ALKBH5 alleviates hypoxia postconditioning injury in aged cardiomyocytes by regulating STAT3

doi:10.21203/rs.3.rs-1880078/v1

Download PDF

Research Article

ALKBH5 alleviates hypoxia postconditioning injury in aged cardiomyocytes by regulating STAT3

https://doi.org/10.21203/rs.3.rs-1880078/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Ischemic postconditioning (I/Post) reduces ischemia/reperfusion (I/R) injury by activating endogenous cardioprotection mechanisms, such as the JAK/STAT3 and PI3K/Akt pathways, which offer a traditional approach to myocardial protection. According to the previous study, cardioprotection by I/Post may lost in aged mice, and in our previous research, hypoxic postconditioning (H/Post) lacked a protective effect in senescent cardiomyocytes, which was associated with low expression of long noncoding RNA (lncRNA) H19. The N6-methyladenosine (m⁶A) modification is a dynamic and reversible process that has been confirmed plays a role in cardiovascular diseases. However, the mechanisms of m⁶A modification in myocardial I/Post remains to be explored. Neonatal cardiomyocytes were isolated from 2-day-old Sprague Dawley rats and senescence was induced by D-galactose, followed by stimulation of hypoxia-reoxygenation (H/R) and H/Post. Hypoxic injury was evaluated by cell viability and the Bcl-2/Bax protein ratio. Total m⁶A levels were measured using a colorimetric m⁶A RNA Methylation Quantification Kit and the m⁶A modified and differentially expressed mRNA was determined by methylated RNA immunoprecipitation (MeRIP). We found that H/Post increased m⁶A methylation and decreased RNA mA demethylase alkB homolog 5 (ALKBH5) expression in aged cardiomyocytes. Furthermore, ALKBH5 knockdown exacerbated injury following H/Post in senescent cardiomyocytes. Additionally, ALKBH5 regulated STAT3 expression by mediating its m⁶A modification and lncRNA H19/miR-124-3p. ALKBH5 also alleviated the H/Post injury induced by the low expression of STAT3 in aged cardiomyocytes.

aged cardiomyocytes

hypoxic postconditioning

N6-methyladenosine modification

ALKBH5

STAT3

Age is a major risk factor for ischemic cardiovascular disease, due to increased cardiac damage caused by ischemia/reperfusion (I/R) injury, leading to a poorer prognosis than that of young patients^1,2. Ischemic postconditioning (I/Post), brief intermittent episodes of I/R at the onset of reperfusion after a prolonged period of ischemia, reduces I/R injury, thereby offering a traditional approach for myocardial protection^3,4. However, the heart protection by I/Post may be lost middle-aged and old mice⁵. Besides, in our previous study, we demonstrated that hypoxic postconditioning (H/Post) effectively alleviated hypoxia-reoxygenation (H/R) injury in normal primary cardiomyocytes, but not in senescent cardiomyocytes, which exhibited a low expression of long noncoding RNA H19⁶. The reason for the differential expression of H19 in aged and normal cardiomyocytes remains to be explored.

N6-methyladenosine (m⁶A) is the most abundant endogenous mRNA modification in eukaryotes that is catalyzed by a methyltransferase complex (METTL3, METTL14, and WTAP) and removed by ALKBH5 and FTO^7,8. Several studies have reported alterations in m⁶A levels and m⁶A modification-associated genes upon exposure to myocardial infarction (MI) ^9,10. And m⁶A modification-associated genes plays a vital part in the I/R injury. METTL3 promoted DGCR8 binding to pri-miR-143-3p through m⁶A modification, enhancing miR-143-3p expression to inhibit PRKCE transcription and further aggravating cardiomyocyte pyroptosis and I/R injury¹¹. WTAP promotes myocardial I/R injury by increasing endoplasmic reticulum stress via regulating m⁶A modification of ATF4 mRNA¹². Pharmacological postconditioning also protects cardiomyocytes from H/R injury by regulating m⁶A related-genes; according to our previous research, dexmedetomidine postconditioning reduced H/R-induced injury of cardiomyocytes via the ALKBH5/lncRNA H19¹³. However, there are few research focus on the level of m⁶A and ALKBH5 on aged heart following H/R and H/Post.

Signal transducer and activator of transcription 3 (STAT3) has been demonstrated to be activated during various modes of protection against myocardial I/R injury by suppressing apoptosis, autophagy and the inflammatory response^14,15,16. In the heart of aged mice, total STAT3 and phosphorylated STAT3 in the anterior wall at reperfusion were reduced compared with young mice and the cardioprotection by I/Post was abolished in aged wild type and in STAT3-deficient mice¹⁷. The reduced STAT3 protein level in the aged mouse heart may contribute to the loss of cardioprotection by I/Post, however, the upstream regulation mechanism of STAT3 needs to be elucidated.

