Bifidobacterium longum upregulates mitochondrial activity and suppresses Parkinson’s disease in Caenorhabditis elegans

doi:10.21203/rs.3.rs-1969602/v1

Download PDF

Research Article

Bifidobacterium longum upregulates mitochondrial activity and suppresses Parkinson’s disease in Caenorhabditis elegans

https://doi.org/10.21203/rs.3.rs-1969602/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Bifidobacterium is a probiotic bacterium that has positive effects on human health, including the regulation of intestinal function. This study aimed to identify novel bioactive effects of Bifidobacterium in Caenorhabditis elegans. Previously, we found that Bifidobacterium longum significantly increased the motility of nematodes and, although antioxidant effects are thought to be one of the factors, we hypothesized that B. longum might have affected the muscles and mitochondria, causing an increase in motility. Thus, the purpose of this study was to analyze the bioactive effects and mechanisms of action of B. longum on the muscle and mitochondria of C. elegans. The results showed that B. longum increased the muscle mass, mitochondrial mass, ATP content, mitochondrial membrane potential, and mitochondrial ROS. Furthermore, high-resolution microscopy and qPCR showed that B. longum maintained mitochondrial homeostasis. We also used inhibitors of the mitochondrial complexes to analyze those which were specifically targeted by B. longum. The results implicated mitochondrial complex I, which is closely associated with Parkinson’s disease. Furthermore, B. longum increased the expression of dopaminergic neurons and decreased the expression of α-synuclein in C. elegans. Overall, we showed that B. longum is beneficial to health and has the potential to prevent Parkinson’s disease.

Bifidobacterium longum

Caenorhabditis elegans

muscle

mitochondria

membrane potential

Parkinson’s disease

In recent times, people have become more concerned with their health, as well as the health benefits of different foods. However, there are some substances with proclaimed health benefits that are lacking in evidence to support their effects. Research has been conducted on extracts and isolated functional substances from food to analyze their bioactive effects on health. An increasingly popular target of such research is probiotics. Probiotics are bacteria that have a positive effect on people’s health and are often contained in dairy products such as yogurt, which is consumed daily by a wide range of people, from children to the elderly. Bifidobacterium and Lactobacillus supplements are well-known probiotics. In the human intestine, Bifidobacterium is said to be 100–1000 times more abundant than Lactobacillus and is the most predominant probiotic in the intestine[1]. Their impact on the host is significant because of their high abundance in the gut and, importantly, they are known to have positive health effects on humans such as improving intestinal flora[2]. Bifidobacterium is a gram-positive rod and anaerobic microbe that is difficult to grow in the presence of oxygen[3]. For this reason, they are usually found in the human body in places like the large intestine, where oxygen is less abundant than in places like the small intestine and colon[4]. Many Bifidobacterium species live in the human body, and new functions in human health are continuously being discovered; however, they may have undiscovered functions that could further improve health. So far, we have analyzed the antiaging effects of Bifidobacterium in C. elegans[5]. C. elegans is often used as a model experimental organism and survives for approximately three weeks at 20°C in a laboratory environment on an agar medium coated with E. coli [6]. Most nematodes are hermaphroditic and self-fertilize without reproducing; they lay the eggs of the next generation within 4 or 5 days after hatching, resulting in rapid generational changes. Thus, nematode individuals with the same genetic background can be obtained within a short period and, because their lifespan is shorter than other experimental models, nematodes are often used for lifespan analysis experiments. In addition to nervous and reproductive systems, C. elegans has digestive organs including the intestine; therefore, it is often used as an experimental model to evaluate the functionality of orally administered food extracts and substances[7, 8]. Furthermore, the entire genome sequence of C. elegans has already been revealed, and many of its genes are homologous to those of higher animals[9]. This means that C. elegans can be used to obtain results that mimic those of higher animals in a short period.

We have previously shown that B. longum increases the antioxidant activity of C. elegans, inhibits the decline in motility associated with aging, and increases the membrane potential of mitochondria[5]. It is possible that the increased antioxidant activity suppressed the age-related retardation in motility, but it remains unclear whether the increase in motility was caused by that alone. Since the membrane potential of the mitochondria of nematodes was increased by Bifidobacterium, we considered the possibility that Bifidobacterium affected the muscle and mitochondria to increase their motility. Therefore, this study aimed to analyze the age-related effects of Bifidobacterium on the muscle and mitochondria. As a further application of this study, we considered its inhibitory effect on Parkinson’s. Parkinson’s disease begins with symptoms such as tremors in the limbs and, as it progresses, the patient may become bedridden or have difficulty breathing. Although several causes of Parkinson's disease have been proposed, including the degeneration of dopaminergic neurons due to decreased mitochondrial homeostasis, no cure has been established; therefore, it is necessary to search for a cure from various directions in addition to drug therapy[10]. Thus, this study aimed to analyze the bioactive effects of Bifidobacterium on muscle and mitochondria using C. elegans and assess the inhibitory effect of Bifidobacterium on Parkinson’s disease.

