WITHDRAWN: The Double Glycoprotein Rabies Virus Strain Shows Increased Propagation Rate and Boosted Immunogenicity.

doi:10.21203/rs.3.rs-1911773/v1

Download PDF

Research Article

WITHDRAWN: The Double Glycoprotein Rabies Virus Strain Shows Increased Propagation Rate and Boosted Immunogenicity.

https://doi.org/10.21203/rs.3.rs-1911773/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this older preprint version

Read the latest preprint version →

The full text of this preprint has been withdrawn by the authors while they make corrections to the work. Therefore, the authors do not wish this work to be cited as a reference. Questions should be directed to the corresponding author.

Editorial notes are used to provide important context regarding the topic of a preprint or to alert readers to potential issues concerning that preprint or a downstream publication associated with it. For more information on editorial notes, see our Editorial Policies.

Background

Rabies is a neurotropic virus that causes about 59000 deaths worldwide annually. The most effective means to control and prevent rabies is prevention through proper pre- and post-exposure vaccination. Glycoprotein (G) is one of five structural proteins of the rabies virus and has a pivotal role in host immunity against the virus. This research has evaluated the results of incorporating an additional copy of the glycoprotein gene in the rabies virus genome on the immunogenicity and propagation rate of the recombinant virus.

Methods

. A PCR amplified copy of the G gene was previously inserted into the genome of the rabies virus PV strain. The recombinant virus glycoprotein expression was compared with the PV strain. The propagation rate of the recombinant virus in cell culture and its immunogenicity in BALB/c mice were assessed. The rapid fluorescent focus inhibition test (RFFIT) was used to analyze the virus-neutralizing antibodies (VNAs) in the mice sera.

Results

The addition of an extra G gene between the G and L genes was verified in the rescued recombinant virus. The virus strain carrying two G (dG) showed significantly higher virus titers and glycoprotein expression levels in cell culture and also induced higher titers of VNAs when applied in mice as an experimental vaccine.

Conclusion

Our results suggest that duplication of the G gene in the PV virus genome between G, and L genes leads to increased G expression level, higher virus propagation rates and improved VNA induction. The recombinant dG strain might be characterized for application in rabies vaccine production, and it can also be used to study different cellular pathways related to the rabies virus cycle.

Rabies virus

Glycoprotein

Reverse genetics

Immunogenicity

Rabies is acute lethal encephalitis caused by the highly neurotropic rabies virus (RABV). RABV belongs to the lyssavirus genus and Rhabdoviridae family, spreading throughout the world [1]. Members of this genus cause more than 59,000 human deaths each year globally, mostly in underprivileged regions of Asia and Africa [2]. There is no cure for rabies, and once the clinical symptoms appear, rabies is almost always fatal. Nevertheless, it is a hundred percent preventable provided that the standard preventive and post-exposure treatments against the rabies virus are implemented [3, 4]. There is no antiviral drug against rabies, and the focus is on immuno-vaccination to counter the rabies virus attack. Since the original innovation by Louis Pasteur, a certain number of rabies vaccines have been developed and produced. Some have been discontinued based on the WHO recommendations or have not reached the level of approval and market authorization [3, 5].

On the other hand, vaccines that have reached the level of safety and effectiveness are limited [6]. Besides, due to the costs devoted to the production and quality, those vaccines are not easily affordable in regions where they are more required. Less expensive rabies vaccines with more immunogenicity are needed for better rabies control [7]. Important investigations and efforts have been made to moderate the costs while maintaining the safety and efficacy of the rabies vaccine.

