2.1 Reagents
TGF-ß1 was purchased from Sino Biological (Beijing, China). The adeno-associated virus 9 (AAV9) was purchased from Weizhen Technology Co., LTD. (Shandong, China). In the TFEB-overexpression mice built by adeno-associated virus, gene ID: NM_011549, vector: PAV-CMV-P2A-GFP (CMV promoter), virus titer: 3.84 x 1013 µg/ml; AAV9-NC was GFP (CMV promoter) control adeno-associated virus with a titer of 8.02×1013 µg/mL. In the AAV9-shTFEB mice with TFEB expression down-regulated by AAV9 4in1shRNA, gene ID: NM_011549, vector: PAV-4IN1shrNA-GFP; primer design: positive CGGCAGTACTATGACTATGA, reverse: GCCGTCATGATACTGATACTA; Virus titer: 2.22×1013 µg/mL; AAV9-sh-TFEB virus was AAV9-U6-GFP control adeno-associated virus inserted with nonsense sequence, and the virus titer was 4.74×1013 µg/ mL. All the dilution virus titer was 1×1013 ug/ml, and the dose was 10µl for each mouse. The adenovirus used in the in vitro study was purchased from Hanheng Biology (Shanghai, China). Ad-TFEB was HBAD-TFeb-EGFP overexpressed virus, gene sequence number: NM_001025707. Ad-Gfp was used as a control virus with HBAD-EGFP overexpression. The multiplicity of cellular infection (MOI) of the virus infection complex in the 6-well plate was 30, with an adenovirus volume of 10μL. The MOI of the virus infection complex in the 24-well plate was 30, with an adenovirus volume of 3μL. The siRNAs were used to reduce TFEB expression, with Si-NC serving as control. The target sequence of siRNAs: GCAGTCTCAGCATCAGAAA.
2.2 Animals and MI modeling
We used male mice to establish a stable MI model considering that Estrogen has shown a protective effect against pathological hypertrophic remodeling in pressure-overload. [3, 13]. Two-month-old wild-type male C57BL/6 mice (20-30g) were purchased from the Animal Experimental Centre of Jicui Yaokang Biotechnology Co. LTD. (Jiangsu, China). All mice were fed in the SPF animal laboratory at the Animal Center of Sun Yat-Sen University, Guangzhou, China, with free access to standard laboratory food and water. Thirty mice were equally randomized into five groups: Sham group, AAV9-TFEB group, AAV9-NC group, AAV9-shTFEB group, and AAV9-shNC group. The AAV9-NC and AAV9-sh-NC group served as controls of the AAV9-TFEB and AAV9-sh-TFEB groups, respectively. All mice were pretreated with myocardial multipoint injection of Adeno-associated virus 9 (AAV9) for two weeks before the MI modeling. All the dilution virus titer was 1×1013 ug/ml, and the dose was 10µl for each mouse. After 14 days of feeding, the anterior descending branch of the mice’s left coronary artery (LAD) was permanently ligated to set up the MI model. The surgery was conducted under the anesthetization of 50 mg/kg intraperitoneally injected pentobarbital sodium (Sigma) and endotracheal intubation. For mice in the Sham group, the chest was surgically opened without LAD ligation. Echocardiography was performed every day for 28 days. The mice were anesthetized and sacrificed by cervical dislocation at different time points after MI or sham operation. Hearts were collected and stored at −80 °C for the next step measurements. The flowchart of this experiment is illustrated in figure 2A.
2.3 Echocardiography
Echocardiography was performed on the VisualSonics machine Vevo 3100. Mice were anesthetized by Isoflurane (Rayward Life Technology Co., LTD., Shenzhen, China). Mouse chests were hair-shaved, and the animals were positioned on a warm cushion. Left ventricular ejection fraction (LVEF) was measured in M-mode short-axis at the level of papillary muscles.