This study aimed to explore the new bioactivities of B. longum (BL, BR-108) on motility, muscle, and mitochondria. First, we measured motility in the presence and absence of BL for 15 days and confirmed that BL suppressed the age-dependent decreases in motility (Fig. 1A). In addition, we analyzed the age-dependent decline in motility using a mutant lacking aak-2, which is an AMPK in C. elegans (Fig. 1B)[11]. The results showed that the motility of the BL-fed mutants did not change, suggesting that aak-2 was involved in this enhanced motility. We hypothesized that BL affects the muscle and mitochondria to suppress the loss of motility; therefore, we analyzed muscle mass and mitochondrial mass by measuring the fluorescence levels of recombinant RW1596, in which GFP was fused to myo-3 in muscle, and recombinant SJ4103, in which GFP was fused to myo-3 in mitochondria[12]. BL increased the fluorescence of GFP, suggesting that it enhanced the amount of muscle and mitochondria (Figs. 2C and 3E). In particular, muscle mass was significantly increased on days 3 and 6, and mitochondrial mass was significantly increased from days 3 to 12. Mitochondria in muscle are arranged in a linear pattern along muscle fibers; however, with aging, homeostasis decreases, aggregation and rupture occur, and the linear pattern is broken[13, 14]. To determine mitochondrial homeostasis, the SJ4103 nematode was observed under high magnification using the THUNDER imaging system and a fluorescence microscope. We observed that the mitochondria of day 9 nematodes, where a particularly striking difference was observed, maintained their linearity compared to the CT (Figs. 3C and 3D). Mitochondria produce ATP via oxidative phosphorylation and ATP is measured as an indicator of mitochondrial homeostasis. Although the amount of ATP decreased with aging, the BL-fed nematodes maintained a higher amount of ATP than the CT-fed ones (Fig. 4). We also analyzed mitochondrial homeostasis by measuring the genes involved in mitochondrial fusion and fission. The mRNA levels of eat-3 and fzo-1, which are involved in mitochondrial fusion, and drp-1, which is involved in mitochondrial fission, were measured using qPCR[15]. The amount of drp-1 involved in fission did not change, but the amount of eat-3 and fzo-1 involved in fusion increased (Fig. 5). These results suggest that BL maintains mitochondrial homeostasis. Electron transfer and oxidative phosphorylation steps in the mitochondria lead to an increase in membrane potential and the generation of ROS[16]. The BL-induced increase in mitochondrial membrane potential and ROS in the nematodes suggests that BL promoted mitochondrial activation (Figs. 6C and 7C).

To determine which part of the mitochondria was specifically affected by BL, we used mitochondrial complex inhibitors. Mitochondria have five complexes, I-V, and we used rotenone, TTFA, antimycin A, sodium azide, and DCCD as inhibitors of each complex, respectively[17–19]. We also measured senescence-dependent motility, mitochondrial membrane potential, and phenotypes that were markedly altered by BL using the inhibitors. Senescence-related motility was similarly decreased by all inhibitors (Fig. 8). The inhibitors reduced motility in both CT and BL nematodes; the decrease in motility was less pronounced than in the nematodes to which no inhibitors were added. This suggests that all complexes were involved in the BL-induced increase in motility. Next, we measured the mitochondrial membrane potential using the inhibitors and showed that the BL-induced increase in membrane potential was suppressed only when rotenone, an inhibitor of complex I, was added (Fig. 9). The inhibitors of complexes II-V did not decrease the BL-induced increase in the membrane potential. This suggests that complex I is specifically involved in the BL-induced increase in mitochondrial membrane potential.

These results suggest that Bifidobacterium influences the mitochondria. We hypothesized that Bifidobacterium may have an inhibitory effect on Parkinson’s disease, which is an intractable disease that causes tremors and stiffness in the limbs, resulting in significant adverse effects on physical activities and, in some cases, death. The cause of Parkinson’s disease has been proposed in various ways, with the leading theory being a degeneration of dopaminergic neurons as a result of decreased homeostasis of mitochondrial complex I, resulting in decreased dopamine levels. Thus, we measured the expression of dopaminergic neurons using BZ555 nematode worms, in which GFP was fused with dopaminergic neurons. The amount of fluorescence of BL-fed BZ555 nematodes increased, suggesting that BL increased the expression of dopaminergic neurons in the nematodes (Fig. 10A). Next, we used the NJ5901 nematode, in which YFP was fused with α-synuclein, which is thought to accumulate and contribute to Parkinson’s disease. The fluorescence of BL-fed NJ5901 nematodes decreased, suggesting that BL decreased the expression of α-synuclein in the nematodes (Fig. 10B). These results not only suggest a new bioactive effect of Bifidobacterium on muscle and mitochondria but also suggest the potential inhibition of Parkinson’s disease.