Live attenuated recombinant vaccines have been demonstrated to be effective in generating specific and long-term immune responses in different animal models [8]. However, those viral expression systems pose safety concerns due to the potential pathogenicity of the vector. Infectious viruses with the capability for a single round of replication have also demonstrated reliable performance. Those viruses are defective for one or more genomic elements, which must be complemented with the virion-producing cell line during the production [9]. Although this technology has broadly been used to develop replication-deficient influenza viruses, additional safety approvals would be necessary for viruses with higher pathogenicity before utilization in vaccine production [8, 10, 11]. At present, live rabies virus of any type is not allowed through the parenteral route, and all rabies vaccines endorsed by the WHO are based on the classic form of inactivated whole virus particles amplified in animal cell culture systems [4, 12]. The glycoprotein of the rabies virus is the crucial component for immunogenicity against rabies. Molecular manipulation of the glycoprotein gene is a means to achieve broader antigenic coverage in order to target various genotypes of the rabies viruses. Increasing the immunogenicity of this molecule is another means to improve vaccine efficacy and quality [13]. The virus immunogenicity has also been enhanced by manipulating the virus’s glycoprotein [14, 15] or by inserting non-viral genes in the virus genome [16]. In the present study, we analyzed glycoprotein expression, propagation rate and immunogenicity of the new virus in comparison with the original PV strain. This type of modified virus is also more consistent with WHO guidelines for manufacturing the rabies vaccine [6]. Preceding studies have demonstrated the superiority of the rabies virus with double glycoprotein both in propagation rate and immunogenicity [14]. Hence achieving a more efficient virus would ease access to appropriate human rabies vaccines.

2.1 Cells, viruses and genetic constructs

The T7BHK cell line, the BHK21 cell line, the CVS-11 strain of rabies virus, and the BALB/c mice were kindly provided by the Pasteur Institute of Iran. T7BHK cells were used to rescue the virus from the plasmids, which were under the control of the T7 promoter. BHK21 cells were used for virus propagation and determining the titer of the virus. CVS-11 strain of rabies virus and BALB/c mice were provided by the viral vaccines production unit and laboratory animal research unit of Pasteur Institute of Iran. The plasmid construction of the double glycoprotein (dG) strain, as well as plasmid constructs carrying PV strains of the virus, have been discussed in the previous study by Alamdary et al. [17]. The genome construct of this recombinant virus is presented in Fig. 1.

2.2 Rescue of the viruses

The immunogenicity and the propagation rate of the virus were studied in vivo and in vitro. For this purpose, the rescued dG virus was compared to a rescued PV strain with a similar passage number. The plasmid vectors carrying rabies virus gene constructs were transformed to TOP10 E.coli for propagation. The bacteria were propagated, and plasmid vectors were extracted from the clarified lysate using the Maxiprep plasmid extraction kit (YTA, Iran). Lipofectamine 2000™ (Thermo, USA) was used to transfer plasmid vectors into T7BHK cells. In order to rescue dG and PV strains, 2.5 µg from each of the full genome constructs were transferred to the T7BHK cell line along with 2.5 µg of nucleoprotein (N), 1.25 µg of phosphoprotein (P), and 1.25 µg of large polymerase protein (L) coding constructs. Since all the constructs were under the control of the T7 promoter, both viruses were primarily rescued from the T7BHK cell line. The rescued viruses released in the culture supernatant were collected 96 hours after transfection and cultured for two more passages on T7BHK cells. The cell culture supernatants containing rescued viruses were sub-cultured for three more passages on BSR cells to evaluate the functionality of the virus and were collected for further assessments. In each stage of the work, the presence of the rabies virus was studied using Fluorescent Antibody Test (FAT), conforming to the standard protocols (see below) [18].

2.3 RT-PCR and sequencing

The genome of rescued viruses was extracted using RNX™ RNA extraction Kit (Cinnagen, Iran) and was amplified by reverse transcription PCR reaction using random hexamer primers (YTA, Iran) for the reverse transcription step, followed by PCR using the forward and reverse primers (F: CTGACTGCCTTGATGTTGAT, R: CTCAGCCCTCTATTTCCTA) previously described [17]. The reaction condition conformed to the standard PCR protocols. The same primers were used to verify the viral sequences using the Sanger-based sequencing method (Pishgam, Iran).

2.4 Analysis of the glycoprotein gene expression

BHK cells were cultured in 6-well plates using DMEM supplemented with 5% FBS and were incubated at 37 C with a 5% CO₂ flush. A Monolayer of the cells was infected with PV or dG strains with a multiplicity of infection equal to 0.1. After 48 hours, the supernatants were harvested for quantification of glycoprotein gene expression levels in ten independent experiments.