Therefore, the aim of this research was to explore the level of RNA m⁶A and the role of ALKBH5. We also hope to detect the mutual regulation between ALKBH5 and STAT3 in H/Post injury on aged cardiomyocytes.

Cell culture and treatment

Neonatal cardiomyocytes were isolated from 2-day-old Sprague Dawley rats purchased from Vital River Laboratory Animal Technology Co., Ltd. (Beijing, China). Our study was approved by Tianjin Medical University Cancer Institute and Hospital (No.NSFC-AE-2020047) and all experiments were conducted according to the Declaration of Helsinki and conformed to the US National Institutes of Health Guide for the Care and Use of Laboratory Animals. Hearts were cut into 1-mm³ pieces, placed in 1.5 mL Eppendorf tubes and digested at 37°C with 0.125% trypsin (Amersco, USA) and 0.1% collagenase II (Sigma, St Louis, MO, USA) until there was no obvious tissue structure. The digested cells were resuspended in Dulbecco’s modified Eagle’s medium (DMEM; Gibco, USA) supplemented with 10% fetal bovine serum, 100 U/mL penicillin G, and 100 μg/mL streptomycin, at 37°C and 5% CO₂. Fibroblasts were removed using a differential attachment technique. The dissociated cells were cultured for 48 h in a medium containing 0.1 mmol/L bromodeoxyuridine to prevent proliferation of non-myocytes. After 4 days in culture, the various treatments described below were performed.

H9c2, HEK293A cells purchased from the Shanghai Institute of Cell Biology (Shanghai, China). Cells were cultured in DMEM supplemented with 10% fetal bovine serum, 100 U/mLpenicillin G, and 100 μg/mL streptomycin, at 37°C and 5% CO₂.

To induce hypoxia-reoxygenation (H/R) injury, the medium was changed to Hanks’ balanced salt solution (Gibco) and cells were cultured at 37°C in a hypoxic incubator (Billups-Rothenberg, USA) filled with pre-mixed gas (5% CO₂ and 95% N₂) for 6 h. H/Post was performed after 6 h of hypoxia by exposing cells to three cycles of 30 min of hypoxia and 30 min of reoxygenation. After hypoxia or H/Post, the cells were transferred to normal culture medium and kept in an incubator for12 h of reoxygenation.

D-galactose (Sigma) was dissolved in DMEM at 0, 5, 10, or 20 g/L to induce senescence of primary cardiomyocytes and was added to the primary cardiomyocyte cultures for different incubation periods.

Senescence-associated β-galactosidase (SA-β-gal) assay

SA-β-gal staining was performed using an SA-β-gal staining kit (Beyotime, Shanghai, China) according to the manufacturer’s instructions. Briefly, cells were washed in phosphate-buffered saline (PBS, Gibco), fixed with fixative solution for 15 min at room temperature, and rinsed three times with PBS. Subsequently, the cells were incubated overnight at 37°C with the staining solution mix. The percentage of senescent cells (blue staining) was calculated in five randomly chosen fields of view for each sample. The assay was performed in triplicate.

Cell transfection

The siRNAs against rat ALKBH5 and STAT3 as well as rno-miR-124-3p mimics, rno-miR-124-3p inhibitor, and their negative controls (NC) were purchased from Genepharma (Shanghai, China). The previously confirmed siRNA sequences used in the study are shown in the Supplemental Materials (Table 1). Two of siRNAs and their mix were transfected into cells. ALKBH5 siRNA, STAT3 siRNA, their mix, rno-miR-124-3p mimics, rno-miR-124-3p inhibitor, or their negative controls (100 nM) were combined with Lipofectamine RNAimax (Invitrogen, Carlsbad, CA, USA) and transfected according to the manufacturer’s instructions. After 48 h, samples were used in the described experiments.

The full-length sequence of H19 was cloned into pCDNA3.0 to generate the H19 expression vector, pCDNA3.0-H19. The vectors were transfected using Lipofectamine 2000 reagent (Invitrogen). After 48 h, samples were used in the further experiments.

The coding sequence region of the ALKBH5 sequence used for constructing Ad-ALKBH5 was extracted from rat heart and inserted into adenoviral vectors. The empty vector, Ad-Null, was used as a control for Ad-ALKBH5. The vectors were transfected into HEK293A cells and the virus was collected. After transfect the virous in the primary cells 24 h, samples were used in the following experiments.

