus: Attenuation by Quercetin

doi:10.21203/rs.3.rs-1861312/v1

Download PDF

Research Article

Role of Nrf2/ARE Signalling in Cadmium induced Alterations inNMDA ReceptorMediatedPostsynaptic Signalling inRat Hippocampus: Attenuation by Quercetin

https://doi.org/10.21203/rs.3.rs-1861312/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Exposure tocadmium, a heavy metal distributed in the environment is a cause of concerndue to associated health effects in population world over. Continuing with the leadsdemonstrating alterations in brain cholinergic signalling in cadmium induced cognitive deficits;the study is focussed to understand involvement of N-Methyl-D-aspartate receptor (NMDA-R) and its post-synaptic signalling and Nrf2-ARE pathway in hippocampus. Also, the protective potential of quercetin, a polyphenolicbioflavonoid, was assessed in cadmium induced alterations. Cadmium treatment (5 mg/kg, body weight, p.o., 28 days)decreased mRNA expression and protein levels of NMDA receptor subunits (NR1, NR2A) in rat hippocampus, compared to controls. These rats also exhibited decrease in levels of NMDA-Rassociated downstream signalling proteins (CaMKIIα, PSD-95, TrkB, BDNF, PI3K, AKT, Erk_1/2, GSK3β, and CREB) and increase in levels of SynGap, a negative regulator of Ras-MAPK in hippocampus. Alterations in protein levels of selected targets associated with AREsignalling (Nrf2, HO-1 and Keap1) and degeneration of pyramidal neurons were also evident in hippocampus of cadmium treated rats.Simultaneous treatment with quercetin (25 mg/kg body weight p.o., 28 days) was found to attenuate cadmium induced changes in hippocampus. No significantchange in any targetwas observed in hippocampus of ratstreated with quercetin alone.The results suggest that impairment in ARE signalling on exposure to cadmium may disrupt NMDA-R and its post-synaptic signaling in hippocampus and contribute in cadmium induced cognitive deficits in rats. Further, quercetin has the potential to protect cadmium induced changes in hippocampus possibly by modulating ARE signalling.

Cadmium

Hippocampus

NMDA receptor

Nrf2/ARE signaling

Cognitive deficits

Quercetin

Cadmium, a nonessential transition metal is considered to be an industrial elementbecause of its immense uses in the production of alloys, storage batteries, fertilizersand semiconductor quantum dots [1]. It is also used as a pigment in plastic and metal industries and preferred over other metals for electroplating due to its non-corrosive nature [2, 3]. Extensive anthropogenic uses of cadmium therefore contribute its wide occurrence in the environment and enhance the risk of human exposure in non-occupational settings [4, 5].High levels of cadmium in drinking water, food and beverages are other potential sources of exposure among general population[5, 6].Exposure to cadmium is imminent among the tobacco users and also in those exposed to tobacco smoke passively[7, 8]. Cadmium has been identified to be a carcinogen and classified in the category of group IA chemicals [9]. The metal gets accumulated in the bodydue to its delayed clearance. Therefore, exposure to cadmium even at low dose has cumulative adverse effects leading to multi-organ toxicity and affects the functioning of lungs, liver and kidneys in exposed individuals[10, 11]. While peripheral neuropathy is frequently reported, cadmium also affects the functioning of autonomic and central nervous systems readily due to its high permeability through the blood brain barrier [12–14].Hearing loss associated with altered behavior and poor IQ level in children has been reported on prenatal and childhood exposure to cadmium [15].Risk of neurological abnormalities including Alzheimer’s, Parkinson’s and Huntington’s diseases has been found to be enhanced on exposure to cadmium and associated with high cadmium levels in blood and urine in population studies [16–20].Reports of high blood cadmium levels with AD related mortalities in adults have been of great concern [21, 22]. Consistent with these reports, increased risk of cognitive deficits has been associated with higher cadmium body burden in older men in a recent cross-sectional study from China [23]. Exposure to cadmium has also been found to affect grip strength in a separate study from US [24]. These findings have direct relevance of health effects and a strong predictor of all-cause mortality [24].

In view of increasing risk of cadmium induced neurotoxicity, several experimental studieshave been undertaken to understand the mechanisms involved in cadmium induced neurotoxicity. Cadmium may disrupt the synaptic signaling by affecting the integrity of neurotransmitters and their receptors leading to functional deficits [25, 26]. Being prooxidant in nature, cadmium increases free radical generation and affects the anti-oxidant defense system and thus enhanced oxidative stress has been considered to be a primary mechanism in cadmium induced neurotoxicity[1].Consequently, enhancedapoptosis and inflammation and perturbed autophagy may also contribute in cadmium neurotoxicity [27–29].

Considering the increased risk of cadmium induced neurotoxicity in population at large, a number of experimental studies employingnatural and pharmacological agents have been conducted to assess their protective potential[30].Quercetin, a polyphenolic natural flavonoid has natural occurrence in vegetables and fruits including onion, green leafy vegetables, apple, berries, cherries and citrus fruits[31]. Presence of quercetin has also been found both in alcoholic and non-alcoholic beverages [32, 33].Radical scavenging and antioxidant activity associated with metal chelating effects of quercetin are well documented and attributed to its broad pharmacological spectrum exhibiting anti-inflammatory, antidiabetic, cardioprotective, anticancer and antiulcer activities [34]. Protective effects of quercetin have been reported in experimental models of Parkinson’s, Alzheimer’s and Huntington’s disease[35–38]. Promising effects of quercetin to modulate physiological functions in preclinical studies have strengthened its use in clinical situations in the management and treatment of many diseases including neurodegenerative disorders[39]. The reports that quercetin affects the nuclear factor erythroid 2-related factor 2 (Nrf2), a key transcription factor that binds to antioxidant response element (AREs) and induces the expression of pro-survival proteins and cytoprotective enzymes and modulate oxidative stress are of much interest. It has been suggested that Nrf2 activation may be used as a possible therapeutic target in aging and associated diseases [40, 41].Further, quercetin has been found to increase antioxidant capacity and attenuate D-galactose-induced neurotoxicity and behavioral impairments [40]. In an earlier study by us, cadmium induced cholinergic alterations in brain have been associated with cognitive deficits and these changes were found to be modulated on simultaneous treatment with quercetin[42].

While role of NMDA receptors (NMDA-R) and its downstream signaling in brain is convincingly accepted to modulate synaptic plasticity, effect of cadmium on NMDA receptor signaling in hippocampus and its involvement in cadmium induced cognitive deficits is not clearly understood. Further, the therapeutic targets which may be modulated by quercetin in cadmium induced neurotoxicity are incognito.The current study is therefore focused to understand involvement of PI3K/AKT/NMDA receptor and Nrf2/ARE signaling pathways in cadmium induced cognitive deficits and its protection by quercetin.

2.1. Experimental Animals and Treatment Procedure

Adult male rats of Wistar strain (180 ± 20 g) procured from the central animal house of CSIR-Indian Institute of Toxicology Research (CSIR-IITR), Lucknow were housed in the experimental facility. The animals wereacclimatized for 7 days in the experimental rooms at controlled temperature (25 ± 2ºC) with a 12-h light/dark cycle under standard hygiene conditions. The study protocols were approved by the institutional animal ethics committee of CSIR-IITR, Lucknow (IITR/IAEC/44/17–44/18–52/19) and all experiments were carried out in accordance with the guidelines approved by the Committee for the Purpose of Control and Supervision of Experiments on Animals (CPCSEA), Ministry of Environment and Forests, New Delhi, India.Food in the form of pellet procured commercially and water were freely available to the experimental animals.