Glycoprotein gene expressions were quantified with the nucleoprotein gene of the virus, being considered as the internal control. Total RNA was extracted from supernatant using the RNX™ (Cinnagen, Iran) reagent. The reverse transcription step was performed using the M-MLV Reverse Transcriptase (YTA, Iran). The amplification reactions were performed using RealQ Plus 2x Master Mix Green High ROX (Ampliqon, Denmark) and StepOnePlus thermal cycler (ABI, USA). The sequences of primers are as follows: TGGTAGTGGAGGACGAAGGA (forward), and ATCTGGTGTTGGGCGGAAAT (reverse) [15]. The ΔΔCt was used to reach the fold changes in gene expression, and the statistical analyses were accomplished using Prism V6 (GraphPad, USA) software.

2.4 Virus titration determination

The Fluorescent antibody test (IFA or FAT) was used to determine the virus titer. Tenfold dilutions of the virus in DMEM were prepared and were applied to a monolayer of BSR cells previously cultured in Labtek chamber slides (Thermo, USA). After 24 hours, the cells were fixed and permeabilized with 80% cold acetone in water solution for 30 min and assessed by an anti-rabies nucleocapsid antibody conjugated with fluorescein isothiocyanate (Bio-Rad, USA). After immunostaining, samples were visualized under UV radiation by fluorescence microscopy (Motic, PRC). The results were presented as FFU (Focus Forming Unit)/mL, which signifies the number of fluorescent foci counted for each sample multiplied by the dilution factor. All the titrations were obtained from at least two experiments, and the mean was presented as the virus titer.

2.5 Assessment of Virus Propagation Rates

In order to compare and evaluate the propagation rates of the rescued viruses, BSR cells were infected with either PV or dG strains. The same multiplicity of infection was used in any of the infection steps. The viruses were harvested at the same intervals at 72, 96, and 120 hours post-infection, and the virus titer changes over time were defined. The titers of the viruses were evaluated in six independent sets of experiments. The titration was carried out using FFU determination and fluorescent staining, as mentioned before.

2.6 Virus inactivation and formulation

The inactivation of the viruses was performed by the addition of Beta-Propiolactone to the virus harvests in a ratio of 1:2500 (v/v). The in vivo inactivation test was performed conforming to the previously published protocols [19]. Briefly, ten mice of 10–18 grams of weight were injected through the intracerebral route, each one with 30 microliters of the inactivated virus solution. The mice were observed for 21 days, and any mortality or signs of morbidity were registered. In the next step, the inactivated viruses were diluted 1:5 with DMEM, and 0.5 mg per mL of Alhydrogel® (Croda, Denmark) was added to the mixture. Negative control was prepared by adding the mentioned ratios of BPL and Alhydrogel® to DMEM.

2.7 Assessment of Virus Immunogenicity

Unisex BALB/c mice of 10–18 gram weight were divided into different groups according to the immunization schedules. For this purpose, six mice were prepared for each group of immunization. The harvests of both viruses were primarily concentrated to equal virus titers. In the next step, mice were immunized through intraperitoneal (IP) injection on days 0 and 7, as mentioned in supplementary table 1 and Fig. 2. The negative control group was comprised of eight mice, two mice assigned for each of the sampling days. The immunogenicity of prepared inactivated viruses and the negative control was assessed using blood sampling in 7, 14, and 21 days after inoculation. On each defined day post-immunization (DPI), mice were anesthetized, and blood samples were withdrawn from heart chambers. After one hour at room temperature, the blood samples taken from the hearts of the mice were coagulated, and a 1000g centrifuge was applied to separate the serum from blood. According to the standard protocols, the antibody titer in mice sera was evaluated using the RFFIT [3].

