Subjects
In total, this study was conducted for 61 days, started with the first day to conduct screening phase and followed by sixty days of consumption phase. Forty primary school children aged 10-12 years old from East Lombok, Indonesia participated in this study. The participants were randomly and equally divided into two groups of 20 children, namely placebo group and probiotic group. All participants have met inclusion criteria, i.e. BMI ≤ -2 SD, had no history of reaction to probiotics component. Candidates were excluded if they had a digestive system disorder and lactose intolerant. Subsequently, subjects would be disqualified from the study if during the study they took antibiotics, prebiotics, probiotics, supplements, or immune regulators. Before follow the research all subject must signed inform consent by the parent/legal guardian. During the study, subjects were obliged to fill in a subject diary to record their food intake, medical record and medicine intake, and defecation frequency. Subject who pass the criteria will given informed consent and must be signed accompanied by a parent or guardian who will accompany the subject during the research process.
Ethics Declaration
The study protocol was approved by Medical and Health Research Ethics Committee (MHREC), Faculty of Medicine, Universitas Gadjah Mada (Approval reference: KE/0861/08/2018) Registered on 26 June 2018 and approved on 17 September 2018. This research done by regulation that applicable in Indonesia and based by guidelines from World Medical Assembly (Declaration Helsinki, last amendment, Edinburgh, Scotland, 2000 and last clarified in Tokyo, 2004, appendix 7) also with notes of CPMP on GCP (CPMP/ICH/135/95). Data information such as Informed Consent obtained from all participant/subject and signed from parent/legal guardian. This study also registered in Center For Research And Development Of Health Resources And Services, Health Research and Development Agency, Ministry of Health of the Republic of Indonesia with registration number INA-PA2HB87 (Registered on 16-12-2020) .
Research products
Probiotic powder containing L. plantarum Dad-13 of 1 × 109 CFU/gram were supplemented to probiotic group. The probiotic L. plantarum Dad-13 was deposited in ampoules at the Food and Nutrition Culture Collection (FNCC), Center for Food and Nutrition Studies, Universitas Gadjah Mada, Indonesia. Subsequently, probiotic powder was prepared using Halal media and stored in a refrigerator (<4°C) before being consumed. Meanwhile, placebo group was given skim milk powder from commercial product.
Research design
This research was conducted using a Randomized Double-Blind Placebo-Controlled trial for 60 days. During the period of consumption, 1 gram of probiotic powder and 1 gram of skim milk powder were consumed by probiotic and placebo group, respectively. The subjects consumed the products during their school break time. Additionally, on Sunday or public holiday consumption was done at home. Figure 1 below depicts the research design in this study.
Figure 1. Schematic diagram of research design
Faecal samples collection
Faecal samples were collected twice, in the morning of day-1 and day-61. Each subject collected their faecal sample at home using a stool kit containing masks, gloves, trail paper, ice gel and sterile tubes, spoon, glass beads and RNA. Subjects were asked to defecate on a trail paper to avoid contamination by urine or other liquid. Two spoons of faecal specimen were quickly inserted into the tube. Subsequently, the faecal samples were transported to the laboratory in a cooler box (<10°C) within a maximum of one hour after collection. Faecal samples were labelled and stored in a freezer at a temperature of -25°C for further molecular analysis.
Anthropometric measurement
Measurement of weight and height of the subjects were performed every 30 days. A 2-m-long and 1-mm-wide metal tape (Microtoise) was used for height measurement, with round up to 0.1 cm. Body weight was measured using an indoor light clothing and without shoes, with round up to 0.1 kg. Each measurement was done twice for each subject and average value was used for data entry.
pH analysis for faecal samples and analysis of stool quality
For each faecal sample, 0.2 - 1 g was taken and added with distilled water with ratio 1:5. The mixture was vortexed and pH was measured by inserting a glass electrode of pH meter [10]. Additionally, stool quality of each subject was evaluated in several parameters, i.e. consistency of feces, colour, frequency of defecation per day and number of days of defecation. Stool consistency was compared to Bristol Stool Chart consisted of type 1 – 7 (1 being separate hard lump, to 7 being liquid consistency with no solid pieces). Colour of faeces consisted of type 1 – 4 (1= yellow, 2= brownish yellow, 3= brown, 4= green) [20]. Frequency of defecation was counted per 10 days and number of days of defecation was counted per 10 days.
Analysis of faecal microbiota with Real-Time PCR
Gut microbiota of interest in this study are listed in Table 1 which are associated with malnutrition. Real-Time PCR was used to investigate the number of specific microbiota in a sample. Extraction of DNA used a ZymoBIOMICSTM DNA Miniprep Kit (D4300) from Zymo Research Corp. (USA). The extraction followed the instructions from the kit with a slight modification. DNA sample was contained in a column/well with a composition of 10 µL Evagreen®, 1 µL forward primer, 1 µL reverse primer, and 1 µL isolated DNA. Double-distilled water (ddH2O) was added until the solution reached 20 µL. In the process of amplification in PCR, each had its specific condition (Table 1), especially for annealing temperature for each primer. The selected microbiota was analysed in a selected DNA sample using a primer.