Rats were divided into four groups randomly and assigned to following treatment groups,

Group I - Rats treated with vehicle (distilled water containing 0.1% Tween-20, p.o., once daily for 28 days)

Group II - Rats treated with cadmium as cadmium chloride (dissolved in distilled water, 5 mg/kg body weight, p.o., once daily for 28 days)

Group III -Rats treated with quercetin (suspended in distilled water containing 0.1% Tween 20, 25 mg/kg body weight, p.o., once daily for 28 days)

Group IV-Rats treated with cadmium and quercetin simultaneously as in treatment groups II and III respectively.

The dose, duration and route of exposure of cadmium and quercetin are the same as used earlier by us [42].

Rats from each treatment groups were sacrificed 24 h after the last treatment dose for neurochemical and histological studies. The brains were rapidly removed and washed in ice cold saline (0.9%). Following the standard procedure, brain parts, including the hippocampus, were dissected out and stored at -80 ͦ C for further analysis.

2.2. Quantitative Real-Time PCR (RT-PCR) analysis

The m-RNA expression of NMDA-R subunits was determined by using quantitative RT-PCR. To summarize, total RNA was isolated from rat brain hippocampal tissue, and samples were extracted with Trizol reagent (Invitrogen, USA).The RNA's integrity was tested, and total RNA was determined by measuring the absorbance ratio (260/280nm) with Eppendorf BioSpectrometers (Eppendorf AG, Germany). For Quantitative PCR, the first strand of cDNA was synthesized using High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, USA). β-actin is a housekeeping gene that serves as an internal control. In a final volume of 20µl,the PCR reaction mixture contained 1XSyber Green Universal PCR Master mix (Applied Biosystems,USA), gene primer (10pM), gene probe (4pM), cDNA (2µl) and nuclease-free water. For RT- PCR, Syber Green assays for each gene target were performed in triplicate on cDNA samples in 384-well optical plates on Fast Real-Time PCR System (ABI 7900HT, Applied Biosystems). The PCR conditions were set according to standard procedure [50°C for 2 min, 95°C for 10 min followed by 40 cycles of 95°C for 15 seconds and 60°C for 60 seconds].

The primers sequence of NR1, NR2A & NR2B subunits for mRNA expression [43]is as follows,

NR1 FP CTCATCTCTAGCCAGGTCTA

NR1 RP TCGCATCATCTCAAACCAGAC

NR2A FP ACTCCACACTGCCCATGAAC

NR2A RP TTGTTCCCCAAGAGTTTGCTT

NR2B FP GTTTGATGAAATCGAGCTGGC

NR2B RP TCCAGTTCCTGCAGGGAGTT

β-actin FP TGGAATCCTGTGGCATCCATGAAA

β-actin RP TAAAACGCAGCTCAGTAACAGTCC

2.3. Western blotting and Quantification

Immunoexpression of NMDA receptor subunits and the proteins associated with NMDA receptor signaling were assessed by western blotting following the standard protocols.Briefly, hippocampal tissue (~ 80–100 mg) was homogenizedin appropriate RIPA lysis buffer (freshly prepared) in which protease inhibitor cocktail and phosphatase inhibitor tablet (procured from Sigma Aldrich, USA) were added. Protein content was estimated by using the BCA kit (Thermo Fisher Scientific, USA) and bovine serum albumin (BSA) was used as a reference standard. A curve using varying concentrations of BSA was constructed to calculate the protein concentration in hippocampal samples.

Equal amount of sample (~ 40–70 µg protein/lane) was electrophoresed on SDS polyacrylamide gel electrophoresis (8–10%, depending on the size of protein). The protein was transferred onto the PVDF membrane (Millipore, USA) using a tank transfer system (100 V, 400 mA, 90–120 min). The transfer of gel protein to the membrane was confirmed using Ponceau S staining (Sigma Aldrich, USA). The membrane was blocked with buffer that contained BSA (5%). Subsequently, the membrane was incubated overnight at 4°C with either of the primary monoclonal antibodies (NR1, NR2A, NR2B, PSD95, CaMKIIα/pCaMKIIα, SynGap, ERK½/pERK½, TrkB, BDNF, AKT/pAKT, GSK3α-3β / pGSK3β, CREB/ pCREB, Nrf2, Keap1, HO-1, β-actin, GAPDH with dilution 1:1000). After incubation with the primary antibody, the membrane was washed by TBST (Tris-buffered saline with 0.1% Tween 20 detergent) buffer thoroughly and incubated with IRDye® 800CW Goat anti-Mouse IgG Secondary Antibody and IRDye® 680CW Goat anti-Rabbit IgG Secondary Antibody (1:20000) for 60 min at room temperature. After the incubation, the membrane was washed by TBST buffer and developed. The intensity of band was quantified by imaging analysis software (AlphaEase FC).

2.4. Histological Analysis

Rats wereanaesthetized with overdose of Ketamine HCl (40mg/kg), perfused with ice cold saline solution followed by neutral buffered formalin (NBF, 10%). After the perfusion, rats were sacrificed, whole brain isolated and stored in NBF solution (10%) for 72 hours. The fixed brain samples were washed in running tap water for 7 h and transferred to automatic tissue processor (STP-120, Micros instruments Inc., GmbH), and embedded in paraffin wax using Meditetissue embedding system (TES99, Medite Inc., GmbH). Paraffin embedded tissues were serially cut into coronal sections (4 um thickness) through the hippocampal region using semiautomatic microtome (RM 2155, Leica, GmbH).Thesections were put on floatation bath and mounted on positively charged slides, allowed to air dry and stained through automated slide stainer (Leica XL Automatic slide stainer, Leica, GmbH) following standard protocols for hematoxylin-eosin (H & E) staining[44]. Histopathological changes in hippocampal neuronal morphology were examined at 2X and 20X magnification under light microscope (BX-53, Olympus, Japan).

2.5. Statistical Analysis

The data of mRNA expression, protein levelsof minimum 3 independent biological reproducible experimentswas analyzed using GraphPad Prism version 5.00 (GraphPad Software Inc., California, USA). To determine the levels of significance, one-way analysis of variance (ANOVA) and the Newman–Keuls test were used to compare all pairs of columns. The data has been expressed as the mean ± SEM. Further, p values up to 0.05 have been considered statistically significant.

3.1. Effect on mRNA expression and protein levels of NMDA receptor subunits:

Effect of cadmium and protective effect of quercetin on mRNA expression and protein levels of NMDA receptor subunitswas assessed by quantitative PCR and western blotting respectively. A significant decrease in the mRNA expression of NR1 (0.45fold, p < 0.05) and NR2A (0.6-fold, p < 0.05) receptor subunits in hippocampus was evident in cadmiumtreated ratsas compared to rats in the control group (Figure − 1A). There was however, no significant changein mRNA expression of NR2B subunit in hippocampus of cadmium treatedrats. Simultaneous treatment with quercetin in cadmium treated rats was found to protect cadmium induced changes in mRNA expression of both NR1 (0.68-fold, p < 0.05) and NR2A (0.9-fold, p < 0.05) subunits as compared to rats in the cadmium treated group. Treatment of rats with quercetin alone had no significant effect on the mRNA expression of NR1, NR2A and NR2B subunits in hippocampus as compared to control rats (Figure − 1A).