Cell viability assessment

The cell counting kit 8 (CCK-8) assay (Dojindo, Kumamoto, Japan) was used to detect cell viability according to the manufacturer’s protocol. Cells were seeded in 96-well tissue culture plates at a density of 2 × 10⁴ cells/mL and treated or transfected. After treatment, cells were cultured in DMEM with 10% CCK-8 for 1 h, and then cell viability was determined by measuring the optical absorbance at 450 nm. The assay was performed in triplicate.

Quantitative real-time PCR (qRT-PCR)

Total RNA was extracted with Trizol and chloroform, precipitated with isopropyl alcohol, washed with 75% ethanol, dissolved in diethyl pyrocarbonate (DEPC)-treated water, dried, and dissolved in RNase-free water. RNA was reverse transcribed with a reverse transcriptase kit (Takara, Kusatsu, Japan) and subjected to qRT-PCR using SYBR Green (Takara) according to the manufacturer’s instructions. The primers used for the qRT-PCR are listed in the Supplementary Materials (Table 1). qRT-PCR was carried out on a CFX96 TM Real-time System instrument (Bio-Rad, Hercules, CA, USA). GAPDH was used as an endogenous control.

miRNA was converted into cDNA using a miRcute Plus miRNA First-Strand cDNA Synthesis Kit (TIANGEN, Beijing, China) and was quantified with a miRcute miRNA qPCR Detection Kit (TIANGEN). U6 was used as a reference gene.

Each sample was run in triplicate. Comparative quantification was performed using the 2^−ΔΔCt method.

Dual-Luciferase Reporter Assay

The reporter assay was performed using the Dual Luciferase Reporter Assay kit (Promega, Madison, WI, USA). Briefly, co-transfection of wild type (wt) or mutant (mut) pGL3 vectors in H9c2 cells revealed H19 and STAT3 3¢-UTR with miR-124-3p mimics or mimic NC, respectively. At 48 h post transfection, the luciferase activity was measured.

Immunoblotting

Cells were rinsed twice with PBS, and then lysed for 30 min on ice in lysis buffer containing phenylmethylsulfonyl fluoride (PMSF). Proteins were quantified using a BCA Protein Assay Kit (Beyotime). After separation using sodium dodecyl sulfate-polyacrylamide gel electrophoresis, proteins were transferred onto polyvinylidene difluoride (PVDF) membranes, which were then blocked with non-fat milk for 1 h at room temperature. The PVDF membranes were incubated with the primary antibody at 4°C overnight, washed with PBS, and incubated with the horseradish peroxidase-conjugated secondary antibody at 37°C for 1 h. Signals were detected using a chemiluminescence imaging system (Bio-Rad). Blots were probed with antibodies against Bcl-2, Bax, ALKBH5 (Proteintech, Wuhan, China), p53 (Cell Signaling Technology, Danvers, MA, USA), STAT3, and phospho-STAT3-Y705 (Affinity, Changzhou, China), and with GAPDH (Santa Cruz Biotechnology, Dallas, TX, USA) as a loading control.

m⁶A Quantification

Total RNA was extracted from cells. Changes in total m⁶A levels of mRNA were measured using an m⁶A RNA Methylation Quantification Kit (Colorimetric; Abcam, Cambridge, UK) according to the manufacturer’s protocol. For analysis of each sample, 200 ng of RNA was coated on an assay well, and then the capture antibody solution and detection antibody solution were added individually at the required dilutions. m⁶A levels were quantified colorimetrically by reading the absorbance at a wavelength of 450 nm; calculations were performed based on a standard curve.

RNA immunoprecipitation

RNA immunoprecipitation (RIP) experiments were performed using the Magna RIP RNA-Binding Protein Immunoprecipitation Kit (Millipore Corporation, Burlington, MA, USA) according to the manufacturer’s protocol. Briefly, antibodies against m⁶A (SYSY, Goettingen, Germany) or IgG bound to magnetic beads were diluted to 1:50. H9c2 cells transfected with NC or siALKBH5 for 48 h were lysed in RIP lysis buffer. Samples of each lysate were aliquoted to serve as input controls, while the remaining lysates were immunoprecipitated with the precipitation magnetic beads. Beads and input were then treated with proteinase K buffer solution for 30 min at 55°C. Then, RNA was isolated and purified by phenol:chloroform:isoamyl alcohol extraction from inputs and precipitation magnetic beads. The immunoprecipitated RNA was subsequently analyzed using RT-qPCR.

