Clinical sample collection
From February 2013 to June 2014, 64 patient samples from breast cancer resections along with the corresponding paracancerous tissues were collected from Pingxiang Health Vocational College. The pathological diagnosis was obtained based on histology or biopsy of the tumor specimen and examined by experienced pathologists. The breast cancer tissues and paracancerous tissues were stored in liquid nitrogen.
Cell culture and transfection
Human breast epithelial cell line (MCF-10A) and breast cancer cell lines (MDA-MB-231, MCF-7, BT-549, MDA-MB-468 and SK-BR-3) without mycoplasma and other contamination were selected. The above cells were purchased from American Type Culture Collection (Manassas, VA, USA). All cells were cultured in 90% RPMI-1640 medium, which were appended with 10% fetal bovine serum (Gibco; Thermo Fisher Scientific, Waltham, MA, USA), 100 U/mL penicillin and 100 mg/mL streptomycin, and then cultured in a saturated incubator containing 5% CO2 at 37 °C.
MCF-7 cells were divided into groups, and the vector used for transfection was purchased from Guangzhou RiboBio (Guangdong, China). siRNA was designed and synthesized by Thermo Fisher Scientific Inc. MCF-7 cells were seeded at 1 × 106 cells/well in 6-well plates, and transduced with Lipofectamine 2000 transfection reagent (Invitrogen, Carlsbad, CA). According to different experimental requirements, cells were collected at different time periods after transfection for subsequent experiments.
Reverse transcription quantitative polymerase chain reaction (RT-qPCR)
Cells were harvested 48 h post transfection and total RNA was extracted using Trizol (Sigma-Aldrich, St Louis, MO, USA). RNA sample (5 µL) was diluted 20-fold with RNase-free ultrapure water, and the absorbance value at 260 nm and 280 nm was read by an ultraviolet spectrophotometer to determine the concentration and purity of RNA. According to the reverse transcription kit instructions (Beyotime, Shanghai, China), reverse transcription was performed on a PCR amplification instrument for the synthesis of a cDNA template. The required qPCR primers were synthesized by Sangon Biotech Co., Ltd. (Shanghai, China). The primer information is shown in Table 1. Glyceraldehyde phosphate dehydrogenase (GAPDH) was the loading control of PRNCR1 and CCND2, and U6, the loading control of miR-377. 2−△△Ct method was adopted for gene expression analysis.
Table 1
Name | Sequence (5'-3') |
PRNCR1 | F: CCAGATTCCAAGGGCTGATA |
R: GATGTTTGGAGGCATCTGG |
miR-377 | F: GTCGTGGAGTCGGCAATT |
R: GGCATCACACAAAGGCAAC |
CCND2 | F: ACCTTCCGCAGTGCTCCTA |
R: CCCAGCCAAGAAACGGTCC |
U6 | F: AAAGCAAATCATCGGACGACC |
R: GTACAACACATTGTTTCCTCGG |
GAPDH | F: ATTGTTGCCATCAATGACCC |
R: AGTAGAGGCAGGGATGATGT |
Note: F, forward; R: reverse; miR-377, microRNA-377; GAPDH, glyceraldehyde phosphate dehydrogenase. |
Western blot assay
Cells were harvested 48 h post transfection and then washed with precooled phosphate buffered saline (PBS) and lysed with radioimmunoprecipitation assay buffer containing 10% protease inhibitor (MCE, USA). The cell sample was transferred to a 1.5 mL centrifuge tube, centrifuged for 10 min at 13,000 g for acquiring the supernatant. The measurement of protein concentration was implemented by bicinchoninic acid method and stored at -20 °C until use. The kit of sodium dodecyl sulfate polyacrylamide gel electrophoresis was utilized for preparing 10% separation gel and 4% concentrated gel. Next, the protein was separated by electrophoresis on polyacrylamide gel, and transferred to the nitrocellulose membrane by wet transfer method, and the membrane was blocked by 5% defatted milk for 1 h. After that, the membrane was probed with the primary antibodies CCND2 (ab207604), MEK1 (ab32091), phosphorylated (p)-MEK1(ab96379), p38 MAPK (ab31828), p-p38 MAPK (ab4822) (all from Abcam, Cambridge, USA), and re-probed with secondary antibody IgG (ab150077, Abcam). The image was developed by a Bio-Rad gel imaging system (MG8600, Beijing Thmorgan Biotechnology Co., Ltd., Beijing, China), and quantitative analysis was performed using IPP7.0 software (Media Cybernetics, Singapore).