In this study, we analyzed the bioactive effects of Bifidobacterium on the muscle and mitochondria in C. elegans and the inhibitory effect of Bifidobacterium on Parkinson’s disease. Because C. elegans has a basic intestine and ingests only Escherichia coli, it is thought that the bacteria in the intestine of C. elegans are mostly occupied by E. coli. In nature, a small number of bacteria (less than 100 species) have been reported to exist in the intestine of C. elegans, which is far fewer than that in humans and mice[20, 21]. This fact led us to analyze the effect of Bifidobacterium alone, rather than the interaction of intestinal bacteria in C. elegans. In previous studies that explored the bioactivity of Bifidobacterium using C. elegans, the cell wall components of Bifidobacterium were recognized via Toll-like receptors (TLRs)[22, 23]. In addition, previous studies using cells and mice have suggested that TLRs recognize bacterial peptidoglycan layers and lipoteichoic acids[24, 25]. Furthermore, stimulation by TLRs activates the p38-MAPK pathway, which in turn activates SKN-1, a transcription factor involved in stress tolerance[22, 26]. In our previous study, B. longum (BR-108), which was also used in the present study, promoted the activation of SKN-1. Therefore, we believe that in the present study, as well as in previous studies, the cell wall components of BR-108, such as the peptidoglycan layer, were receptive via TLRs[5].

In our previous study, we found that B. longum extended the lifespan of C. elegans, increased motility, and promoted mitochondrial activation[5]. In this study, we analyzed the phenotypes of motility and mitochondrial activation related to the muscles and mitochondria for a longer period than in previous studies. First, BL suppressed the age-related decreases in motility in C. elegans. This effect remained significant and persisted until day 15 in the aged nematodes (Fig. 1). We have previously shown that BL increased stress tolerance in C. elegans via the insulin signaling pathway[5], and the maintenance of motility by BL could be one reason for the increased stress tolerance in nematodes. However, we hypothesized that increased motility did not arise from increased stress tolerance alone. Previously, Bifidobacterium breve was shown to increase muscle mass and promote mitochondrial biosynthesis in rats; thus, we thought that BL might have affected the muscles of nematodes and their energy-producing mitochondria[27]. As a result, we analyzed the muscle and mitochondrial mass in C. elegans. BL increased muscle mass and suppressed the decrease in mitochondrial mass with aging (Figs. 2C and 3E). BL significantly increased the muscle mass in relatively young individuals up to day 6. Since motility significantly increased even after day 6, it can be inferred that muscle mass does not directly affect motility. Whether the increase in motility was due to an increase in muscle mass, or vice versa, should be clarified in future research. We also hypothesized that mitochondria have a greater effect on the suppression of motility loss in C. elegans than on muscle mass, and subsequently analyzed mitochondrial activity and homeostasis; for the former, we measured ATP levels, mitochondrial membrane potential, and mitochondrial ROS levels, and for the latter, we analyzed mitochondrial morphology and the expression of genes involved in fusion and fission. When mitochondrial activity is increased, proton transport is enhanced and a hydrogen ion concentration gradient occurs between the matrix and the inner membrane, resulting in a change in membrane potential[16]. In addition, the proton concentration gradient promotes oxidative phosphorylation, which synthesizes ATP, and at the same time, superoxide, a type of ROS, is produced in the mitochondria[16]. Normally, ROS can cause negative effects such as cell damage[28]; however, in our previous study, we found that BL caused an increase in the expression of ROS scavengers, suggesting that the BL-mediated elevation in mitochondrial ROS was positive rather than a negative[5]. Although the antioxidant effect of scavengers might be one of the factors responsible for the suppression of decreased motility, the large increases in mitochondrial membrane potential and ATP might be a major factor in BL-induced increased motility. To confirm that mitochondrial quality was maintained, we measured the mitochondrial morphology and gene expression involved in fusion and fission. When mitochondrial homeostasis is compromised, mitochondrial rupture and aggregation occur, resulting in decreased ATP production[12]. Mitochondrial cleavage was most pronounced in day 9 nematodes, where a difference between the CT and BL nematodes was observed. This suggests that BL maintains mitochondrial homeostasis (Figs. 3C and 3D). This also suggests that BL maintains the ATP production capacity of mitochondria. Gene expression analysis using qPCR showed that the levels of eat-3 and fzo-1, which are involved in mitochondrial fusion, increased (Fig. 5). The imbalance between mitochondrial fusion and fission leads to abnormal aggregation and rupture[29]. In this study, only the expression of genes involved in fusion was upregulated; however, BL maintained its mitochondrial morphology, suggesting that the upregulation was gradual enough to not disrupt the equilibrium between fusion and fission. In addition, a previous study showed that the upregulation of mitochondrial fusion prolongs the lifespan of aging nematodes[30]. Considering that BL prolonged the lifespan of C. elegans in our previous study, it is possible that the increased expression of these fusion genes also contributed to the prolongation of the lifespan of BL[5].