Consistent with changes in the expression ofmRNA, treatment of rats with cadmium for 28 days caused significant decrease in protein levels of NR1 (0.3 fold, p < 0.01) and NR2A (0.6 fold, p < 0.01) subunits in hippocampus as compared to control rats (Figure − 1B).There was no significant change in protein levels of NR2B subunit in hippocampus in these rats. Interestingly, decrease in protein levels both in NR1 (0.7 fold, p < 0.01) and NR2A subunits (0.7 fold; p < 0.05) in hippocampusof cadmium treated rats was found to be protected on simultaneous treatment with cadmium and quercetinas compared to rats in the cadmium treated group. There was no significant effect on protein levels of any of the NMDA-R(NR1, NR2A, NR2B) subunits inhippocampus of rats treated with quercetin alone as compared to rats in the control group(Figure − 1B).

3.2. Effect on the levels of post-synaptic signaling proteins:

As NMDA receptor postsynaptic signaling in hippocampus plays important role in modulating the long-term potentiation,effect of cadmium was assessed on the integrity of CaMKIIα, SynGap and PSD95 proteins in hippocampus. Treatment of rats with cadmium caused decrease in protein levels of pCaMKIIα/CaMKIIα (0.6 fold, p < 0.05) and PSD95 (0.7 fold, p < 0.01) and an increase in the levels of SynGap (1.25fold, p < 0.05), a negative regulator of Ras-MAPK pathway in hippocampus as compared to rats in the control group (Figure − 2). Cadmium induced changes were found to be protected in rats on simultaneous treatment with cadmium and quercetin as evident by increase in the levels of pCaMKIIα/CaMKIIα (0.8 fold, p < 0.05) and PSD95 (0.8 fold, p < 0.05) and decrease in the levels of SynGap (0.85 fold, p < 0.05) in comparison to rats treated with cadmium alone (Figure − 2). No significant change in the levels of pCaMKIIα/CaMKIIα, PSD95 and SynGapwas observed in hippocampus of rats treated with quercetin alone as compared to rats in the control group.

3.3. Effect on the levels of TrkB/BDNFsignaling pathway:

There was decrease in the levels of BDNF (0.5 fold, p < 0.01) and TrkB (0.6 fold, p < 0.01) in hippocampus of rats treated with cadmium for 28 days as compared to rats in the control group. Simultaneous treatment with cadmium and quercetin in rats was found to increase the levels of both BDNF (0.75 fold, p < 0.01)and TrkB (0.8 fold, p < 0.01) in hippocampus as compared to cadmium treated rats (Figure − 3). Treatment of rats with quercetin alone had no significant effect on protein levels of both BDNFandTrkB in hippocampus as compared to control rats.

3.4. Effect on the levels of PI3K/AKTsignaling:

Involvement of PI3K/AKT, a cell survival signaling pathway thatmaintains the intracellular levels of PIP3 causes Akt phosphorylation was assessed in cadmium induced neurotoxicity. Decreasein the levels of pAKT/AKT (0.7 fold, p < 0.01) was observed in hippocampus of rats treated with cadmium for 28 daysascompared to rats in the controlgroup(Figure- 3). Simultaneous treatment of rats with cadmium and quercetin was found toincreasethe protein levels of pAKT/AKT (0.82 fold, p < 0.05) as compared to rats treated with cadmium alone. No significant change in the levels of pAKT/AKT was observed in hippocampus of rats treated with quercetin alone as compared to rats in the control group.

3.5. Effect on the levels of proteins involved in MAPK/ERK/GSK3βneuronal survival pathway:

Effect of cadmium on GSK3β and MAPK/ERKwas assessed in hippocampusin view of their role to modulate PI3K/Akt neuronal survival pathway. Treatment of rats with cadmium for 28 days caused a decrease in the levels of pGSK3β/GSK3β (0.64 fold, p < 0.01) in hippocampus as compared to control rats(Figure- 4). Further, decrease in the levels of pErk1/Erk1 (0.48 fold, p < 0.01) and pErk2/Erk2 (0.6 fold, p < 0.05)wasevidentin hippocampus of cadmium treated rats (Figure- 4). Simultaneous treatment with quercetin in cadmium treated rats was found to increase the levels of pGSK3β/GSK3β (0.7 fold, p < 0.05),pErk1/Erk1 (0.63 fold, p < 0.05) and pErk2/Erk2 (0.72 fold, p < 0.05) in hippocampus as compared to those treated with cadmium alone. There was no significant effecton protein levelsofpGSK3β/GSK3β, pErk1/Erk1 and pErk2/Erk2in hippocampus of rats treated with quercetin alone as compared to rats in the control group (Figure- 4).

3.6. Effect on the levels of CREB:

Effect of cadmium on the integrity of cAMP response element binding protein (CREB), a transcriptional factor and the downstream target in GSK3β pathway that modulates learning and memory was also assessed to understand its involvement in cadmium induced neurotoxicity. There was a decrease in the levels of pCREB/CREB (0.58 fold, p < 0.01) in hippocampus of rats treated with cadmium for 28 days as compared to controls. Simultaneous treatmentof rats with quercetin and cadmiumwas found to protect cadmiuminducedchanges as revealed by increase in the levels of pCREB/CREB (0.8 fold, p < 0.05) in hippocampus in comparison to rats treated with cadmium alone (Figure-4). There was no significant effect on the levels of pCREB/CREB in hippocampus of rats treated with quercetin alone as compared to those in the control group.

3.7. Effect on the levels of proteins involved in Nrf2/ARE signaling:

Nrf2-ARE is a critical signaling pathway that modulates oxidative stress by regulating the levels of antioxidant enzymes. Decrease in the levels of Nrf2 (0.42fold, p < 0.01) and HO-1 (0.62 fold, p < 0.05) was evident in hippocampus of rats treated with cadmium for 28 days as compared to control rats (Figure- 5). The levels of Keap1 (1.4fold, p < 0.01), a master regulator of antioxidant response that represses Nrf2activation was found increased in hippocampus of rats treated with cadmium as compared to control rats. Cadmium induced changes were found to be protected in rats on simultaneous treatment with quercetin as evident by increase in the levels of Nrf2 (0.9 fold, p < 0.01) and HO-1 (0.9 fold, p < 0.05) and decrease in the levels of Keap1 (0.87 fold, p < 0.05) in comparison to rats treated with cadmium alone (Figure − 5). No significant change in protein levels of Nrf2, Keap1, and HO-1 was observed in hippocampus of rats treated with quercetin alone as compared torats in the control group.

3.8. Histological Analysis- H & E Staining

As pyramidal neurons in the hippocampal region are rich in glutamate receptors and moreover play important role in modulating cognitive functions, effect on their integrity was also assessed by carrying out histological studies. Pyramidal neuronal cells with central large vesicular nuclei in CA1, CA3 and DG areas in hippocampus were found to be normal in control ratsas evident by the presence of nucleoli (arrows) with normal neuro-glial cells (arrow heads), (a - c, Figure-6). The pyramidal neuronal cells were also found to be normal in CA1, CA3 and DG areas in hippocampus of rats treated with quercetin alone (g-I, Figure − 6) similar to rats in the control group.Treatment of rats with cadmium caused degeneration of pyramidal neurons with shrunken hyperchromatic cytoplasm andreduced thickness of pyramidal layer (star) with darkly stained pyknotic nuclei in neuronal cells (arrows) in CA1, CA3 and DG regions of hippocampus in H&E-stained sections(d-f, Figure − 6). Mild infiltration of neuroglial cells (gliosis, arrow heads) was also observed in these sections on cadmium treatment (d-f). Interestingly, incidences of degenerated pyramidal neurons and other morphological alterations on cadmium treatment were found to be protected in CA1, CA3 and DG areas in hippocampus of rats on simultaneous treatment with quercetin (j – l, Figure-6).