2.7.1 Rapid fluorescent focus inhibition test

The rapid fluorescent focus inhibition test (RFFIT) is the recommended method by WHO to evaluate the antibody titers in serum samples [18]. The serum samples complement system was heat-inactivated at 56^ᵒC for 30 minutes before the RFFIT experiment. For the accomplishment of RFFIT, serial three-fold dilutions of serum samples were prepared in 96 wells plate and were exposed to a defined concentration of PV strain for 1 hour at 37ᵒC. In the next step, 50,000 BSR cells were added to the mixture in each well. After 20–24 hours, the infected cells were studied using FAT immune staining to find the FFID50 (50% fluorescent focus infectious dose). For this purpose, 20–22 fields of each well were observed under a UV microscope, and the presence of any infected cell in the field would be considered positive. A 10 international unit (IU) HRIG sample was used to standardize the antibody titers. The titer of the antibody would be calculated using the Reed-Muench method [18]. All the experiments were accomplished at least in duplicates, and the mean was considered as the serum titer.

$$Interpolative value=\frac{50-\% infected fields next<50}{\% infected fields next>50-\% infected fields next<50}$$

LogED50 = Interpolative value$\times {\text{log}}_{10}Dilution factor$+${\text{log}}_{10}Dilution next<50\% infected fields$

E = 10^ Log ED50

ED50 = 1/E

2.8 Statistical analysis

The statistical analyses were accomplished using GraphPad Prism software V6 (GraphPad, USA). The normality of the data was studied using the Shapiro-Wilk test, and the Mann-Whitney test was the nonparametric exam used to compare two unpaired data groups. Kruskal-Wallis was the nonparametric exam used for comparing the difference between more than three groups. P-values below 0.05 were considered statistically significant. The Molecular Evolutionary Genetics Analysis (MEGA) software was used to study the sequencing results.

2.9 Ethics

The present study has been carried out in accordance with the research ethics committee of Pasteur Institute of Iran with approval number IR.P11.REC.1398.018.

The rescue process of the viruses resulted in functional PV and dG strains from T7BHK cells transfected with plasmid vectors carrying genes essential for the virus replication and assembly. The presence of rabies viruses in infected cells was proved in all steps through an antibody-based method. The presence and intactness of the second glycoprotein in the dG strain were verified in the virus genome through alignment of the genes against reference sequences using the MEGA software. The qRT-PCR results from ten independent experiments showed a significantly higher glycoprotein expression in dG virus and the mean of fold change was 2.47 (Fig. 3).

Comparing the propagation rates of the viruses on BHK-21 cells revealed a significant increase in titer of the dG strain of the rabies virus compared to the PV strain during different time intervals. As presented in Fig. 4, the mean of six series of the dG virus titration in all studied groups was significantly higher than the PV virus. The detailed data corresponding to the virus titers is presented in supplementary table 2.

In order to evaluate and at the same time compare the immunogenicity of the rabies strains, a similar dilution from both viruses with 10e7 particle per milliliter of virus content was prepared, inactivated, and formulated prior to the immunogenicity test. No mortality or morbidity in immunized mice was observed in the course of the test. The results of tested sera by RFFIT revealed a significant increase in the immunogenicity of the dG rabies strain compared to the PV strain, as shown in Fig. 5. The statistical analyses showed a significant difference among all studied groups (p < 0.05). Seven days after the first immunization, the antibody titer in mice injected with dG was higher than in the group injected with PV, but the difference was not significant (p = 0.4545). In mice that received one injection on day 0, both on 14 and 21 days post-immunization (DPI), the titer of anti-rabies antibody in the mice sera was significantly higher for dG compared to PV. Similarly, in mice that received two injections on days 0 and 7, the titer of anti-rabies was significantly higher for dG compared to PV on day 14. The antibody titer of both dG and PV groups on day 7 was the lowest among the studied groups. No virus-neutralizing antibody (VNA) was detected in the negative control group. The detailed statistical data for antibody titer comparison between dG and PV strains are presented in supplementary table 3.

Compared to 21 days post-inoculation (DPI) group with one injection, the titer of the dG virus was significantly lower in 14DPI-1 injection but not significantly different in 14DPI − 2 injections. In the case of the PV virus, no significant difference was observed between 14DPI-1 injection and 14DPI-2 injections with 21DPI-1 injection. All the antibody titers are presented in the international unit (IU).

In the present study, we have shown that a recombinant rabies virus with two identical glycoprotein genes (dG) had a higher glycoprotein expression and produced more virus particles in cell culture than the parental PV strain. Further assessments for immunization of laboratory animals with an inactive form of those viruses showed that the glycoprotein duplication conferred more immunogenicity to the dG virus strain.