To analyze the mechanism of BL-induced bioactivity, we measured motility during aging in a mutant lacking the AMPK aak-2 gene (Fig. 1B). aak-2 is known to be stimulated and regulated by the insulin signaling pathway, which we have previously shown to be associated with BL-induced bioactivity in nematodes[5, 31]. AMPK is also involved in the regulation of mitochondrial biogenesis and mitochondrial membrane potential[32, 33]. Our results of motility during aging in aak-2-deficient mutants suggest that AAK-2 is involved. Taken together, it is likely that BL affects mitochondria by activating AAK-2 through the insulin signaling pathway.

As BL had a significant effect on mitochondria, this study further aimed to determine which mitochondrial complexes were strongly involved. Similar to higher organisms, C. elegans mitochondria contain five complexes[17] and each complex has its own inhibitor; in this study, we used rotenone, TTFA, antimycin A, sodium azide, and DCCD for complexes I-V, respectively. The concentrations were determined based on previous studies, where ATP in nematodes could be reduced, albeit for short exposures[34]. Only antimycin A was reduced to a viable concentration because the nematodes could not survive at the concentration used in a previous study. To measure the effects of these inhibitors, we analyzed the motility and mitochondrial membrane potential phenotypes during aging. Experiments on motility suggested the involvement of all complexes, and experiments on mitochondrial membrane potential strongly suggested the involvement of complex I only. It has been suggested that the involvement of a specific complex cannot be ruled out because the changes in motility associated with aging involve various factors other than mitochondria, such as cellular homeostasis due to antioxidant effects and neurodegeneration[35]. In addition, previous studies have shown that mitochondrial complexes do not work independently but rather that several complexes aggregate to form a supercomplex[36, 37]. In this study, complex I played a central role and other complexes may have been involved simultaneously. Rotenone, which we used as an inhibitor of mitochondrial complex I, is known to cause the Parkinson’s disease phenotype[38]. Parkinson’s disease makes daily life very difficult due to muscle stiffness and spasms, and in severe cases, it can lead to death due to breathing difficulties[10]. Parkinson’s disease is also caused by the degeneration of dopaminergic nerves due to decreased homeostasis of mitochondrial complex I[39, 40]. Another known cause is α-synuclein protein aggregation, which has been found to negatively affect dopamine release and is known to induce Parkinson’s disease[41, 42]. A previous study reported that the percentage of Bifidobacterium in the intestinal microflora of a mouse model of Parkinson’s disease was decreased[43]. This decrease may have disrupted mitochondrial homeostasis and resulted in the degeneration of dopaminergic neurons, leading to Parkinson’s. In a study using a Drosophila model of Parkinson's disease, it was reported that restoring mitochondrial function and increasing mitochondrial membrane potential suppressed the Parkinson’s phenotype[44]. Based on these findings, we hypothesized that supplementation with Bifidobacterium could suppress Parkinson’s disease by preventing the decrease in mitochondrial homeostasis and causing an increase in membrane potential. In the present study, nematodes that were fed BL showed upregulated dopaminergic neural expression and downregulated α-synuclein aggregation (Figs. 10A and 10B). These results suggest that BL may have the potential to inhibit Parkinson’s disease.

Further analysis is needed, but we hope that Bifidobacterium will not only have a positive effect on health but will also have a preventive effect on disease.

Nematodes and Bifidobacterium

C. elegans variation Bristol N2 wild type, RW1596[stEx30(myo-3p::GFP::myo-3 + rol-6)V], SJ4103[zcIs14(myo-3::GFP(mit))], RB754[aak-2(ok524)X], BZ555[egIs1(dat-1p::GFP)], and NL5901[pkIs2386(unc-54p::α-synuclein::YFP + unc-119)]. Nematodes were obtained from the Caenorhabditis Genetics Center (CGC). C. elegans was reared on nematode growth medium (NGM) at 20°C coated with E. coli OP50 strain (OP plates)[6, 45].

B. longum (BR-108) (Combi Corporation, Tokyo, Japan), was heat-sterilized at 105°C for 20 min. For storage, 500 mg/ml of BR-108 aqueous solution was frozen and stored at -80°C. The frozen BR-108 aqueous solution was thawed and mixed with OP50 to a concentration of 50 mg/ml. Two samples were prepared: Worms grown on OP plates (CT) and those grown on BL plates coated with a mixture of OP50 and B. longum (BL).