Role of NMDA receptors, an important member of the glutamate receptor family, in modulating the synaptic plasticity is well accepted [45].It is considered to be a tetrameric assembly that contains two NR1 and two NR2 subunits. However, in some cases, two NR1 subunitsmay combine with one NR2 and one NR3 subunits[46]. Both glycine and glutamate serve as coagonists and are required for the normal functioning of NR1 and NR2 subunits respectively [47]. Alteration in the integrity of any of the subunits may cause functional changes. Hyperactivation of NMDA receptors has been associated in the etiology of epilepsy, hypoxic ischemia and in traumatic conditions [45].Exposure to NMDA antagonists has been found to cause deficits both in spatial and non-spatial learning in experimental animals by affecting brain NMDA receptors[45, 48, 49].In a classical study, decreased LTP in hippocampus was associated with impaired spatial learning in NR2A knockout mice [45, 50]. Interestingly, drug induced inhibition in brain NMDA receptors has been found to enhance release of glutamate and acetylcholine, the excitatory neurotransmitters in the brain [51]. Thus, stimulation of NMDA receptors for prolongedperiod may cause hyposensitivity and intense stimulation at times may lead to degenerative changes in the brain [52]. Exposure to environmental chemicals has been found to target NMDA receptor subunits and cause functional deficits in experimental studies undertaken earlier [53–55].Decrease in NR1 and NR2B subunits in hippocampus was accompanied with decreased cognition in developing rats prenatally exposed to lambda-cyhalothrin, a new generation type II synthetic pyrethroids. Learning deficits in mice offspring, prenatally exposed to arsenic, have been associated with alterations in NMDA-R (NR1, NR2A and NR2B) and AMPA-R (GluR1) subunits and their signaling in hippocampus[56]. However, exposureto arsenic in adult rats was found to affect the levels of NR1 or NR2A subunits or both and these changes were associated with cognitive deficits [57–59]. The differential changes in NMDA receptor subunits in arsenic treated animals may be due to use of different arsenic compounds / formulations and moreover differences in the dose, duration and exposuretiming.Exposure to lead, another metal prevalent in the environment, decreased the levels of NR2A subunit both in developing and adult rat brain [60, 61].Interestingly, reduction in synapse formation and morphological changes were correlated with alterations in NMDA-R subunits [62]. While understanding the protective role of zinc in cadmium induced neurotoxicity, it was found that exposure to cadmium affects the expression of NR2A subunits in cultured hippocampal neurons[63]. Decrease both in the mRNA expression and protein levels of NR1 and NR2A subunits in hippocampus on exposure to cadmium as observed in the present study exhibits vulnerability of NMDA receptors. Interestingly, changes in NMDA receptor subunits besides the cholinergic alteration in hippocampus as observed by us earlier[42]may contribute in cadmium induced learning and memory deficits in rats.

Calcium/calmodulin-dependent protein kinase II (CaMKIIα), a highly abundant Ca²⁺activated enzyme is one of the downstream effectors of NMDA-R [59, 64]. Its threonine-286 residue phosphorylated form is considered important for modulating learning, memory and synaptic plasticity in hippocampus [65].As calcium (Ca2+) signaling is critical for NMDA-R induced long-term potentiation (LTP), Ca2 + binds to calmodulin (CaM) andstimulatestheCaMKIIα pathway on activation of NMDA-R[66].Alterationintheactivity and expression of CaMKII has been observed earlier in rats treatedwith lead during developmental period [61]. Exposure to arsenic has also been found to suppress protein levels of CaMKII in vitro and in adult mice [67]. In a separate study, arsenic exposure during developmental period also resulted to decrease protein levels of CaMKII/pCaMKII in hippocampus of mice offspring[56]. More interestingly, these changes were found associated with alterations in NMDA-R subunits[56]. Decrease in thelevelsofCaMKIIα/pCaMKIIα at Thr286 siteas observed in the present study may be due to disarray in the normal functioning of NMDA-R subunitsinhippocampus of cadmium treated rats. Further, role ofpostsynaptic density protein (PSD-95), a signaling scaffold,iswell accepted for synaptic maturation by stabilizing and orchestrating the trafficking of NMDA-R to the postsynaptic membrane. As PSD-95 is in the middle of calcium influx and has specific downstream signaling process [68], decrease in protein levels of PSD-95 in hippocampus of cadmium treated rats may affect it. Further, decrease in protein levels of PSD-95 in the inferior temporal cortex in Alzheimer's disease has been associated with disease pathology[59].

SynGAP, a Ras GTPase activating protein and a negative regulator of Ras signaling at excitatory synapses,has important role once itinteractswith NMDA-R complex [69].Ideally, SynGAP binds at the PDZ-domain of PSD-95;a core component in postsynaptic signalingthatregulates LTP and synaptic plasticity by modulating CaMKIIα phosphorylation [70]. During theprocess, ERK½ activation has critical role to consolidate and reconsolidatethe memory[71] and thus effect on its integrity may influence the downstream signaling. While understanding the effect of zinc transporter ZnT3, exposure to cadmium was found to decrease ERK½ signaling in rat hippocampal neurons[63].Interestingly, in this study, changes appear to be interlinked suggesting that decrease in the levels of CaMKIIα may enhance levels of SynGapand could affect MAPK/ERK activation as signaled by decrease in pERK½ protein levels in hippocampus on exposure of rats to cadmium.

Among neurotrophins, BDNF and its major receptor TrkB activation contribute effectively to integrate synaptic plasticity with NMDA-R. Decrease in the expression of BDNF and NMDA-R has been reported during early life stress [72, 73] and on exposure to environmental toxicants [18] including cadmium [63].Consistent with this, decrease in protein levels of BDNF and TrkB on exposure to cadmium observed in the present study may be associated with cognitive deficits in cadmium treated rats as reported earlier[42]. The Phosphatidylinositol 3-kinases/protein kinase B (PI3K/AKT), a crucial regulator of neurotoxicity attune neuronal survival through glycogen synthase kinase-3β (GSK-3β), an important substrate,[74] which was also affected inhippocampus on exposure to cadmium in the present study.GSK3β, a ubiquitous serine/threonine kinase and one of the isoforms of GSK3 [75, 76] may modulate glycogen metabolism by different kinases at Ser9. Phosphorylation of GSK3β is an important step in the process to modulate LTP by regulating glycogen metabolism through different kinases at Ser9 [77].Involvement of GSK3β in chemical induced neurotoxicity and CNS diseases is well accepted[78].The other downstream target in the pathway is CREBthatcontrols neuronal plasticity and apoptosis in hippocampal neurons and plays important role to regulate learning and memory [79]. A number of studies have found that CREB phosphorylation at Ser 133 residue is critical to modulate learning and memory [80].It is one of the downstream substrate of Akt and effectively contributesto regulate PI3K/AKT/ERK neuronal survival pathway. The function of ERK ½ in activating CREB to lay an impact on LTP in hippocampal neurons[81]has also been observed in the present study. Although it is difficult to comment whether ERK½ directly phosphorylates CREB or needs some mediators, it is quite possible that downregulated pERK ½ in hippocampus on exposure to cadmium may affectthe CREB and could be associated with cadmium induced memory deficits in rats.