The overexpressed glycoproteins might incorporate into virus particles or increase the free glycoproteins in culture media. Some previous studies have shown the effect of the genomic location of G insertion on the incorporation of the glycoproteins in virus particles. The additional glycoprotein in this study, inserted in the rabies virus genome, was located downstream of the matrix gene, between G and L genes, and conferred improved immunogenicity to the recombinant virus. This finding is in accordance with previous studies that show the advantage of this region for gene insertion [15]. The suggested mechanism behind this issue is that the proximity of a gene with the promoter sequence determines the transcription and protein expression level. The addition of a G gene between P and M led to lower virus titers and lower glycoprotein numbers in virion particles. Despite the overexpression of total glycoprotein, the distance between M and promoter results in downregulation of matrix protein which has a crucial role in virus packaging, leading to lower amounts of glycoprotein in assembled virions. It has been shown that incorporating the additional glycoprotein in a location between M and G contributed to less apoptosis induction, more glycoprotein incorporation in virion particles, and better immunogenicity against rabies virus [15].

Current rabies vaccines need several visits for vaccine injection, making it difficult to comply with the completion of the vaccination course. Scientists attempt to improve vaccine quality by developing epitope-based and nucleic acid-based vaccines, virus-like particles, simian adenovirus-based vaccines, and chimeric rabies vaccines [20–23]. Consequently, certain efforts have been made successfully to improve the virus immunogenicity by concentrating on gene duplications [14, 24]. The glycoprotein of the rabies virus has a fundamental role in virus attachment and infectivity as well as inducing the host’s antiviral immune response [25, 26]; therefore, an increase in the virus glycoprotein can inherently enhance the host defense mechanism. Thus, the enhanced immune response induced by the gene duplication in our study in the mouse model could suggest that the glycoprotein duplication might be applicable to other vaccine strains of the rabies virus. Additionally, it has been reported that the intergenic region between G and L genes could be an appropriate location for other forms of gene incorporation into the virus genome [27].

The results of this study revealed a significant increase in virus titer after cloning an additive copy of the glycoprotein gene in the virus genome 72, 96, and 120 hours after infecting the BHK-21 cells. The dG strain titers were significantly higher than the PV strain in all studied hours of infection. These findings complied with previous works by Navid et al. and Liu et al., in which a similar increase in titers of the virus with two glycoprotein genes was observed [14, 15]. Both studies have demonstrated the increase of virus titers despite the witnessed increase in apoptosis. On the contrary, in another study by Tao, no differences were reported in virus titers after duplicating the glycoprotein gene [24]. These findings suggest that the impact of apoptosis conducted by duplication of glycoprotein is negligible. On the other hand, the overexpression of glycoprotein has a much higher impact on virus propagation. There is evidence that overexpression of the glycoprotein is witnessed in double G particles, which showed higher virus titers [15].

In all previous studies, there was a similar increase in glycoprotein expression. In two similar studies, Tariq et al. [15] and Liu et al.[14], reported an increase in the titration of recombinant SAD-B19 and Flurry-HEP strains with two glycoprotein genes, respectively [14, 15, 24, 25]. Tao et al. [24] witnessed no difference in virus titer after duplication of G in Flurry LEP strain, while Faber et al. [25] reported a decrease in the titer of recombinant double glycoprotein SAD-B19 virus. There has been a common report for the increase of apoptosis after overexpression of rabies virus glycoprotein [14, 15]. It seems that G overexpression has more positive impacts on virus titer compared to related negative impacts of increased apoptosis.