Synchronization

Adult nematodes were collected using S-basal, which was made up of 0.1 M NaCl (Kanto Chemical, Tokyo, Japan) and 50 mM potassium phosphate buffer. The adults were treated with a NaClO solution, comprising 1:10 of 10 N NaOH (FUJIFILM Wako Pure Chemical Corporation, Osaka, Japan) and NaClO (Haiter; Kao, Tokyo, Japan). The nematodes were crushed using this treatment, and the eggs were collected for subsequent experiments. The L1 larvae obtained after incubating the collected eggs at 20°C for 18 h were used for the experiments. Synchronization was performed to align the growth stages of the eggs used in the experiment.

Gene expression

Synchronized N2 wild-type nematodes were grown on OP plates for 96 h and then transferred onto OP or BL plates (day 0). After the synchronization treatment, 0.5 mg/ml FUdR (FUJIFILM Wako) was used on days − 1 and 0 to inhibit egg-laying and development. On day 3, nematodes were collected, washed with dDW, and crushed with the Bio Masher II (Nippi, Tokyo, Japan) and Power Masher II (Nippi). The mRNA was extracted from the crushed solution using RNAiso Plus (Takara Bio, Shiga, Japan). Subsequently, cDNA was synthesized using the cDNA reverse transcription kit PrimeScript™ RT reagent kit with gDNA Eraser (Takara Bio) and underwent qPCR by the THUNDERBIRD SYBR qPCR Mix (Toyobo, Osaka, Japan) and a Thermal Cycler Dice® Real-Time System Lite (Takara Bio). Based on a previous study, Y45F10D.4 was chosen as an internal control for expression stability[46]. Each cDNA sample was measured in triplicate and independent experiments were performed at least thrice. Primers used in this assay are listed in Table 1.

Table 1

Sequences of the primers used in the gene expression analysis
Gene	5′-3′ Sense	5′-3′ Anti-sense
Y45F10D.4*	CGACAACCCGCGAAATGTCGGA	CGGTTGCCAGGGAAGATGAGGC
eat-3	CGACATCTGCTCAAACTTCGAT	CCAAGACCCATTTGAATCGAAC
fzo-1	GTGCTGCCGATAATGAACCAC	TTCCCGCTGTTCAGAACTAAC
drp-1	GAAGACGGTCAAATGGAACAC	GCACGGCATCGAAGTCTGT
*Internal control gene.

Long-term motility assay

Synchronized N2 nematodes were grown on OP plates for 96 h and then transferred onto OP or BL plates (day 0). Thereafter, the plates were changed every three days, and the number of thrashing movements of N2 nematodes was measured for 15 s. On days − 1, 0, and 3, 0.5 mg/ml FUdR (FUJIFILM Wako) was used to inhibit egg-laying and development. Similarly, measurements were performed for RB754 (aak-2) until day 9. To examine the association with mitochondria, the same experiments were conducted with the inhibitors of mitochondrial complexes I, II, III, IV, and V: rotenone (Sigma-Aldrich), 2-thenoyltrifluoroacetone (TTFA; Sigma-Aldrich), antimycin A (Sigma-Aldrich), sodium azide (FUJIFILM Wako), and N,N′-dicyclohexylcarbodiimide (DCCD; FUJIFILM Wako), respectively. 10, 20, and 50 µM rotenone; 500, 1,000, and 2,000 µM TTFA; 1, 10, and 20 µM antimycin; 100, 200, and 400 µM sodium azide; and 20, 50, and 100 µM DCCD were dropped onto the plate at the same time as the plate change (N = 10). Independent experiments were performed at least three times.

Long-term muscle mass assay

Synchronized nematodes, RW1596 (myo-3::GFP), were grown on OP plates for 96 h and then transferred to OP or BL plates (day 0). Thereafter, the plates were changed every three days and GFP fluorescence was measured using a BZ-X810 fluorescence microscope (KEYENCE, Osaka, Japan). In addition to motility measurements, spawning and development were inhibited with 0.5 mg/ml FUdR (FUJIFILM Wako) on days − 1, 0, and 3 (N ≥ 13). Independent experiments were performed at least three times.

Long-term intramuscular mitochondrial mass

Synchronized nematodes SJ4103 (myo-3::GFP(mit)) were grown on OP plates for 96 h and then transferred to OP or BL plates (day 0). Thereafter, the plates were changed every three days, and GFP fluorescence was measured using a BZ-X810 fluorescence microscope (KEYENCE). Spawning and development were inhibited with 0.5 mg/ml FUdR (FUJIFILM Wako) on days − 1, 0, and 3 (N ≥ 11). Independent experiments were performed at least three times.

Mitochondrial homeostasis assay

Synchronized nematodes SJ4103 (myo-3::GFP(mit)) were grown on OP plates for 96 h and then transferred to OP or BL plates (day 0). Thereafter, the plates were changed every three days and observed using a THUNDER fluorescence microscope imaging system (Leica, Wetzlar, Germany). Spawning and development were suppressed using 0.5 mg/ml FUdR (FUJIFILM Wako) on days − 1, 0, and 3 (N ≥ 5), Independent experiments were performed at least three times.

