Plants
Wild type L. esculentum (‘Yaxin 87-5’) seeds were obtained from Yaxin Seed Co. Ltd. (Shihezi City, Xinjiang, China). Plants were first grown in a 25°C tissue culture room (16/8 hour light/dark cycle) with 60-70% relative humidity and 200 µmol m−2 s−1 light intensity. Seedlings were next transplanted to pots that contained an equal mixture of soil, peat, and vermiculate, and were transferred to a 22-28°C greenhouse with natural lighting and identical humidity and light cycle conditions. While in this greenhouse, plants underwent irrigation with 500 mL of Hoagland’s nutrient solution two times each week.
LeGPA1 cloning
A RNAisoPlus kit (TaKaRa) was used to extract DNA from the leaves of tomato plants, with DNase I on-column digestion being conducted based on provided instructions. PrimeScript RTase (TaKaRa) was used for first-strand cDNA synthesis, after which PCR was used to amplify full-length LeGPA1 using the LeGPA1 (Kpn Ⅰ)-CF and LeGPA1 (Sal I)-CR (Table 1) primers designed using Solanum lycopersicum gene sequences (GenBank ID: NM_001306055.1). PrimeSTAR Max DNA polymerase (TaKaRa) was used for PCR with thermocycler settings as follows: 95°C for 5 min; 35 cycles of 95°C for 30 s, 56°C for 30 s; 72°C for 10 min. This approach yielded a 1176-bp PCR fragment that we then cloned into the pMD19-T vector (TaKaRa). The identity of this fragment was confirmed via DNA sequencing.
Table 1 List of primers used in this study.
Name
|
Sequence (5’-3’)
|
Purpose
|
LeGPA1 (Kpn Ⅰ)-F
|
GGTACCATGCTGTCGGTGGTTTTCGAA
|
Cloning
|
LeGPA1 (Sal Ⅰ)-R
|
GTCGACTCATAATAAACCTGCTTCGAA
|
Cloning
|
LeGPA1 (Xba Ⅰ)-R
|
TCTAGAAATAAACCTGCTTCGAAGAGA
|
Subcellular localization
|
LeGPA1 (Xho I and Sal I )-F
|
CTCGAGTCCAGATTGTGCCCATTA
|
RNAi upstream
|
LeGPA1 (Bgl II and BamH I )-R
|
AGATCTGACCCACTCAAAGAGTT
|
RNAi downstream
|
LeGPA1-qF
|
CTACAGTCAAGCCGATGATGAG
|
qRT-PCR
|
LeGPA1-qR
|
AAAGCCAGTTTGGAACAAGAGT
|
qRT-PCR
|
LeEF1α-qF
|
GGAACTTGAGAAGGAGCCTAAG
|
qRT-PCR
|
LeEF1α-qR
|
CAACACCAACAGCAACAGTCT
|
qRT-PCR
|
LeSOD-qF
|
GGCCAATCTTTGACCCTTT
|
qRT-PCR
|
LeSOD-qR
|
AGTCCAGGAGCAAGTCCAGT
|
qRT-PCR
|
LePOD-qF
|
GTCCGGGAGTTGTTTCTTGT
|
qRT-PCR
|
LePOD-qR
|
ATCACCATTGGCTTCTGACA
|
qRT-PCR
|
LeCAT-qF
|
ATTTGGTGGAGAAACTTGCC
|
qRT-PCR
|
LeCAT-qR
|
CTGTACACCAGGAGCTCGAA
|
qRT-PCR
|
LeDRCi7-qF
|
TTGTGTTTCTGTGTTGTTTTGG
|
qRT-PCR
|
LeDRCi7-qR
|
GCACATACATATGCACTTACATACAG
|
qRT-PCR
|
LeTPS1-qF
|
GGTACCTGCAGACACTGAGTGGAA
|
qRT-PCR
|
LeTPS1-qR
|
CTGTCGACTATACAAAGGATGCATGATTCTTAAC
|
qRT-PCR
|
LelICE1-qF
|
GGAAGGAAAAGCGGTGAAC
|
qRT-PCR
|
LelICE1-qR
|
AACACATCCAACACAAACCC
|
qRT-PCR
|
LeCBF1-qF
|
TTCATCGTCATCGTCGTTTTCT
|
qRT-PCR
|
LeCBF1-qR
|
TCCTCTTCCTGATTCCCCTGT
|
qRT-PCR
|
LeCOR413PM2-qF
|
AACTGGAGGAGCAACATA
|
qRT-PCR
|
LeCOR413PM2-qR
|
TCAAGCCAATCTGGAAAG
|
qRT-PCR
|
LeGPA1-qF
|
AGGTTCCAGATTGTGCCCATTA
|
RT-PCR
|
LeGPA1-qR
|
TCCTGTTGAAACTGACTGGTAATCT
|
RT-PCR
|
LeEF1α-qF
|
TCAGGCTGACTGTGCTGTTCTC
|
RT-PCR
|
LeEF1α-qR
|
CTGGGTCATCCTTGGAGTTTGAG
|
RT-PCR
|
Overexpression and RNAi plasmid construction
To overexpress LeGPA1, we cloned the PCR-amplified LeGPA1 fragment into the pCAMBIA2300 binary vector using Kpn Ⅰ and Sal I restriction sites and the 35S promoter to control transcription. RNAi plasmids were constructed by cloning a 220-bp LeGPA1-based gene segment encoding RNAi specific for LeGPA1 bases 340-560. This segment was amplified via PCR with appropriate primers (Table 1) prior to cloning into the pCAM2300 vector. The identities of all constructs were confirmed via sequencing.