Statistical Analysis

Data are expressed as the mean ± standard deviation (SD) of at least three independent replicates. Comparisons between two groups or multiple groups were performed using Student’s t-test or one-way analysis of variance followed by Tukey’s multiple comparisons test, respectively. All the analyses were performed using GraphPad Prism version 8.0 software (GraphPad Software, USA). Differences were considered statistically significant if P < 0.05.

1. ALKBH5 expression decreases in aged cardiomyocytes

Cardiomyocytes were extracted, isolated, and seeded in 96-well plates at a density of 5×10⁴ cells/L until Day 4. Then, the media were replaced with media containing D-galactose (final concentrations 0, 5, 10, or 20 g/L). CCk-8 was used to examine the cell growth at 24, 48, and 72 h, and the OD450 value was recorded. The results showed that the viability of cardiomyocytes treated with different D-galactose concentrations gradually decreased with the increase in time and concentration (Fig. 1A). Next, the cells were stained with SA-β-gal and the proportion of dyed dark blue cells was calculated. The results showed that with the increase in D-galactose concentration, the proportion of cell senescence was significantly increased (Fig. 1B). Furthermore, the protein expression of senescence-related protein p53 was upregulated with the increase in D-galactose concentration, while ALKBH5 expression decreased (Fig. 1C).

2. H/Post increases m⁶A methylation and decreases ALKBH5 expression in aged cardiomyocytes

After 48 h in culture, D-galactose or normal DMEM was added and cardiomyocytes were exposed to H/R and H/Post. Figure 2A shows the optical microscope images of cells after the different treatments. RNA was extracted from each treatment group, and the content of total m⁶A RNA in normal and aging cells were measured by a colorimetric method. Compared with the H/R group, in the normal cells the total m⁶A RNA was decreased after H/Post, while in senescent cells this effect was not observed (Fig. 2B). We further examined the ALKBH5 RNA and protein expression levels. Compared with the control, ALKBH5 expression in senescent cardiomyocytes was decreased following H/R and H/Post. However, in normal cells, ALKBH5 expression was increased after H/Post compared with the H/R group (Fig. 2C, D). The increased total m⁶A RNA level and decreased ALKBH5 expression may be the reason for the reduced protection of H/Post in aged heart.

3. ALKBH5 knockdown aggravates injury following H/Post in senescent cardiomyocytes

For higher and more stable transfection efficiency, we used the rat heart cell line H9c2. The transfection efficiency was determined by western blotting after 48 h of transfection of different ALKBH5 siRNAs into H9c2 (Fig. 3A). To examine cell viability, after 48 h of culture with D-galactose, primary cardiomyocytes were transfected with the siALKBH5 mix to reduce ALKBH5 expression. Within 48 h of transfection, the cell viability was decreased in ALKBH5-knockdown cardiomyocytes treated with H/Post, compared with the H/Post plus NC group (Fig. 3B). Furthermore, the ratio of Bcl-2/Bax protein expression in the H/Post plus siALKBH5 group was lower than that in the H/Post plus NC group (Fig. 3C). Therefore, knockdown of ALKBH5 exacerbated injury following H/Post in senescent cardiomyocytes.

4. ALKBH5 regulates the m⁶A modification of STAT3

STAT3 signaling controls intercellular communication, signal transduction, and gene transcription, and has been demonstrated to be involved in myocardial I/Post. Therefore, we measured the expression of STAT3 following H/Post in primary cardiomyocytes. STAT3 and P-STAT3 protein expression was decreased in senescent cells after H/Post, while in normal cells it was not (Fig. 4A). In our previous research, H19 was similarly decreased after H/Post in aged cells⁵. Thus, we investigated the regulatory relationship between ALKBH5 and STAT3. To this end, we transfected the siALKBH5 mix into H9c2 cells to downregulate ALKBH5 expression. After 48 h, STAT3 expression was decreased at the mRNA and protein levels (Fig. 4B, C). However, when STAT3 was knocked down, the expression of ALKBH5 was not upregulated (Fig. S1). To investigate the mechanism by which ALKBH5 regulates STAT3, we knocked down ALKBH5 and measured the m⁶A methylation levels of STAT3. We found that STAT3 m⁶A methylation was increased after ALKBH5 knockdown in H9c2 cells (Fig. 4D).