Cell counting kit (CCK)-8 assay
According to the kit's operating instructions, CCK-8 (Bimake) was adopted to determine cell proliferation capacity. Twenty-four hours post cell transfection, the cells were re-seeded at 3000 cells per well onto a 96-well plate. Optical density value was detected using a microplate reader at 450 nm. Each experiment was executed in triplicate and repeated independently three times
Flow cytometry
The cells at 48 h post transfection were rinsed with PBS-balanced salt solution, and detached with 0.25% trypsin. The trypsin was removed when the cells were observed to be shrinkage round under the microscope, and the detachment was terminated by adding serum-containing medium. Afterwards, the cells were triturated for cell suspension, which was centrifuged to remove the supernatant. Afterwards, the cells were fixed with 70% ice-cold ethanol for 30 min, and dyed with 1% propidium iodide (PI) solution containing RNA enzyme for 30 min. With PI removal, the cells were adjusted to the concentration of 1 mL. The samples were positioned in a BD-Aria FACS Calibur flow cytometer (FACSCalibur, Beckman Coulter, USA) for detecting the cell cycle.
The cells at 48 h post transfection were altered to the concentration of 1 × 106 cells/mL. Next, the cells were appended with 70% precooled ethanol solution and rinsed with PBS two times. Cell suspension (100 µL, no less than 106 cells/mL) was suspended in 100 µL Binding Buffer, supplemented with added with 10 µL Annexin V-fluorescein isothiocyanate (FITC),5 µL PI as well as 300 µL Binding Buffer. A flow cytometer (Attune NxT, Thermo Fisher, USA) was implemented to detect apoptosis at 488 nm.
Fluorescent in Situ Hybridization (FISH)
PRNCR1 expression was detected in situ in MCF-7 cells using a FISH Kit (C10910, RiboBio). The cell slide was placed on the 24-well plate’s bottom, and MCF-7 cells were detached onto the slide (approximately 6 × 104/well). When reaching 60–70% confluence, cells were fastened in 4% paraformaldehyde, appended with 1 mL pre-cooled permeable fluid. After discarding the permeable fluid, cells were supplemented with 200 µL prehybridization solution. Meanwhile, the hybridization solution was added with 2.5 µL 20 µM FISH Probe Mix storage fluid. Afterwards, the pre-hybridization solution was removed and hybridization solution containing the PRNCR1 probe was appended. Next, the cells were washed with different kinds of wash solution and incubated devoid of light. The nucleus was stained with ',6-diamidino-2-phenylindole 2hci solution and washed with PBS three times. Under dark conditions, the cell slide was carefully removed from the well, which was fixed on a glass slide with a mounting plate and perform fluorescence detection. PRNCR1 specific probe was synthesized by RiboBio.
Dual luciferase reporter gene assay
The biological prediction website was utilized to analyze the binding site of PRNCR1 and miR-377, and the binding site of miR-377 and CCND2, thereby obtaining the fragment sequence containing the action site. Next, the full length PRNCR1 and 3'UTR of CCND2 were cloned and amplified into pmirGLO luciferase vectors (E1330, Promega, Madison, WI, USA) and named as PRNCR1-wild type (Wt) and CCND2-Wt. Bioinformatics software was adopted for forecasting the binding sites of miR-377 and PRNCR1, along with miR-377 and CCND2 by site-directed mutations. PRNCR1-Mut and CCND2-mutant type (Mut) vectors were constructed, and the internal reference was pRL-TK vector (E2241, Promega) expressing renilla luciferase. The 293T cells were introduced with miR-377 mimic or mimic negative control (NC) with the luciferase reporter vector respectively, and the fluorescence intensity was tested using a fluorescence detector (Glomax 20/20, Promega).
RNA pull-down assay
Cells were transduced with 50 nM biotin-labeled Wt-bio-miR-377 and Mut-bio-miR-377. Forty-eight hours later, cells were incubated for 10 min with specific lysis buffer (Ambion, Austin, Texas, USA). After that, the lysate was cultured with M-280 streptavidin magnetic beads (S3762, Sigma) pre-coated with RNase-free bovine serum albumin together with yeast tRNA (TRNABAK-RO, Sigma). Next, the beads were cultured for 3 h at 4 °C, washed with pre-chilled lysis buffer, low salt buffer, and high salt buffer. The bound RNA was purified by Trizol and then detected.
Radioimmunoprecipitation (RIP) assay
Cell were lysed with lysis buffer (25 mM Tris-HCl pH 7.4, 150 mM NaCl, 0.5% NP-40, 2 mM EDTA, 1 mM NaF and 0.5 mM dithiothreitol) containing RNasin (Takara, Dalian, China) and a protease inhibitor mixture (B14001a, Roche, USA). The lysate was centrifuged to collect the supernatant. Then, anti-Ago-2 magnetic beads (BMFA-1, Biomarker, Beijing, China) were added, and the control group was added with anti-IgG magnetic beads. Then the beads were rinsed three times with wash buffer (50 mM Tris-HCl, 300 mM NaCl pH 7.4, 1 mM MgCl 2, 0.1% NP-40). RNA was extracted from magnetic beads by Trizol method.
Statistical analysis
All data were processed by SPSS 21.0 statistical software (IBM Corp. Armonk, NY, USA). All data were reported as mean ± standard deviation for no less than three independent experiments. The statistical significance of the average was determined by the student t test. For skewed distribution data, non-parametric tests were used to determine statistical significance. P < 0.05 was indicative of statistical significance.