ATP assay

Synchronized N2 nematodes were grown on OP plates for 96 h and then transferred onto OP or BL plates (day 0). On days − 1, 0, and 3, 0.5 mg/ml FUdR (FUJIFILM Wako) was used to inhibit spawning and development. More than 200 nematodes were collected, washed with MilliQ water, and then crushed with the Bio Masher II (Nippi, Tokyo, Japan) and Power Masher II (Nippi) every 3 days. The crushed fluid was cooled and centrifuged (4°C, 1,000 g, 10 min) and ATP was extracted using the ‘Tissue’ ATP assay kit (TOYO B-Net Co., Ltd., Tokyo, Japan). Luciferase luminescence was quantified using a white 96-well plate (FUJIFILM Wako) and luminometer (Berthold Technologies, Bad Wildbad, Germany). ATP levels were measured in three wells. Independent experiments were performed at least thrice.

Long-term mitochondrial membrane potential and mitochondrial ROS assay

Synchronized nematodes SJ4103 (myo-3::GFP(mit)) were grown on OP plates for 96 h and then transferred to OP or BL plates (day 0). Thereafter, the plates were changed every three days. To measure mitochondrial membrane potential and mitochondrial ROS, 1 ml of 0.5 µM MitoTracker Orange CMTMRos (Thermo Fisher Scientific, Inc., Waltham, USA) and 1 ml of 0.5 µM MitoTracker Orange CM-H2TMRos (Thermo Fisher Scientific) were added respectively. After 3 h, the samples were collected and washed. Thereafter, the nematodes were fixed in 10% ethanol (Kanto Chemical) for 10 min, and the fluorescence of MitoTracker was measured using a BZ-X810 fluorescence microscope (KEYENCE). Spawning and development were inhibited with 0.5 mg/ml FUdR (FUJIFILM Wako) on days − 1, 0, and 3 (N ≥ 13). Independent experiments were performed at least three times. The same experiments were conducted with the inhibitors of the mitochondrial complexes mentioned previously, and the same concentrations of the inhibitors were dropped onto the plate at the same time as the plate change (see ‘Long-term motility assay’). For the membrane potential assay, N ≥ 10, and for the mitochondrial ROS assay, N ≥ 11. Independent experiments were performed at least three times.

Dopaminergic neuronal mass assay

Synchronized nematodes BZ555 (dat-1p::GFP) were grown on OP plates for 96 h and then transferred to OP or BL plates (day 0). Thereafter, the plates were changed every three days. Twenty worms were transferred to a well and GFP fluorescence was measured using a Synergy H1 fluorescent microplate reader (Biotek Instruments, Vermont, USA) in a 96 well plate (Thermo Fisher Scientific, Inc.). In addition to motility measurements, spawning and development were inhibited with 0.5 mg/ml FUdR (FUJIFILM Wako) on days − 1, 0, and 3. Each GFP sample was measured in three wells, and independent experiments were performed at least three times.

α-synuclein mass assay

Synchronized nematodes NL5901 (unc-54p::α-synuclein::YFP) were grown on OP plates for 96 h and then transferred to OP or BL plates (day 0). Thereafter, the plates were changed every three days. Twenty worms were transferred to a well and YFP fluorescence was measured using a Synergy H1 fluorescent microplate reader (Biotek Instruments) in a 96 well plate (Thermo Fisher Scientific, Inc.). In addition to motility measurements, spawning and development were inhibited with 0.5 mg/ml FUdR (FUJIFILM Wako) on days − 1, 0, and 3. Each YFP sample was measured in three wells and independent experiments were performed at least three times.

Statistical analysis and figure drawing

Statistical analysis and figure drawing were performed using Python (version 3.9.5) with the following packages: NumPy, Matplotlib, SciPy, and statsmodels. Data are presented as the mean ± SEM, and statistical analysis was performed using Welch’s t-test for the two-group test and one-way ANOVA followed by Tukey’s HSD post-hoc test for three or more group tests. Statistical significance was set at P < 0.05.

Funding

This work was supported in part by Grants-in-Aid for Scientific Research and Education from the University of Tsukuba, Japan, and Combi Co., Ltd, Tokyo, Japan. The sponsors had no role in the design, execution, interpretation, or writing of the study

Acknowledgements

We would like to thank Combi Co., Ltd, for providing the Bifidobacterium sample. Nematodes used in the study were supplied by the Caenorhabditis Genetic Centre (CGC), University of Minnesota, Minneapolis, MN, USA and the National BioResource Project (NBRP), Tokyo Women’s Medical University, Japan.