Oxidative stress due to generation of free radical species in body organs including brain is considered to be one of the potent mechanism in cadmiumneurotoxicity[82].It may be attributed to prooxidant nature of cadmium. Presences of high levels of transition metals and PUFA but not sufficient intrinsic antioxidant defense in brain enhance the risk to cause oxidative damage and it could further contribute to increased apoptosis and inflammation [83, 84]. The Nrf2 is considered to be master controller of antioxidant response element (ARE) and regulates the antioxidant enzymes. Nrf2 signaling is well controlled by Kelch-like ECH-related protein 1 (Keap1), an executor protein and a negative regulator of Nrf2. Alteration in brain Nrf2 pathway has been reported in neurodegenerative disorders including Alzheimer’s disease and Parkinson’s disease. Decrease in Nrf2 and HO-1 positive cells in hippocampus in D-galactose induced neurotoxicity in mice has been reported [40]. Further, lack of Nrf2 may enhance vulnerability of neurons to oxidative stress due to its influence on the downstream mediators including Hemeoxygenase 1 (HO-1), NADPH quinone oxidoreductase 1 (NQO1), catalase (CAT), and superoxide dismutase (SOD). Decrease in protein levels of Nrf2 and HO-1 and increase in protein levels of Keap-1 clearly exhibit that cadmium affects the anti-oxidant defense in the brain by disrupting the Nrf2-ARE signaling and it could lead to enhance oxidative stress. Accumulation of cadmium due to its long half-life in brain may further accelerate its detrimental effects and cause functional abnormalities including cognitive deficits in rats [85].Morphological and mitochondrial damage in frontal cortex and hippocampus on exposure to cadmium have been observed by us earlier. Loss of Nissl granules both in frontal cortex and hippocampus was evident in cadmium treated rats [42]. Consistent with this, degenerative changes as evident by loss of pyramidal neurons in H &E-stained sections of hippocampus on exposure to cadmium in the present study may be attributed to oxidative stress and apoptosis.

In view of the risk of cadmium induced neurotoxicity in the population, there is lot of interest to develop strategies including use of phytochemicals and natural products and explore their potential to protect deterrent effects of this transition metal. Among a number of phytochemicals, quercetin, aclass of flavonoid is preferred over others due to its extensive biological activities [35].The antioxidant potential of quercetin due to its radical scavenging activity is attributed to modulate its pharmacological spectrum including anti-inflammatory and anti-carcinogenic potential [86, 87]. The reports that this bioflavonoid crosses the blood brain barrier owing to its lipophilic nature have further fascinated to explore its protective potential in CNS abnormalities [88]. Quercetin has been found effective in the management of neurodegenerative diseases including PD and AD [89, 90] and protect neuronal injury in animal models of stroke[91]. Treatment with quercetin has also been found to alleviate chemical induced neurotoxicity by scavenging radical species [92]. A number of studies have found that activation of Nrf2-ARE pathway plays important role to modulate oxidative stress [93]. Nrf2 being a transcription factor enhances endogenous defense by modulating antioxidant defense and therefore contribute effectively to control oxidative stress [94].Co-treatment with quercetin and sitagliptin (antidiabetic medicine) was found to improve cognitive deficits in amyloid B induced AD in rats [95]. Quercetin has also been found to upregulate Nrf2 expression and protect from oxidative insults in mouse model of traumatic brain injury [96]. The protective effect of quercetin was found largely due to its ability to decrease oxidative stress by modulating Nrf2-ARE signaling pathway[94].Preclinical studies have found that Nrf2-ARE signaling is an important target of learning and memory[80]. Pretreatment with quercetin has been found to improve memoryand cognitive ability in rodents [97]. Consistent with these reports, protective changes in the expression of Nrf2, HO-1and Keap-1 on simultaneous treatment with quercetin and cadmium as observed in this study exhibit involvement of Nrf2-ARE signaling in cadmium induced cognitive deficits.

Besides antioxidant activity, intense anti-inflammatory, anti-apoptotic and anti-excitotoxicity effects contribute to enhance protective efficacy of quercetin in neurodegenerative diseases and chemical induced neurotoxicity [98–100]. In a study to understand the neuroprotective potential of rutin, okra and quercetin, pretreatment with quercetin was found to protect decrease in NR2A and NR2B subunits in hippocampus of mice treated with dexamethasone, a synthetic glucocorticoid receptor agonist [101]. Interestingly, dexamethasone induced cognitive deficits and morphological alterations in hippocampus were also protected on pretreatment with quercetin and the protective changes were associated with antioxidant potential of quercetin. Consistent with this, in the present study, simultaneous treatment with quercetinwas found to protect cadmium induced decrease in NMDA receptors (NR2A and NR2B subunits) in hippocampus. The postsynaptic signaling associated with NMDA receptors is well orchestrated through a complex mechanism involving CAMKII, a multimeric kinase. During the process, activation of CREB is important for learning and memory and well regulated by NMDA-R and calcium signaling [61]. The reports that quercetin may activate CREB levels and AKT activity are quite interesting and convincing to link with its protective potential through neuronal survival pathway [102, 103]. Simultaneous treatment with quercetin has been found to protect lead induced decrease in CAMKII, AKT and CREB and these changes were found to protect lead induced cognitive deficits in mice [104]. Quercetin has been found to protect okadaic acid induced hyper phosphorylation of tau protein and oxidative stress in hippocampal neurons [105]. Interestingly, quercetin modulated the expression of GSK3β via PI3K/AKT pathwayin okadaic acid induced neurotoxicity in hippocampal neurons [105]. Protective efficacy of quercetin in focal cerebral ischemia by modulating the PI3K/AKT pathway has also been reported [91]. More interestingly, quercetin was found to enhance levels of BDNF and its receptor TrkB in focal cerebral ischemia [91]. Activation of BDNF-TrkB was well linked to regulate MAPK and PI3K/AKTpathways and modulated apoptosis. The decrease in brain GSK-3β may also influence the CREB.These findings further strengthen the fact that quercetin is effective to modulate PI3K/AKT neuronal survival pathway.Recently, quercetin has been found to alleviate cadmium induced necroptosis by modulating oxidative stress and NF-κβ pathway in chicken brain[106].No degenerative changes and histological abnormalities in hippocampus of cadmium treated rats on simultaneous treatment with quercetin as observed in the present study are well associated with other protective changes and may be attributed to the antioxidant potential of quercetin to scavenge free radical species.

The results exhibit that exposure to cadmium may disrupt the integrity of NMDA receptors and its downstream signaling targets by affecting the Nrf2/ARE signaling pathwayin hippocampus. These changes may contribute in cadmium induced cognitive deficits. It is further interesting that quercetin has the potential to protect cadmium induced changes possibly by modulating Nrf2/ARE signaling whichwas effective to control NMDA-R and PI3K/AKT cell signaling pathway (Figure − 7).

Funding Information

The study is supported by a grant from CSIR- Indian Institute of Toxicology Research, Lucknow. Anugya Srivastava has received DST-INSPIRE fellowship and Anima Kumari has received the UGC fellowship.

Acknowledgement

The authors are thankful to the Director, CSIR- Indian Institute of Toxicology Research, Lucknow for providing necessary support for carrying out the studies. The MSS has been assigned communication number IITR/SEC/202202023/33. All data have been submitted in the repository.

Author Contributions

Experimental work hypothesized and designed by Anugya Srivastava and Dr Vinay K. Khanna. Experimental work and data analysis performed byAnugya SrivastavaandAnima Kumari. Processing of samples for histopathological studies carried out byMr.Pankaj Jagdale and data interpretation by Dr Anjaneya Ayanur. Experimental guidance provided by Dr Vinay Kumar KhannaandDr Aditya Bhushan Pant.Manuscript prepared by Anugya Srivastava and reviewed by Dr Aditya Bhushan PantandDr Vinay Kumar Khanna.

Conflict of Interest

The authors have no conflictof interest.