Laboratory animals are abundantly utilized to demonstrate vaccine quality, especially for rabies vaccine potency testing using the NIH challenge test. The NIH test, used for rabies vaccine potency assessment, has several inherent disadvantages and limitations [28]. Comparison between the immunizing capabilities of two viruses in this study was implemented based on a single-dose serological method recommended by the Monograph 0451 of the European Pharmacopoeia, thus considerably reducing the number of animals and averting rabies challenge infection [29, 30]. Seventy-two mice were vaccinated in three groups, including dG, PV, and control. The results of the RFFIT test from blood samples revealed a significant increase in the level of induced VNA in the dG vaccine. The rise in induced VNAs is common in similar previous studies [14, 15, 24, 25]. The proposed protocol by European Pharmacopeia has suggested collecting blood samples 14 days post-inoculation (DPI) [29, 30]. In addition to the proposed assessment in 14 DPI, which was used to compare with other studies, three other groups were studied, including 7DPI, 21 DPI, and a 14DPI group with an extra inoculation on day 7. The VNA titers of the dG strain were significantly higher in all four studied groups compared to the PV strain. For both strains, all four mentioned groups were compared with each other, and the results showed an order of 7DPI < 14 DPI < 14 DPI-2 injections < 21 DPI, in which all the differences were significant except the difference between 14 DPI-2injections and 21 DPI which was not statistically significant for both strains. In addition to comparing the VNA titers, preliminary results of this study might draw attention to a vaccination schedule on days 0, 7, and 14 for higher VNA titers.

According to WHO recommendations for inactivated rabies vaccine, the virus used for vaccine preparation should be a laboratory-adapted and attenuated strain with stable biological characteristics. The virus rescued in the current work has been recovered and purely generated from verified genetic sequences. In this regard, this type of modified virus has the potential to be used under regulations for manufacturing the rabies vaccine.

Duplication of the rabies virus glycoprotein has conferred overexpression of glycoprotein and improved immunogenicity to the vaccine strain of the rabies virus. It has also rendered more efficient virus propagation during infection on cell culture. While the recombinant dG strain might be characterized for application in rabies virus production, due to inherent influences of overexpressed glycoprotein on host cell mechanism, it can be used to study different cellular pathways related to the rabies virus cell cycle.

Acknowledgements

The authors would like to appreciate Dr. N. Miandehi for valuable technical assistances in cell culture.

Author contribution

Alamdary A: Conceptualization, Methodology, Software, Validation, Investigation, Formal analysis, Writing-original draft

Gholami A: Conceptualization, Methodology, Validation, Writing-original draft and review and editing, Project administration, Resources

Azizi M: Methodology, Supervision, Resources, Writing-review and editing

Noormohammadi Z: Methodology, Supervision, Writing-review and editing

Conflict of Interest

The author declare no conflict of interest.