Author contributions

TS and KS conceived and designed the study; TS performed all experiments; TS and KS analyzed data; and TS and KS wrote the paper. TS and KS have revised the manuscript. KS supervised the study as a principal investigator. All authors read and approved the final manuscript.

Competing interest statement

All authors declare that this study is in competitive interest. However, All authors declare that this competitive interest does not affect the purpose, method, results, discussion, or manuscript writing of this study at all.

Data availability statement

The data underlying this article are available in the article and in its online supplementary material.

Animal experiments

Experiments using all animals are approved in accordance with the regulations of the University of Tsukuba Animal Experiment Committee.

Mitsuoka (1972) Die Darmflora bei Menschen. I. Mitteilung. Die Zusammensetzung der Faekalflora der verschiedenen Altergruppen. Zbl Bakteriol Parasitenkd Infektionskr Htg I Orig A
Picard C, Fioramonti J, Francois A, et al (2005) bifidobacteria as probiotic agents–physiological effects and clinical benefits. Aliment Pharmacol Ther 22:495–512
Mitsuoka T (1984) Taxonomy and Ecology of Bifidobacteria. Bifidobact Microflora 3:11–28
Sekirov I, Russell SL, Antunes LCM, Finlay BB (2010) Gut microbiota in health and disease. Physiol Rev 90:859–904
Sugawara T, Sakamoto K (2018) Killed Bifidobacterium longum enhanced stress tolerance and prolonged life span of Caenorhabditis elegans via DAF-16. Br J Nutr 120:872–880
Stiernagle T (2006) Maintenance of C. elegans. WormBook 1–11
Sugawara T, Sakamoto K (2020) Quercetin enhances motility in aged and heat-stressed Caenorhabditis elegans nematodes by modulating both HSF-1 activity, and insulin-like and p38-MAPK signalling. PLoS One 15:e0238528
Sugawara T, Furuhashi T, Shibata K, et al (2019) Fermented product of rice with Lactobacillus kefiranofaciens induces anti-aging effects and heat stress tolerance in nematodes via DAF-16. Biosci Biotechnol Biochem 83:1484–1489
Kim W, Underwood RS, Greenwald I, Shaye DD (2018) OrthoList 2: A New Comparative Genomic Analysis of Human and Caenorhabditis elegans Genes. Genetics 210:445–461
Morris ME (2000) Movement disorders in people with Parkinson disease: a model for physical therapy. Phys Ther 80:578–597
Curtis R, O’Connor G, DiStefano PS (2006) Aging networks in Caenorhabditis elegans: AMP-activated protein kinase (aak-2) links multiple aging and metabolism pathways. Aging Cell 5:119–126
Wang H, Webster P, Chen L, Fisher AL (2019) Cell-autonomous and non-autonomous roles of daf-16 in muscle function and mitochondrial capacity in aging C. elegans. Aging 11:2295–2311
Hahm J-H, Jeong C, Lee W, et al (2020) A cellular surveillance and defense system that delays aging phenotypes in C. elegans. Aging 12:8202–8220
Palikaras K, Lionaki E, Tavernarakis N (2015) Coordination of mitophagy and mitochondrial biogenesis during ageing in C. elegans. Nature 521:525–528
Breckenridge DG, Kang B-H, Kokel D, et al (2008) Caenorhabditis elegans drp-1 and fis-2 regulate distinct cell-death execution pathways downstream of ced-3 and independent of ced-9. Mol Cell 31:586–597
Zorova LD, Popkov VA, Plotnikov EY, et al (2018) Mitochondrial membrane potential. Anal Biochem 552:50–59
Tang X, Luo Y-X, Chen H-Z, Liu D-P (2014) Mitochondria, endothelial cell function, and vascular diseases. Front Physiol 5:175
Detaille D, Pasdois P, Sémont A, et al (2019) An old medicine as a new drug to prevent mitochondrial complex I from producing oxygen radicals. PLoS One 14:e0216385
Lay S, Sanislav O, Annesley SJ, Fisher PR (2016) Mitochondrial Stress Tests Using Seahorse Respirometry on Intact Dictyostelium discoideum Cells. Methods Mol Biol 1407:41–61
Dirksen P, Marsh SA, Braker I, et al (2016) The native microbiome of the nematode Caenorhabditis elegans: gateway to a new host-microbiome model. BMC Biol 14:38
Zhang F, Berg M, Dierking K, et al (2017) Caenorhabditis elegans as a Model for Microbiome Research. Front Microbiol 8:485
Tenor JL, Aballay A (2008) A conserved Toll-like receptor is required for Caenorhabditis elegans innate immunity. EMBO Rep 9:103–109