5. STAT3 is regulated by H19/miR-124-3p

In our previous research, we verified ALKBH5 regulate H19 expression and H19 play an important part in aged cardiomyocytes following H/Post⁵^,¹³^. Therefore, we hypothesis H19 may also mediate STAT3 expression by sponging microRNAs. Firstly, using bioinformatics methods, miR-124-3p was predicted to bind to 3’-UTR of STAT3 and the binding sites in STAT3 are high conservative (Fig. 5A). After 48 h of treatment with D-galactose, miR-124-3p expression was increased in primary cardiomyocytes treated with H/Post (Fig. 5B). When miR-124-3p was overexpressed by transfecting mimics into H9c2 cells, STAT3 and P-STAT3 expression was decreased. In contrast, knockdown of miR-124-3p by transfecting the inhibitor increased the expression of STAT3 and P-STAT3 in H9c2 cells (Fig. 5C). To investigate the mechanism, wt and mutant sequences of potential binding sites for miR-124-3p in STAT3 were cloned into reporter plasmids (Fig. 5D), which were co-transfected into H9c2 cells. The luciferase assay showed that the wt but not the mutated reporter was suppressed by the rno-miR-124-3p mimics (Fig. 5E). According to the bioinformatics analysis, we also predicted that lncRNA H19 regulates miR-124-3p by suppressing its expression (Fig. 6A). After transfecting H9c2 cells with the H19 expression vector, pcDNA3.0-H19, the expression of miR-124-3p was decreased (Fig. 6B). In contrast, H19 knockdown in H9c2 cells by transfecting them with siH19 increased the expression of miR-124-3p (Fig. 6B). Next, we constructed reporter plasmids with wt or mutant sequences of potential binding sites of H19 with miR124-3p (Fig. 6C). The predicted effect of H19 on miR-124-3p expression was verified by the luciferase reporter gene assays in H9c2 cells (Fig. 6D).

6. STAT3 knockdown exacerbates H/Post injury in senescent cardiomyocytes

To choose the best siRNA for STAT3, two siSTAT3 and their mix were transfected into H9c2 cells. STAT3 and P-STAT3 expression levels in H9c2 cells were examined after 48 h by western blotting (Fig. 7A). Next, we used Ad-Null and Ad-ALKBH5 viruses to infect primary cardiomyocytes, and then measured the expression of ALKBH5, STAT3, P-STAT3, and GAPDH after 24 h (Fig. 7B). To determine the function of STAT3, cells transfected with siSTAT3 mix or NC for 48 h were treated with H/Post. To elucidate the regulation of ALKBH5, the cells infected with Ad-Null or Ad-ALKBH5 viruses for 24 h were then transfected with siSTAT3. After 48 h, these cells were treated with H/Post. The effect of altered STAT3 and ALKBH5 expression on senescent cardiomyocytes subjected to H/Post was examined by cell viability assays and Bcl-2/Bax western blot analysis. We found that the H/Post injury was exacerbated by STAT3 knockdown and alleviated by ALKBH5 upregulation (Fig. 7C, D).

According to our study, the impaired H/Post protective effect on senescent cardiomyocytes was associated with the increased total m⁶A RNA level and decreased expression of ALKBH5. ALKBH5 regulated the expression and activity of STAT3 by mediating its m⁶A modification. ALKBH5 also regulated STAT3 via H19/miR-124-3p.

RNA methylation is the most common type of RNA modification in eukaryotes, and the RNA m⁶A modification level may be a potential diagnostic biomarker of acute MI¹⁸. The m⁶A mRNA dot blot assay showed that the methylation level of m⁶A mRNA increased in H9c2 cells and neonatal mouse ventricular cardiomyocytes after H/R¹⁹. A study that performed m⁶A quantification analysis of mRNA from Day 1 and Day 7 mouse hearts found that the total RNA m⁶A methylation was significantly increased after birth²⁰. In our study, the total RNA m⁶A modification level was increased after H/R in normal cells, but it was decreased following H/Post. However, in senescent cells this effect was not observed (Fig. 2B). We also found that the expression of ALKBH5 was decreased in aged cardiomyocytes following H/R as well as H/Post, and thus explored its role. We demonstrated that ALKBH5 knockdown exacerbated the H/Post injury in aged cells. In an in vivo research, after injection of AAV9-ALKBH5 on Day 4, an I/R model was established on Day 7. On Day 21, the ALKBH5 mRNA and protein levels in heart tissue were significantly increased, while the m⁶A-modified mRNA levels were decreased and the scar of myocardial infarction was significantly decreased²⁰. Therefore, ALKBH5 may contribute to a strategy for alleviating ischemia injury both in aged and neonatal hearts. Our current study verified the function of ALKBH5 in aged cardiomyocytes following H/Post.