Klein A et al(2021) Retrospective Enhanced Bat Lyssavirus Surveillance in Germany between 2018–2020.Viruses, 13(8)
Gholami A, Alamdary A (2020) The World Rabies Day 2020: Collaborate and Vaccinate. Iran Biomed J 24(5):264–268
WorldHealthOrganization (2020) Rabies. ; Available from: https://www.who.int/news-room/fact-sheets/detail/rabies
WorldHealthOrganization (2010) Weekly epidemiological record, Rabies vaccines: WHO position paper. Vol. 85.
WorldHealthOrganization (2015) Rabies: rationale for investing in the global elimination of dog-mediated human rabies. Available from: http://apps.who.int/iris/bitstream/handle/10665/185195/9789241509558_eng.pdf?sequence=1
World Health Organization, Recommendations for inactivated rabies vaccine for human use produced in cell substrates and embryonated eggs. Fifty-sixth report ed. Technical Report Series, No. 941 (2005) Geneva: WHO expert committee on biological standardization
Fooks AR, Banyard AC, Ertl HCJ (2019) New human rabies vaccines in the pipeline. Vaccine 37(Suppl 1):A140–A145
Publicover J, Ramsburg E, Rose JK (2005) A single-cycle vaccine vector based on vesicular stomatitis virus can induce immune responses comparable to those generated by a replication-competent vector. J Virol 79(21):13231–13238
Dudek T, Knipe DM (2006) Replication-defective viruses as vaccines and vaccine vectors. Virology 344(1):230–239
Hai R et al (2011) A reassortment-incompetent live attenuated influenza virus vaccine for protection against pandemic virus strains. J Virol 85(14):6832–6843
Rodrigo WW, de la Torre JC, Martinez-Sobrido L (2011) Use of single-cycle infectious lymphocytic choriomeningitis virus to study hemorrhagic fever arenaviruses. J Virol 85(4):1684–1695
WorldHealthOrganization(2021) Oral rabies vaccine: a new strategy in the fight against rabies deaths.
Malave CM et al(2021) Impact of Molecular Modifications on the Immunogenicity and Efficacy of Recombinant Raccoon Poxvirus-Vectored Rabies Vaccine Candidates in Mice.Vaccines (Basel), 9(12)
Liu X et al (2014) A recombinant rabies virus encoding two copies of the glycoprotein gene confers protection in dogs against a virulent challenge. PLoS ONE 9(2):e87105
Navid MT et al (2016) Comparison of the immunogenicity of two inactivated recombinant rabies viruses overexpressing the glycoprotein. Arch Virol 161(10):2863–2870
Gai W et al (2017) Immunization with recombinant rabies virus expressing Interleukin-18 exhibits enhanced immunogenicity and protection in mice. Oncotarget 8(53):91505–91515
Alamdary A et al (2021) Construction and Rescue of a Rabies Virus with Duplicated Glycoprotein Gene. Vacres 8(1):104–109
WorldHealthOrganization., Laboratory techniques in rabies, CER.A.RFB Abela-Ridder(2018) Editor. World Health Organization. p. 176–183
WorldHealthOrganization.(2007) WHO Expert Committee on Biological Standardization: fifty-sixth report. WHO Technical Report Series. Geneva, Switzerland: World Health Organization. 352
Ertl HCJ (2018) Human immune responses to traditional and novel rabies vaccines. Rev Sci Tech 37(2):649–656
Fisher CR et al (2020) Lyssavirus Vaccine with a Chimeric Glycoprotein Protects across Phylogroups. Cell Rep 32(3):107920
Napolitano F et al (2020) A next generation vaccine against human rabies based on a single dose of a chimpanzee adenovirus vector serotype C. PLoS Negl Trop Dis 14(7):e0008459
Schutsky K et al (2013) Intramuscular inoculation of mice with the live-attenuated recombinant rabies virus TriGAS results in a transient infection of the draining lymph nodes and a robust, long-lasting protective immune response against rabies. J Virol 87(3):1834–1841
Tao L et al (2011) Generation of a recombinant rabies Flury LEP virus carrying an additional G gene creates an improved seed virus for inactivated vaccine production. Virol J 8:454
Faber M et al (2002) Overexpression of the rabies virus glycoprotein results in enhancement of apoptosis and antiviral immune response. J Virol 76(7):3374–3381
Huey R, Hawthorne S, McCarron P (2017) The potential use of rabies virus glycoprotein-derived peptides to facilitate drug delivery into the central nervous system: a mini review. J Drug Target 25(5):379–385
Du J et al (2011) Development of recombinant rabies viruses vectors with Gaussia luciferase reporter based on Chinese vaccine strain CTN181. Virus Res 160(1–2):82–88
Schiffelers MJ et al (2014) Replacing the NIH test for rabies vaccine potency testing: a synopsis of drivers and barriers. Biologicals 42(4):205–217
Kramer B et al (2013) A multi-dose serological assay suitable to quantify the potency of inactivated rabies vaccines for veterinary use. Biologicals 41(6):400–406
Lewis CE et al (2012) Potency testing of veterinary rabies vaccines: replacement of challenge by in vitro testing: considerations for development of alternative assays. Dev Biol (Basel) 134:29–33

Download PDF

Version 1

posted

You are reading this older preprint version

Read the latest preprint version →

WITHDRAWN: The Double Glycoprotein Rabies Virus Strain Shows Increased Propagation Rate and Boosted Immunogenicity.

Status:

Version 1

Editorial Note

Abstract

Background

Methods

Results

Conclusion

Figures

1 Introduction

2 Material And Methods

2.1 Cells, viruses and genetic constructs

2.2 Rescue of the viruses

2.3 RT-PCR and sequencing

2.4 Analysis of the glycoprotein gene expression

2.4 Virus titration determination

2.5 Assessment of Virus Propagation Rates

2.6 Virus inactivation and formulation

2.7 Assessment of Virus Immunogenicity

2.7.1 Rapid fluorescent focus inhibition test

2.8 Statistical analysis

2.9 Ethics

3 Results

4 Discussion

5 Conclusions

Declarations

References

Supplementary Files

Status:

Version 1