Sun S, Mizuno Y, Komura T, et al (2019) Toll-like receptor homolog TOL-1 regulates Bifidobacterium infantis-elicited longevity and behavior in Caenorhabditis elegans. Biosci Microbiota Food Health 38:105–110
Michelsen KS, Aicher A, Mohaupt M, et al (2001) The role of toll-like receptors (TLRs) in bacteria-induced maturation of murine dendritic cells (DCS) Peptidoglycan and lipoteichoic acid are inducers of DC maturation and require TLR2. J Biol Chem 276:25680–25686
Schwandner R, Dziarski R, Wesche H, et al (1999) Peptidoglycan- and lipoteichoic acid-induced cell activation is mediated by toll-like receptor 2. J Biol Chem 274:17406–17409
Cheesman HK, Feinbaum RL, Thekkiniath J, et al (2016) Aberrant Activation of p38 MAP Kinase-Dependent Innate Immune Responses Is Toxic to Caenorhabditis elegans. G3 6:541–549
Toda K, Yamauchi Y, Tanaka A, et al (2020) Heat-Killed Bifidobacterium breve B-3 Enhances Muscle Functions: Possible Involvement of Increases in Muscle Mass and Mitochondrial Biogenesis. Nutrients 12:219
Schieber M, Chandel NS (2014) ROS function in redox signaling and oxidative stress. Curr Biol 24:R453-62
Kim H, Perentis RJ, Caldwell GA, Caldwell KA (2018) Gene-by-environment interactions that disrupt mitochondrial homeostasis cause neurodegeneration in C. elegans Parkinson’s models. Cell Death Dis 9:555
Chaudhari SN, Kipreos ET (2017) Increased mitochondrial fusion allows the survival of older animals in diverse C. elegans longevity pathways. Nat Commun 8:182
Apfeld J, O’Connor G, McDonagh T, et al (2004) The AMP-activated protein kinase AAK-2 links energy levels and insulin-like signals to lifespan in C. elegans. Genes Dev 18:3004–3009
Jornayvaz FR, Shulman GI (2010) Regulation of mitochondrial biogenesis. Essays Biochem 47:69–84
Marin TL, Gongol B, Zhang F, et al (2017) AMPK promotes mitochondrial biogenesis and function by phosphorylating the epigenetic factors DNMT1, RBBP7, and HAT1. Sci Signal 10:. https://doi.org/10.1126/scisignal.aaf7478
Luz AL, Lagido C, Hirschey MD, Meyer JN (2016) In Vivo Determination of Mitochondrial Function Using Luciferase-Expressing Caenorhabditis elegans: Contribution of Oxidative Phosphorylation, Glycolysis, and Fatty Acid Oxidation to Toxicant-Induced Dysfunction. Curr Protoc Toxicol 69:25.8.1–25.8.22
Son HG, Altintas O, Kim EJE, et al (2019) Age-dependent changes and biomarkers of aging in Caenorhabditis elegans. Aging Cell 18:e12853
Dudkina NV, Kouril R, Peters K, et al (2010) Structure and function of mitochondrial supercomplexes. Biochim Biophys Acta 1797:664–670
Cogliati S, Frezza C, Soriano ME, et al (2013) Mitochondrial cristae shape determines respiratory chain supercomplexes assembly and respiratory efficiency. Cell 155:160–171
Sherer TB, Betarbet R, Testa CM, et al (2003) Mechanism of toxicity in rotenone models of Parkinson’s disease. J Neurosci 23:10756–10764
Kösel S, Hofhaus G, Maassen A, et al (1999) Role of mitochondria in Parkinson disease. Biol Chem 380:865–870
Thomas B, Beal MF (2007) Parkinson’s disease. Hum Mol Genet 16 Spec No. 2:R183-94
Leong SL, Cappai R, Barnham KJ, Pham CLL (2009) Modulation of α-Synuclein Aggregation by Dopamine: A Review. Neurochem Res 34:1838–1846
Sherer TB, Kim JH, Betarbet R, Greenamyre JT (2003) Subcutaneous rotenone exposure causes highly selective dopaminergic degeneration and alpha-synuclein aggregation. Exp Neurol 179:9–16
Perez-Pardo P, Dodiya HB, Engen PA, et al (2018) Gut bacterial composition in a mouse model of Parkinson’s disease. Benef Microbes 9:799–814
Imai Y, Inoshita T, Meng H, et al (2019) Light-driven activation of mitochondrial proton-motive force improves motor behaviors in a Drosophila model of Parkinson’s disease. Commun Biol 2:424
(2014) Nematode Growth Medium (NGM). Cold Spring Harb Protoc 2014:db.rec081299
Zhang Y, Chen D, Smith MA, et al (2012) Selection of Reliable Reference Genes in Caenorhabditis elegans for Analysis of Nanotoxicity. PLoS One 7:e31849

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Bifidobacterium longum upregulates mitochondrial activity and suppresses Parkinson’s disease in Caenorhabditis elegans

Status:

Version 1

Abstract

Figures

Introduction

Results

Discussion

Materials And Methods

Declarations

References

Additional Declarations

Status:

Version 1