DNA methylation leads to chromatin condensation and gene expression changes. Similarly, RNA m⁶A modification can affect all phases of the mRNA life cycle, such as splicing, nuclear export, stability, translation, and degradation^21,²². To explore the mechanism of ALKBH5 in H/Post in aged heart, we hypothesized that ALKBH5 regulates the mRNA m⁶A level of downstream genes. In another study, the m⁶A-modified and differentially expressed mRNAs were determined by MeRIP-seq and RNA-seq in ALKBH5-overexpressing HL-1 cells. This study suggested that a triple functional domain (Trio) mRNA can be upregulated by reducing the m⁶A level of the Trio mRNA²³. Several studies have indicated that the STAT3 signaling pathway is an important player in myocardial I/R injury and that it plays an important part in cardioprotective conditioning strategies, such as pre- and postconditioning strategies²⁴. The activation of STAT3 has been demonstrated to reduce cardiac apoptosis during myocardial ischemic injury²⁵. STAT3 deficiency contributes to the incidence of autophagy in cardiac HL-1 cells²⁶. Impaired downregulation of STAT3 activation in subacute infarction has been demonstrated to promote cardiac inflammation²⁷. In summary, STAT3 has been demonstrated to protect hearts from I/R injury through regulation of several myocardial processes including apoptosis, autophagy, and inflammation. STAT3 mRNA expression in HTR-8 cell line decreased after ALKBH5 knockdown by RNA sequencing²⁸. Herein, we observed similar expression patterns of STAT3 and ALKBH5, thus verifying the regulatory relationship between these proteins. Namely, ALKBH5 regulated the expression and activity of STAT3 by increasing its m⁶A modification level and decreasing its expression.

Numerous studies have indicated that lncRNAs can interact with miRNAs as a competitive endogenous RNA, to regulate downstream gene expression²⁹^,30. Bioinformatics methods (DIANA tools, LncBase v.2, microRNA.org) predicted the upstream regulation of STAT3. In our study, miR-124-3p suppressed protein expression by binding to the 3′-UTR of STAT3 mRNA, and H19 bound to miR-124-3p to decrease the free miRNA. The direct interaction was verified by luciferase reporter assays. In our previous research, we showed that ALKBH5 mediated H19 expression in H9c2 cells. Therefore, ALKBH5 may also regulate the STAT3 via H19/miR-124-3p regulation.

Finally, we also examined the function of STAT3 in aged primary cardiomyocytes. When STAT3 was knocked down, the H/Post injury in aged cells was exacerbated. However, when ALKBH5 was overexpressed by adenoviral infection in STAT3-deficient cells, the hypoxia injury was alleviated.

In conclusion, we demonstrated that the reduced protective effect of H/Post in senescent cardiomyocytes was associated with an increased total RNA m⁶A level and suppressed ALKBH5 expression. ALKBH5 regulated the expression and activity of STAT3 by mediating its m⁶A modification. ALKBH5 also regulated STAT3 expression via H19/miR-124-3p, which alleviated the H/Post injury induced by reduced STAT3 expression (Fig. 8).

Data Availability

The data used to support the findings of this study are available from the corresponding author upon request.

Author contributions

Yiqing Yin and Xuan Zhang conceived the study and designed the experiments. Xuan Zhang and Feixiang Li performed most of the experiments. Xuan Zhang and Xiaobei Zhang wrote the manuscript. All authors agreed on its contents before submission.

Funding

This research was conducted with the support of the National Natural Science Foundation of China (82001479).

Conflict of interest

The authors declare that they have no competing interests.