Gonçalves, J.F., et al., Cadmium neurotoxicity: From its analytical aspects to neuronal impairment, in Advances in Neurotoxicology. 2021, Elsevier. p. 81–113.
Satarug, S., et al., Cadmium, environmental exposure, and health outcomes. Cien Saude Colet, 2011. 16(5): p. 2587–602.
Zhang, H. and M. Reynolds, Cadmium exposure in living organisms: A short review. Sci Total Environ, 2019. 678: p. 761–767.
Andrade, V.M., M. Aschner, and A.P. Marreilha Dos Santos, Neurotoxicity of Metal Mixtures. Adv Neurobiol, 2017. 18: p. 227–265.
Alnahdi, H.S. and I.A. Sharaf, Possible prophylactic effect of omega-3 fatty acids on cadmium-induced neurotoxicity in rats' brains. Environ Sci Pollut Res Int, 2019. 26(30): p. 31254–31262.
Czarnecki, L.A., et al., Functional rehabilitation of cadmium-induced neurotoxicity despite persistent peripheral pathophysiology in the olfactory system. Toxicological Sciences, 2012. 126(2): p. 534–544.
Richter, P., O. Faroon, and R.S. Pappas, Cadmium and Cadmium/Zinc Ratios and Tobacco-Related Morbidities. Int J Environ Res Public Health, 2017. 14(10).
Gustin, K., et al., Cadmium exposure and cognitive abilities and behavior at 10 years of age: A prospective cohort study. Environ Int, 2018. 113: p. 259–268.
Bernhoft, R.A., Cadmium toxicity and treatment. ScientificWorldJournal, 2013. 2013: p. 394652.
Li, Z.X., et al., [Cadmium burden and renal dysfunction among residents in cadmium-polluted areas: A 3-year follow-up study]. Zhonghua Yu Fang Yi Xue Za Zhi, 2016. 50(4): p. 322–7.
Satarug, S., et al., A Comparison of the Nephrotoxicity of Low Doses of Cadmium and Lead. Toxics, 2020. 8(1).
Branca, J.J., et al., Selenium and zinc: Two key players against cadmium-induced neuronal toxicity. Toxicology in Vitro, 2018. 48: p. 159–169.
Méndez-Armenta, M. and C. Ríos, Cadmium neurotoxicity. Environ Toxicol Pharmacol, 2007. 23(3): p. 350–8.
Wang, B. and Y. Du, Cadmium and its neurotoxic effects. Oxid Med Cell Longev, 2013. 2013: p. 898034.
Liu, Y., et al., Hearing loss in children with e-waste lead and cadmium exposure. Sci Total Environ, 2018. 624: p. 621–627.
Ciesielski, T., et al., Cadmium exposure and neurodevelopmental outcomes in U.S. children. Environ Health Perspect, 2012. 120(5): p. 758–63.
Goyal, T., et al., Assessement of Blood Lead and Cadmium Levels in Occupationally Exposed Workers of Jodhpur, Rajasthan. Indian J Clin Biochem, 2021. 36(1): p. 100–107.
Ma, Z., et al., Alpha-synuclein is involved in manganese-induced spatial memory and synaptic plasticity impairments via TrkB/Akt/Fyn-mediated phosphorylation of NMDA receptors. Cell Death Dis, 2020. 11(10): p. 834.
Basun, H., et al., Cadmium in blood in Alzheimer's disease and non-demented subjects: results from a population-based study. Biometals, 1994. 7(2): p. 130–4.
Okuda, B., et al., Parkinsonism after acute cadmium poisoning. Clin Neurol Neurosurg, 1997. 99(4): p. 263–5.
Min, J.Y. and K.B. Min, Blood cadmium levels and Alzheimer's disease mortality risk in older US adults. Environ Health, 2016. 15(1): p. 69.
Peng, Q., et al., Cadmium and Alzheimer's disease mortality in U.S. adults: Updated evidence with a urinary biomarker and extended follow-up time. Environ Res, 2017. 157: p. 44–51.
Peng, Y., et al., Relation between cadmium body burden and cognitive function in older men: A cross-sectional study in China. Chemosphere, 2020. 250: p. 126535.
García-Esquinas, E., et al., Cadmium exposure is associated with reduced grip strength in US adults. Environ Res, 2020. 180: p. 108819.
Gupta, R., et al., Involvement of PKA/DARPP-32/PP1α and β- arrestin/Akt/GSK-3β Signaling in Cadmium-Induced DA-D2 Receptor-Mediated Motor Dysfunctions: Protective Role of Quercetin. Sci Rep, 2018. 8(1): p. 2528.
Tsentsevitsky, A.N., G.F. Zakyrjanova, and A.M. Petrov, Cadmium desynchronizes neurotransmitter release in the neuromuscular junction: Key role of ROS. Free Radic Biol Med, 2020. 155: p. 19–28.
Chen, L., L. Liu, and S. Huang, Cadmium activates the mitogen-activated protein kinase (MAPK) pathway via induction of reactive oxygen species and inhibition of protein phosphatases 2A and 5. Free Radic Biol Med, 2008. 45(7): p. 1035–44.
Xu, B., et al., Calcium signaling is involved in cadmium-induced neuronal apoptosis via induction of reactive oxygen species and activation of MAPK/mTOR network. PLoS One, 2011. 6(4): p. e19052.
Yuan, Y., et al., Cadmium-induced apoptosis in neuronal cells is mediated by Fas/FasL-mediated mitochondrial apoptotic signaling pathway. Sci Rep, 2018. 8(1): p. 8837.
Akinyemi, A.J. and P.A. Adeniyi, Effect of Essential Oils from Ginger (Zingiber officinale) and Turmeric (Curcuma longa) Rhizomes on Some Inflammatory Biomarkers in Cadmium Induced Neurotoxicity in Rats. J Toxicol, 2018. 2018: p. 4109491.
Kaur, S., N. Singla, and D. Dhawan, Neuro-protective potential of quercetin during chlorpyrifos induced neurotoxicity in rats. Drug and chemical toxicology, 2019. 42(2): p. 220–230.
Anand David, A.V., R. Arulmoli, and S. Parasuraman, Overviews of Biological Importance of Quercetin: A Bioactive Flavonoid. Pharmacogn Rev, 2016. 10(20): p. 84–89.
Kumar, R., S. Vijayalakshmi, and S. Nadanasabapathi, Health benefits of quercetin. Def. Life Sci. J, 2017. 2(10).
Dajas, F., et al., Quercetin in brain diseases: Potential and limits. Neurochem Int, 2015. 89: p. 140–8.
Babaei, F., M. Mirzababaei, and M. Nassiri-Asl, Quercetin in Food: Possible Mechanisms of Its Effect on Memory. J Food Sci, 2018. 83(9): p. 2280–2287.
Taslidere, E., et al., Quercetin protection against ciprofloxacin induced liver damage in rats. Biotech Histochem, 2016. 91(2): p. 116–21.
Islam, M.S., et al., Neuropharmacological Effects of Quercetin: A Literature-Based Review. Front Pharmacol, 2021. 12: p. 665031.
Chakraborty, J., et al., Quercetin improves behavioral deficiencies, restores astrocytes and microglia, and reduces serotonin metabolism in 3-nitropropionic acid-induced rat model of Huntington's Disease. CNS Neurosci Ther, 2014. 20(1): p. 10–9.
Salehi, B., et al., Therapeutic Potential of Quercetin: New Insights and Perspectives for Human Health. ACS Omega, 2020. 5(20): p. 11849–11872.
Dong, F., et al., Quercetin ameliorates learning and memory via the Nrf2-ARE signaling pathway in d-galactose-induced neurotoxicity in mice. Biochem Biophys Res Commun, 2017. 491(3): p. 636–641.