Table 1. List of primers and PCR condition
No
|
Bacteria
|
Primer
|
Conditions
|
Source
|
1
|
Prevotella
|
forward (g-Prevo-F) CACRGTAAACGATGGATGCC,
reverse (g-Prevo-R) GGTCGGGTTGCAGACC.
|
1 cycle at 98°C for 2 min,
34 cycles at 98°C for 2 sec and 57.1°C for 30 sec,
the last 1 cycle at 65°C – 95°C for 5 sec.
|
[33]
|
2
|
Bacteroides
fragilis
|
forward (g-Bfra-F2) AYAGCCTTTCGAAAGRAAGAT, reverse (g-Bfra-R) CCAGTATCAACT GCAATTTTA.
|
1 cycle at 98°C for 2 min,
34 cycles at 98°C for 2 sec and 50°C for 30 sec,
at last 1 cycle at 65°C – 95°C for 5 sec.
|
[33]
|
3
|
Clostridium
coccoides
|
forward (g-Ccoc-F)
AAATGACGG TACCTGACTAA, reverse (g-Ccoc-R) CTTTGAGTTTCATTCTTGCGAA.
|
1 cycle at 98°C for 2 min; 34 cycles at 98°C for 2 sec and 52°C for 30 sec
at last 1 cycle at 65°C – 95°C for 5 sec.
|
[33]
|
4
|
Bifidobacterium
|
g-Bifid-F (CTCCTGGAAACGGGTGG)
Bifid-R (GGTGTTCTTCCCGATATCTACA
|
1 cycle at 98oC for 2 min; 34 cycles at 98oC for 2 sec and 58.8oC for 30 sec. At last 1 cycle at 65oC -95oC for 5 sec.
|
[33]
|
5
|
Enterobacteriaceae
|
En-lsu-3F (TGCCGTAACTTCGGGAGAAGGCA) and En-lsu-3R (TCAAGGACCAGTGTTCAGTGTC) for
|
1 cycle at 98oC for 2 min; 34 cycles at 98oC for 2 sec and 60oC for 30 sec. At last 1 cycle at 65oC -95oC for 5 sec.
|
[33]
|
6
|
Escherichia coli
|
forward (g-Ecoli-F) CATGCCGCGTGTATGAAGAA reverse (Ecoli-R)
CGGGTAACGTCAATGAGCAAA
|
1 cycle at 98˚C for 2 min; then 34 cycles at 98˚C for 2 sec and 59.9˚C for 30 sec, with the last 1 cycle at 65˚C–95˚C for 5 sec.
|
[34]
|
7
|
Klebsiella pneumoniae
|
forward (Kpneu-F) CCTGGATCTGACCCTGCAGTA reverse (Kpneu-R) CCGTCGCCGTTCTGTTTC
|
1 cycle at 98˚C for 2 min; then 34 cycles at 98˚C for 2 sec and 61˚C for 30 sec, with the last 1 cycle at 65˚C–95˚C for 5 sec.
|
[35]
|
8
|
Streptococcus
|
forward CTWACCAGAAAGGGACGGCT
reverse AAGGRYCYAACACCTAGC
|
1 cycle at 98˚C for 2 min then 34 cycles at 98˚C for 2 seconds and 58˚C for 30 seconds and with the last 1 cycle at 65˚C–95˚C for 5 seconds
|
[36]
|
9
|
Enterococcus
|
forward (g-Encoc-F) ATCAGAGGGGGATAACACTT
reverse (g-Encoc-R) ACTCTCATCCTTGTTCTTCTC.
|
The amplification cycle for Enterococcus primer was 1 cycle at 98˚C for 2 minutes then 34 cycles at 98˚C for 2 seconds and 48˚C for 30 seconds and the last 1 cycle at 65˚C–95˚C for 5 seconds.
|
[33]
|
10
|
Lactobacillus plantarum subgroup
|
sg-Lpla-F (CTCTGGTATTGATTGGTGCTTGCAT) and sg-Lpla-R (GTTCGCCACTCACTCAAATGTAAA) for
|
1 cycle at 98oC for 2 min; 34 cycles at 98oC for 2 sec and 60oC for 30 sec. At last 1 cycle at 65oC -95oC for 5 sec.
|
[33]
|
Analysis of Short-chain fatty acid
Analysis of short chain fatty acid (SCFA) followed the methods by [21]. Approximately 0.5 – 1 gram of fecal sample was added with distilled water with ratio of 1:3. Subsequently, the mixture was vortexed for 5 minutes, followed by centrifugation at 10000 rpm for 10 minutes. The supernatant was then analysed using gas chromatography (GC) (Shidmadzu, GC 2010 plus series) with specifications of 240°C injector, RTX-Wax column, column length 30 m, column temperature 145°C, diameter 0.25, column flow 0.8 minutes with helium as carrier gas and flame ionization detector (FID) at 240°C.
Statistical analysis
Statistical analysis was performed using IBM Statistic SPSS 20.0 with 95% confidence interval (α = 5%). Chi-Square Test; independent t-test; Wilcoxon test were carried out to evaluate the significant differences of observed parameters between placebo and probiotic-treated group. In addition, a paired t-test was used to analyse the observed parameters before and after consumption of placebo powder or indigenous probiotic powder.