Odden MC, Coxson PG, Moran A, Lightwood JM, Goldman L et al (2011) The impact of the aging population on coronary heart disease in the United States. Am J Med 124(9):827–833
Ferdinandy P, Schulz R, Baxter GF (2007) Interaction of cardiovascular risk factors with myocardial ischemia/reperfusion injury, preconditioning, and postconditioning. Pharmacol Rev 59(4):418–458
Hausenloy DJ, Yellon DM (2007) Preconditioning and postconditioning: united at reperfusion. Pharmacol Ther 116(2):173–191
Tsang A, Hausenloy DJ, Mocanu MM et al (2004) Postconditioning: a form of "modified reperfusion" protects the myocardium by activating the phosphatidylinositol 3-kinase-Akt pathway. Circ Res 95(3):230–232
Perez V, D Annunzio V, Mazo T, Marchini T, Caceres L, Evelson P, Gelpi RJ (2016) Ischemic postconditioning confers cardioprotection and prevents reduction of Trx-1 in young mice, but not in middle-aged and old mice. Mol Cell Biochem 415(1–2):67–76
Zhang X, Cheng L, Xu L et al (2019) The lncRNA, H19 Mediates the Protective Effect of Hypoxia Postconditioning against Hypoxia–Reoxygenation Injury to Senescent Cardiomyocytes by Targeting MicroRNA-29b-3p. SHOCK 52(2):249–256
Fu Y, Dominissini D, Rechavi G, He C (2014) Gene Expression Regulation Mediated through Reversible m⁶A RNA Methylation. Nat Rev Genet 15:293–306
Dominissini D, Moshitch-Moshkovitz S, Schwartz S, Salmon-Divon M, Ungar L, Osenberg S et al (2012) Topology of the human and mouse m⁶A RNA methylomes revealed by m⁶A-seq. Nature 485(7397):201–206
Shi X, Cao Y, Zhang X, Gu C, Liang F, Xue J et al (2021) Comprehensive Analysis of N6-Methyladenosine RNA Methylation Regulators Expression Identify Distinct Molecular Subtypes of Myocardial Infarction.Front Cell Dev Biol. ; 9
Qi L, Hu H, Wang Y, Hu H, Wang K, Li P et al (2022) New insights into the central sympathetic hyperactivity post-myocardial infarction: Roles of METTL3-mediated m⁶A methylation.J Cell Mol Med. 02;26(4).
Wang X, Li Y, Li J, Li S, Wang F (2022) Mechanism of METTL3-mediated m⁶A modification in cardiomyocyte pyroptosis and myocardial ischemia-reperfusion injury.Cardiovasc Drugs Ther. [Epub ahead of print].
Wang J, Zhang J, Ma Y, Zeng Y, Lu C, Yang F et al (2021) WTAP promotes myocardial ischemia/reperfusion injury by increasing endoplasmic reticulum stress via regulating m⁶A modification of ATF4 mRNA.Aging.03 26;13(8).
Zhang X, Fu Q, Xu L et al (2020) Dexmedetomidine Postconditioning Alleviates Hypoxia/Reoxygenation Injury in Senescent Myocardial Cells by Regulating LncRNA H19 and m6A Modification. Oxidative Medicine and Cellular Longevity, 2020
Wang M, Zhang W, Crisostomo P et al (2007) Endothelial STAT3 plays a critical role in generalized myocardial proinflammatory and proapoptotic signaling. Am J Physiol Heart Circ Physiol 293(4):H2101–H2108
Elschami M, Scherr M, Philippens B et al (2013) Reduction of STAT3 expression induces mitochondrial dysfunction and autophagy in cardiac HL-1 cells. Eur J Cell Biol 92(1):21–29
Lim CP, Fu XY (2012) Multiple roles of STAT3 in cardiovascular inflammatory responses. Prog Mol Biol Transl Sci 106:63–73
Boengler K, Buechert A, Heinen Y, Roeskes C, Hilfiker-Kleiner D et al (2008) Cardioprotection by ischemic postconditioning is lost in aged and STAT3-deficient mice. Circ Res 102:131–135
Tong X, Zhao X, Dang X, Kou Y, Kou J (2022) Predicting Diagnostic Gene Biomarkers Associated With Immune Checkpoints, N6-Methyladenosine, and Ferroptosis in Patients With Acute Myocardial Infarction.Front Cardiovasc Med;9
Song H, Feng X, Zhang H, Luo Y, Huang J, Lin M et al (2019) METTL3 and ALKBH5 oppositely regulate m6A modification of TFEB mRNA, which dictates the fate of hypoxia/reoxygenation-treated cardiomyocytes.Autophagy. 15(8)
Han Z, Wang X, Xu Z et al (2021) ;11(6)
Ficz G (2015) New insights into mechanisms that regulate DNA methylation patterning. J Exp Biol 218:14–20
Jonkhout N, Tran J, Smith MA, Schonrock N, Mattick JS, Novoa EM et al (2017) The RNA modification landscape in human disease. RNA 23:1754–1769
Li J, Chen J, Zhao M, Li Z, Liu N, Fang H et al (2022) Downregulated ALKBH5 contributes to myocardial ischemia/reperfusion injury by increasing m⁶A modification of Trio mRNA.Ann Transl Med. 10(7)
Kleinbongard P, Skyschally A, Gent S, Pesch M, Heusch G (2017) STAT3 as a common signal of ischemic conditioning: a lesson on “rigor and reproducibility” in preclinical studies on cardioprotection. Basic Res Cardiol 113:3
Barry SP, Townsend PA, McCormick J et al (2009) STAT3 deletion sensitizes cells to oxidative stress. Biochem Biophys Res Commun 385(3):324–329
Elschami M, Scherr M, Philippens B et al (2013) Reduction of STAT3 expression induces mitochondrial dysfunction and autophagy in cardiac HL-1 cells. Eur J Cell Biol 92(1):21–29
Hilfiker-Kleiner D, Shukla P, Klein G et al (2010) Continuous glycoprotein-130-mediated signal transducer and activator of transcription-3 activation promotes inflammation, left ventricular rupture, and adverse outcome in subacute myocardial infarction. Circulation 122(2):145–155
Li XC, Jin F, Wang BY et al (2019) The m⁶A demethylase ALKBH5 controls trophoblast invasion at the maternal-fetal interface by regulating the stability of CYR61 mRNA. Theragnostic 9(13):3853–3865
Long B, Li N, Xu XX et al (2018) Long noncoding RNA FTX regulates cardiomyocyte apoptosis by targeting miR-29b-1-5p and Bcl2l2. Biochem Biophys Res Commun 495(1):312–318
Wang K, Liu CY, Zhou LY, Wang JX, Wang M, Zhao B et al APF lncRNA regulates autophagy and myocardial infarction by targeting miR-188-3p. Nature communications.2015, 6:6779