Yu, C. and J.H. Xiao, The Keap1-Nrf2 System: A Mediator between Oxidative Stress and Aging. Oxid Med Cell Longev, 2021. 2021: p. 6635460.
Gupta, R., et al., Protective Role of Quercetin in Cadmium-Induced Cholinergic Dysfunctions in Rat Brain by Modulating Mitochondrial Integrity and MAP Kinase Signaling. Mol Neurobiol, 2017. 54(6): p. 4560–4583.
Schwendt, M. and D. Jezová, Gene expression of NMDA receptor subunits in rat adrenals under basal and stress conditions. J Physiol Pharmacol, 2001. 52(4 Pt 2): p. 719–27.
Bancroft, J.D. and M. Gamble, Theory and practice of histological techniques. 2008: Elsevier health sciences.
Newcomer, J.W., N.B. Farber, and J.W. Olney, NMDA receptor function, memory, and brain aging. Dialogues Clin Neurosci, 2000. 2(3): p. 219–32.
Cull-Candy, S.G. and D.N. Leszkiewicz, Role of distinct NMDA receptor subtypes at central synapses. Sci STKE, 2004. 2004(255): p. re16.
Chen, B.S. and K.W. Roche, Regulation of NMDA receptors by phosphorylation. Neuropharmacology, 2007. 53(3): p. 362–8.
Spangler, E.L., et al., NMDA receptor channel antagonism by dizocilpine (MK-801) impairs performance of rats in aversively motivated complex maze tasks. Pharmacol Biochem Behav, 1991. 40(4): p. 949–58.
Pontecorvo, M.J., et al., N-methyl-D-aspartate antagonists and working memory performance: comparison with the effects of scopolamine, propranolol, diazepam, and phenylisopropyladenosine. Behav Neurosci, 1991. 105(4): p. 521–35.
Sakimura, K., et al., Reduced hippocampal LTP and spatial learning in mice lacking NMDA receptor epsilon 1 subunit. Nature, 1995. 373(6510): p. 151–5.
Kim, S.H., et al., Excessive cerebrocortical release of acetylcholine induced by NMDA antagonists is reduced by GABAergic and alpha2-adrenergic agonists. Mol Psychiatry, 1999. 4(4): p. 344–52.
Moghaddam, B., et al., Activation of glutamatergic neurotransmission by ketamine: a novel step in the pathway from NMDA receptor blockade to dopaminergic and cognitive disruptions associated with the prefrontal cortex. J Neurosci, 1997. 17(8): p. 2921–7.
Dhuriya, Y.K., et al., Prenatal exposure to lambda-cyhalothrin impairs memory in developing rats: Role of NMDA receptor induced post-synaptic signalling in hippocampus. Neurotoxicology, 2017. 62: p. 80–91.
Yuan, C.Y., G.S. Hsu, and Y.J. Lee, Aluminum alters NMDA receptor 1A and 2A/B expression on neonatal hippocampal neurons in rats. J Biomed Sci, 2011. 18(1): p. 81.
Tüzmen, M.N., et al., Effects of curcumin and tannic acid on the aluminum- and lead-induced oxidative neurotoxicity and alterations in NMDA receptors. Toxicol Mech Methods, 2015. 25(2): p. 120–7.
Zhao, F., et al., Alterations of NMDA and AMPA receptors and their signaling apparatus in the hippocampus of mouse offspring induced by developmental arsenite exposure. J Toxicol Sci, 2019. 44(11): p. 777–788.
Srivastava, P., et al., PI3K/Akt/GSK3β induced CREB activation ameliorates arsenic mediated alterations in NMDA receptors and associated signaling in rat hippocampus: Neuroprotective role of curcumin. Neurotoxicology, 2018. 67: p. 190–205.
Luo, J.H., et al., Effects of arsenic exposure from drinking water on spatial memory, ultra-structures and NMDAR gene expression of hippocampus in rats. Toxicol Lett, 2009. 184(2): p. 121–5.
Luo, J.H., et al., Arsenite exposure altered the expression of NMDA receptor and postsynaptic signaling proteins in rat hippocampus. Toxicol Lett, 2012. 211(1): p. 39–44.
Neal, A.P., P.F. Worley, and T.R. Guilarte, Lead exposure during synaptogenesis alters NMDA receptor targeting via NMDA receptor inhibition. Neurotoxicology, 2011. 32(2): p. 281–9.
Toscano, C.D., J.P. O'Callaghan, and T.R. Guilarte, Calcium/calmodulin-dependent protein kinase II activity and expression are altered in the hippocampus of Pb2+-exposed rats. Brain Res, 2005. 1044(1): p. 51–8.
Wang, Z.C., J. Zhao, and S. Li, Dysregulation of synaptic and extrasynaptic N-methyl-D-aspartate receptors induced by amyloid-β. Neurosci Bull, 2013. 29(6): p. 752–60.
Ben Mimouna, S., et al., Involvement of the synapse-specific zinc transporter ZnT3 in cadmium-induced hippocampal neurotoxicity. J Cell Physiol, 2019.
Li, X.H., et al., Characterization of postsynaptic calcium signals in the pyramidal neurons of anterior cingulate cortex. Mol Pain, 2017. 13: p. 1744806917719847.
Zalcman, G., N. Federman, and A. Romano, CaMKII Isoforms in Learning and Memory: Localization and Function. Front Mol Neurosci, 2018. 11: p. 445.
Li, X.H., H.H. Miao, and M. Zhuo, NMDA Receptor Dependent Long-term Potentiation in Chronic Pain. Neurochem Res, 2019. 44(3): p. 531–538.
Zhang, C., et al., Arsenic downregulates gene expression at the postsynaptic density in mouse cerebellum, including genes responsible for long-term potentiation and depression. Toxicol Lett, 2014. 228(3): p. 260–9.
Xu, W., PSD-95-like membrane associated guanylate kinases (PSD-MAGUKs) and synaptic plasticity. Curr Opin Neurobiol, 2011. 21(2): p. 306–12.
Komiyama, N.H., et al., SynGAP regulates ERK/MAPK signaling, synaptic plasticity, and learning in the complex with postsynaptic density 95 and NMDA receptor. J Neurosci, 2002. 22(22): p. 9721–32.
Kim, M.J., et al., Differential roles of NR2A- and NR2B-containing NMDA receptors in Ras-ERK signaling and AMPA receptor trafficking. Neuron, 2005. 46(5): p. 745–60.
Davis, S. and S. Laroche, Mitogen-activated protein kinase/extracellular regulated kinase signalling and memory stabilization: a review. Genes Brain Behav, 2006. 5 Suppl 2: p. 61–72.
Roceri, M., et al., Early maternal deprivation reduces the expression of BDNF and NMDA receptor subunits in rat hippocampus. Mol Psychiatry, 2002. 7(6): p. 609–16.
Yamada, K. and T. Nabeshima, Brain-derived neurotrophic factor/TrkB signaling in memory processes. J Pharmacol Sci, 2003. 91(4): p. 267–70.
Long, H.Z., et al., PI3K/AKT Signal Pathway: A Target of Natural Products in the Prevention and Treatment of Alzheimer's Disease and Parkinson's Disease. Front Pharmacol, 2021. 12: p. 648636.
Kim, S., et al., GSK-3β-mediated regulation of cadmium-induced cell death and survival. Cell Mol Biol Lett, 2018. 23: p. 9.
Minami, A., et al., Roles of PTEN/PI3K/AKT/GSK3b pathway in neuron signaling involved in autism. Brain Disorder & Therapy, 2015. 4: p. 165.
Fang, X., et al., Phosphorylation and inactivation of glycogen synthase kinase 3 by protein kinase A. Proc Natl Acad Sci U S A, 2000. 97(22): p. 11960–5.