LeGPA1 sequence assessment
DNAMAN (v8.0) was used to align the LeGPA1 sequence. The TMHMM algorithm (http://www.cbs.dtu.dk/services/TMHMM/) was used for predicting transmembrane domains. MEGA 5.1 (http://www.megasoftware.net/) was used for phylogenetic analyses based on a Neighbor-Joining approach and 1,000 bootstrap replicates, with the deletion of bootstrap scores of <50%.
LeGPA1 subcellular localization analyses
The full-length LeGPA1 open-reading frame (ORF) with no stop codon was amplified via PCR using appropriate primers shown in Table 1, including LeGPA1 (BamH I)-SF and LeGPA1(Xba I)-SR. These primers respectively included BamH I and Xba I restriction sites, and the resultant fragment was then cloned into the pCAMBIA2300-GFP expression vector yielding a p35S-LeGPA1-GFP plasmid under CaMV 35S promoter control. Arabidopsis mesophyll protoplasts were then transfected via a PEG approach with both this p35S-LeGPA1-GFP plasmid as well as with the PM-rk plasmid to assess plasma membrane localization [37, 38, 39]. Following a 16 h culture at 23 ℃, protoplast fluorescence was evaluated via confocal microscopy (Leica Microsystems, Germany) with 488, 561 and 633 nm excitation wavelengths.
Assessment of the impact of stress on LeGPA1 gene expression
Wild-type tomatoes were grown under standard greenhouse as detailed above, after which a subset of these plants that appeared phenotypically similar were selected for stress treatments that were initiated when the light cycle began. LeGPA1 gene expression in a range of organs (fruit, flowers, stems, leaves, roots) from 80-day-old plants was assessed via qRT-PCR. In addition, LeGPA1 expression was assessed in wild-type tomatoes grown under salt, cold, or drought stress conditions. For cold stress, plants were treated for 48 h at 4°C. For drought conditions, plants were removed from soil, and roots were submerged for 48 h 5 cm deep in 20% PEG 6000. Salt stress was induced by removing plants from their soil and immersing the roots for 48 h in 200 mM NaCl. Leaves from identical positions on these plants were collected 0, 1, 3, 6, 9, 12, 24, and 48 h after the initiation of stress conditions. Plants were grown in three separate growth chambers for replicate samples. Collected leaves were snap-frozen prior to storage at −80°C.
A RNAprep Pure Plant Kit (Tiangen, China) was used to isolate sample RNA for qRT-PCR, after which cDNA was synthesized and analyzed with SYBR Green I Master Mix using a LightCycler 480Ⅱ platform (Roche Biochemicals, Indianapolis, IN, USA). As a normalization control for cold stress-related gene expression, the tomato EF1 gene (GenBank ID: X53043) was utilized [40](Lovdal and Lillo, 2009). Thermocycler seting were: 2 cycles of 95°C for 30 s; 50 cycles of 95°C for 5 s, 60°C for 10 s, and 68°C for 10 s. The ΔΔCt method [41] was used for comparing relative gene expression, with triplicate samples being analyzed independently. Primers used for this assay are shown in Table 1.
Transgenic plant preparation
Transgenic plants that either overexpressed LeGPA1 or an RNAi construct were prepared for this study. Briefly, the appropriate constructs were transformed into wild-type plants via the use of Agrobacterium tumefaciens strain GV3101. We then utilized 1/2 strength MS medium supplemented with 60 mg/L kanamycin to screen for transgenic plants. Isolated kanamycin-resistant T0 plants were evaluated via semi-quantitative reverse transcription PCR using LeGPA1 primers (Table 1), and qRT-PCR was then used to confirm the identities of different transgenic plants. Plants in the T2-generation that retained their ability to grow on MS media supplemented with 60 mg/L kanamycin were utilized as transgenic plants in downstream assays.