Table1. List of primers used for real-time PCR and siRNA sequences

ALKBH5	F	5'-ATTCTCAGGAAGACAAGATTAG-3'
ALKBH5	R	5'-TTTTCTTCTTTGTCCATTTC-3'
siALKBH5	810	GCCUCAGGACAUCAAAGAATT
siALKBH5	1016	GGAUCCUGGAAAUGGACAATT
miR-124-3p	F	5’-TAAGGCACGCGGTGAATG-3’
miR-124-3p	R	From the miRNA qPCR Kit
U6	F	5’-CTCGCTTCGGCAGCACA-3’
U6	R	5’-AACGCTTCACGAATTTGCGT-3’
miR-124-3p mimic		UAAGGCACGCGGUGAAUGCC
miR-124-3p inhibitor		CAGUACUUUUGUGUAGUACAA
siH19	796	5’-GCAGGUGAGUCUCCUUCUUTT-3’
siH19	1687	5’-GCUGCACUCAGAACCACUATT-3’
STAT3	F	5’-GCAGTTTAGACAGGGAGGGG-3’
STAT3	R	5’-CACTGTCTCTGGGGCTGAAG-3’
STAT3	511	UUUAUAGUUGAAAUCAAAGUC
STAT3	1072	AAUUUUAAGCUGAUAAUUCAA
GAPDH	F	5’-GCCAAAAGGGTCATCATCTC-3’
GAPDH	R	5’-GGCCATCCACAGTCTTCT-3’

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

ALKBH5 alleviates hypoxia postconditioning injury in aged cardiomyocytes by regulating STAT3

Status:

Version 1

Abstract

Figures

Introduction

Methods

Cell culture and treatment

Dual-Luciferase Reporter Assay

RNA immunoprecipitation

Statistical Analysis

Results

1. ALKBH5 expression decreases in aged cardiomyocytes

2. H/Post increases m⁶A methylation and decreases ALKBH5 expression in aged cardiomyocytes

3. ALKBH5 knockdown aggravates injury following H/Post in senescent cardiomyocytes

4. ALKBH5 regulates the m⁶A modification of STAT3

5. STAT3 is regulated by H19/miR-124-3p

6. STAT3 knockdown exacerbates H/Post injury in senescent cardiomyocytes

Discussion

Declarations

References

Tables

Additional Declarations

Status:

Version 1

ALKBH5 alleviates hypoxia postconditioning injury in aged cardiomyocytes by regulating STAT3

Status:

Version 1

Abstract

Figures

Introduction

Methods

Cell culture and treatment

Dual-Luciferase Reporter Assay

RNA immunoprecipitation

Statistical Analysis

Results

1. ALKBH5 expression decreases in aged cardiomyocytes

2. H/Post increases m6A methylation and decreases ALKBH5 expression in aged cardiomyocytes

3. ALKBH5 knockdown aggravates injury following H/Post in senescent cardiomyocytes

4. ALKBH5 regulates the m6A modification of STAT3

5. STAT3 is regulated by H19/miR-124-3p

6. STAT3 knockdown exacerbates H/Post injury in senescent cardiomyocytes

Discussion

Declarations

References

Tables

Additional Declarations

Status:

Version 1

2. H/Post increases m⁶A methylation and decreases ALKBH5 expression in aged cardiomyocytes

4. ALKBH5 regulates the m⁶A modification of STAT3