Bradley, C., et al., A pivotal role of GSK-3 in synaptic plasticity. Frontiers in Molecular Neuroscience, 2012. 5.
Sakamoto, K., K. Karelina, and K. Obrietan, CREB: a multifaceted regulator of neuronal plasticity and protection. J Neurochem, 2011. 116(1): p. 1–9.
Qu, L., et al., Role of PTEN-Akt-CREB Signaling Pathway in Nervous System impairment of Rats with Chronic Arsenite Exposure. Biol Trace Elem Res, 2016. 170(2): p. 366–72.
Mizuno, M., et al., CREB phosphorylation as a molecular marker of memory processing in the hippocampus for spatial learning. Behav Brain Res, 2002. 133(2): p. 135–41.
Branca, J.J.V., et al., Cadmium-Induced Oxidative Stress: Focus on the Central Nervous System. Antioxidants (Basel), 2020. 9(6).
Buonocore, G. and F. Groenendaal, Anti-oxidant strategies. Semin Fetal Neonatal Med, 2007. 12(4): p. 287–95.
Gao, Y., et al., Resveratrol mitigates the oxidative stress mediated by hypoxic-ischemic brain injury in neonatal rats via Nrf2/HO-1 pathway. Pharm Biol, 2018. 56(1): p. 440–449.
Ashrafizadeh, M., et al., Back to Nucleus: Combating with Cadmium Toxicity Using Nrf2 Signaling Pathway as a Promising Therapeutic Target. Biol Trace Elem Res, 2020. 197(1): p. 52–62.
Wang, L., et al., Quercetin, a flavonoid with anti-inflammatory activity, suppresses the development of abdominal aortic aneurysms in mice. Eur J Pharmacol, 2012. 690(1–3): p. 133–41.
Youn, H., et al., Quercetin potentiates apoptosis by inhibiting nuclear factor-kappaB signaling in H460 lung cancer cells. Biol Pharm Bull, 2013. 36(6): p. 944–51.
Youdim, K.A., et al., Flavonoid permeability across an in situ model of the blood-brain barrier. Free Radic Biol Med, 2004. 36(5): p. 592–604.
Sabogal-Guáqueta, A.M., et al., The flavonoid quercetin ameliorates Alzheimer's disease pathology and protects cognitive and emotional function in aged triple transgenic Alzheimer's disease model mice. Neuropharmacology, 2015. 93: p. 134–45.
Sriraksa, N., et al., Cognitive-enhancing effect of quercetin in a rat model of Parkinson's disease induced by 6-hydroxydopamine. Evid Based Complement Alternat Med, 2012. 2012: p. 823206.
Yao, R.Q., et al., Quercetin attenuates cell apoptosis in focal cerebral ischemia rat brain via activation of BDNF-TrkB-PI3K/Akt signaling pathway. Neurochem Res, 2012. 37(12): p. 2777–86.
Abdalla, F.H., et al., Quercetin protects the impairment of memory and anxiogenic-like behavior in rats exposed to cadmium: Possible involvement of the acetylcholinesterase and Na(+),K(+)-ATPase activities. Physiol Behav, 2014. 135: p. 152–67.
Johnson, J.A., et al., The Nrf2-ARE pathway: an indicator and modulator of oxidative stress in neurodegeneration. Ann N Y Acad Sci, 2008. 1147: p. 61–9.
Buendia, I., et al., Nrf2-ARE pathway: An emerging target against oxidative stress and neuroinflammation in neurodegenerative diseases. Pharmacol Ther, 2016. 157: p. 84–104.
Li, Y., et al., Activation of Nrf2 signaling by sitagliptin and quercetin combination against β-amyloid induced Alzheimer's disease in rats. Drug Dev Res, 2019. 80(6): p. 837–845.
Li, X., et al., Protective Effects of Quercetin on Mitochondrial Biogenesis in Experimental Traumatic Brain Injury via the Nrf2 Signaling Pathway. PLoS One, 2016. 11(10): p. e0164237.
Braun, J.B.S., et al., Neuroprotective effects of pretreatment with quercetin as assessed by acetylcholinesterase assay and behavioral testing in poloxamer-407 induced hyperlipidemic rats. Biomed Pharmacother, 2017. 88: p. 1054–1063.
Sharma, D.R., et al., Quercetin protects against chronic aluminum-induced oxidative stress and ensuing biochemical, cholinergic, and neurobehavioral impairments in rats. Neurotox Res, 2013. 23(4): p. 336–57.
Kao, T.K., et al., Inhibition of nitric oxide production by quercetin in endotoxin/cytokine-stimulated microglia. Life Sci, 2010. 86(9–10): p. 315–21.
Silva, B., et al., Quercetin, kaempferol and biapigenin from Hypericum perforatum are neuroprotective against excitotoxic insults. Neurotox Res, 2008. 13(3–4): p. 265–79.
Tongjaroenbuangam, W., et al., Neuroprotective effects of quercetin, rutin and okra (Abelmoschus esculentus Linn.) in dexamethasone-treated mice. Neurochem Int, 2011. 59(5): p. 677–85.
Wang, X.Q., et al., Quercetin protects oligodendrocyte precursor cells from oxygen/glucose deprivation injury in vitro via the activation of the PI3K/Akt signaling pathway. Brain Res Bull, 2011. 86(3–4): p. 277–84.
Tchantchou, F., et al., Stimulation of neurogenesis and synaptogenesis by bilobalide and quercetin via common final pathway in hippocampal neurons. J Alzheimers Dis, 2009. 18(4): p. 787–98.
Liu, C.M., et al., Quercetin protects mouse brain against lead-induced neurotoxicity. J Agric Food Chem, 2013. 61(31): p. 7630–5.
Jiang, W., et al., Quercetin Protects against Okadaic Acid-Induced Injury via MAPK and PI3K/Akt/GSK3β Signaling Pathways in HT22 Hippocampal Neurons. PLoS One, 2016. 11(4): p. e0152371.
Liu, L., et al., The Alleviative Effects of Quercetin on Cadmium-Induced Necroptosis via Inhibition ROS/iNOS/NF-κB Pathway in the Chicken Brain. Biol Trace Elem Res, 2021. 199(4): p. 1584–1594.

No competing interests reported.

AnugyaSupplementaryInformation.docx

Download PDF

Version 1

posted

You are reading this latest preprint version

Role of Nrf2/ARE Signalling in Cadmium induced Alterations inNMDA ReceptorMediatedPostsynaptic Signalling inRat Hippocampus: Attenuation by Quercetin

Status:

Version 1

Abstract

Figures

1. Introduction

2. Materials And Methods

2.1. Experimental Animals and Treatment Procedure

2.2. Quantitative Real-Time PCR (RT-PCR) analysis

2.3. Western blotting and Quantification

2.4. Histological Analysis

2.5. Statistical Analysis

3. Results

3.1. Effect on mRNA expression and protein levels of NMDA receptor subunits:

3.2. Effect on the levels of post-synaptic signaling proteins:

3.3. Effect on the levels of TrkB/BDNFsignaling pathway:

3.4. Effect on the levels of PI3K/AKTsignaling:

3.5. Effect on the levels of proteins involved in MAPK/ERK/GSK3βneuronal survival pathway:

3.6. Effect on the levels of CREB:

3.7. Effect on the levels of proteins involved in Nrf2/ARE signaling:

3.8. Histological Analysis- H & E Staining

4. Discussion

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1