Assessment of stress response-induced changes in plants
Plants (wild-type or transgenic) from the T2-generation were grown for 3-6 weeks in a 25°C incubation chamber (16/8 h light/dark cycle; 70% humidity; 200 μmol m-2 s-1 photon flux density). After either 3 or 6 weeks, plants with uniform sizes were subjected to a 5 day cold stress exposure (4°C). Plants were grown in three separate growth chambers for replicate samples. Changes in plant phenotypes were then assessed, with imaging being conducted through the use of a Canon 80D camera. The second and third leaves from the tops of each of these plants were additionally collected, and stress response-related gene expression in these leaves was assessed via qRT-PCR. These samples were also used for antioxidant activity assays and assessments of plant physiology.
Physiological parameter analyses
Relative water content (RWC) was assessed as described in a study conducted by Lara et al [42] as follows: RWC = (FW − DW)/(TW − DW) × 100%. In this equation, FW corresponds to leaf fresh weight, TW corresponds to turgid weight (following leaves being incubated in dH2O for 24 h in the presence of light), and DW corresponds to dry weight (drying at 70 °C to a constant weight).
A modified thiobarbituric acid reaction described by Du et al [43] was used to assess MDA levels as a readout for membrane damage. Leaves were first excised, rinsed with dH2O, and discs were collected for MDA measurements with a UV-160A spectrophotometer (UV-160A, Shimadzu Scientific Instruments, Japan).
Relative electrolyte leakage (REL) was assessed via EC 215 conductivity meter (Markson Science Inc., CA, USA) based on the approach of Du et al [43] using the formula REL = (C1 − CW)/(C2 − CW) × 100, with C1 and C2 corresponding to conductivity before and after boiling, respectively, and CW corresponding to the conductivity of deionized water.
Photosystem II (PSII) maximal efficiency in tomato leaves was evaluated via portable fluorescence analyzer (DUAL-PAM-100, Walz, Germany). Briefly, leaves were placed in the dark for 30 minutes, after which they were exposed to a 1 second flash of light. Minimal fluorescence (F0) when all PSII reaction centers are open for this assay was considered to represent the dark-adapted state, whereas maximal fluorescence (Fm) was the fluorescence intensity measured following light saturation, with all of these reaction centers being closed. Variable fluorescence (Fv) was calculated as follows: Fv = Fm – F0 [44].
Free proline was assessed as in the study of Bates et al [45]. Briefly, 4 mL of 3% sulfosalicylic acid was used to extract leaf samples (200 mg) for 10 minutes at 100°C, after which homogenates were spun for 2 minutes at 12,000 × g. Next, a 2 mL supernatant volume was mixed with equivalent volumes of acid-ninhydrin reagent and glacial acetic acid. This solution was then boiled for 30 minutes, prior to transfer into an ice bath. Absorbance at 520 nm was then assessed following toluene (4 mL)-mediated extraction of the organic phase. Proline concentrations were determined based upon comparisons of sample absorbance to a proline standard curve.
The Anthrone method was used for analyses of soluble sugars, using gluose as a standard [46]. Briefly, an initial leaf sample (200 mg) was ground, homogenized in a 1 mL dH2O volume, boiled for 20 minutes, spun for 10 minutes at 13,000 × g, and a 2 mL supernatant volume was then combined with 1.8 mL dH2O and 2.0 mL of 0.14% (w/v) Anthrone solution in 100% H2SO4. This solution was rested for 20 minutes in boiling water, after which it was cooled and the A620 was assessed. Total soluble sugar levels were assessed by comparing these A620 values to those derived from a glucose standard curve. Experiments were conducted in triplicate using three replicate samples.
ROS and antioxidant activity assays
A fresh sample (0.5 g) of leaves from T2-generation wild-type or transgenic plants was collected following cold or drought stress exposure. These leaves were minced, homogenized on ice in a 4 mL volume of 50 mM sodium phosphate buffer (pH 7.8) with 1% polyvinylpyrrolidone and 10 mM β-ME, and spun at 17,426 xg for 15 minutes at 4°C. CAT activity was assessed as described by Cakmak and Marschner [47]. SOD activity was evaluated as reported by Beauchamp and Fridovich [48]. POD activity was determined based on the methods described by Doerge et al [49]. An Infinite M200 Pro microplate reader (Tecan Group Ltd., Männedorf, Switzerland).
H2O2 and O2− levels were assessed as described by Benikhlef et al [50]. A UV-160A spectrophotometer (Shimadzu Scientific Instruments, Japan) was used to assess absorbance for these analyses.
Statistical analysis
Data were assessed using SPSS v13.0 and GraphPad Prism 7.0. Relative LeGPA1 expression was given as means ± SD from triplicate samples, with three leaves per seedling being used as a replicate. Expression levels were normalized to baseline (0 h) levels. Dunnett’s multiple comparison test was used to compare plants. *P <0.05 and **P <0.01 correspond to significance.