2.4 Masson staining and HE staining
The infarction regions of left ventricular tissues were fixed in 4% paraformaldehyde (Servicebio, Wuhan, China) for at least 24 hours, then embedded in paraffin. Sections of 3-6 μm thickness were stained following the Masson trichrome standard protocol (BP028, Biossci, China) and the HE staining protocol (BP092, Biossci, China). In Masson-stained sections, myocardial cells appear red, while collagen appears blue. In HE-stained sections, the cytoplasm was dyed pink, and the cell nucleus was stained blue.
2.5 Sirius red staining
The infarction regions of left ventricular tissues were fixed in 4% paraformaldehyde (Servicebio, Wuhan, China) for at least 24 hours before being embedded in paraffin. Sections of 3-6 μm thickness were stained by the Picro Sirius Red Stain Kit (Phygene, China) following the official guidelines. After staining, collagen I appears orange, and Collagen III appears green.
2.6 Wheat germ agglutinin staining
The whole heart was fixed in 4% paraformaldehyde (Servicebio, Wuhan, China) and embedded in paraffin. Sections of 3-6 μm thickness were stained with fluorescein isothiocyanate-conjugated wheat germ agglutinin (WGA-FITC, MP6325, MKbio, China) to assess the cardiomyocyte cross-sectional area in myocardial sections. The results of WGA staining were observed under a confocal microscope (LSM 880, Zeiss, Germany).
2.7 Immunofluorescence analysis
An immunofluorescence assay was performed to detect the expression and distribution of α‐smooth muscle actin (α‐SMA; 1:8000; Abcam) in the differentiated myofibroblasts, and vimentin (1:200; Abways) was used as an internal control tagging undifferentiated fibroblasts. TFEB protein was tagged by TFEB (1:200; Absin) antibody. In the immunofluorescence staining, the myocytes were marked by ACTA (1:200; Abcam) and the nuclei were counterstained with 0.5 µg/mL 4′,6‐diamidino‐2‐phenylindole (DAPI; 1:500, Solarbio). The result of staining was imaged using an immunofluorescence microscope (BX53, Olympus).
2.8 Protein extraction and Western blotting
Proteins in Cells or mice organs were extracted following standard procedures using the protein extraction reagents of Ripa (Millipore), PMSF (CST), a protease inhibitor (Roche), and phosphatase inhibitor (Roche). The protein concentration was tested by the BCA Quantitative Kit (Thermo). Equal amounts of total protein (30 μg) were separated by 8% SDS-PAGE gels and transferred to PVDF membranes. After being blocked in 5% skim milk for one hour, the membranes were subsequently incubated with primary antibodies at 4°C overnight and then the secondary antibodies at room temperature for one hour. The membranes were then exposed to chemiluminescence developing agents. The antibodies used in this process were as followed: mouse anti- Collagen III (NBP1-05119, Novus), rabbit anti- Collagen I (NB600-408, Novus), rabbit anti-LC3B (2775s, CST), rabbit anti-TFEB (abs131998, Absin), rabbit anti-Lamin-B1 (NBP2-48966, Novus), and rabbit anti-GAPDH (sc-166545, SANTACRUZ). GAPDH was used as an internal control.
2.9 Myocytes isolation and building of Oxygen Glucose Deprivation Model
Primary neonatal rat myocytes were isolated from the heart of 1- to 3-day-old SD rats, digested with 0.05% collagenase type II and trypsin, and dispersed via gentle mechanical attrition. After centrifugation, cells were cultured in DMEM/F-12 (Gibco), supplemented with 10% newborn calf serum (Gibco), 50 U/mL penicillin, 50µg/mL streptomycin in a 37°C, 5% CO2 incubator with assisted circulation. On day four, absorbed and discarded the culture medium gently, washed the wells using PBS (five minutes twice), and then added 1.5 mL sugar-free medium per well immediately. Oxygen Glucose Deprivation (OGD) modeling: The culture plate was placed in a sealed cell culture box with a ventilation tube, maintained with 95% N2+5% CO2 (flow rate kept at 0.2L /min). After 15 minutes of ventilation, the ventilation tube was closed to ensure the box was completely filled with mixed gas. The oxygen concentration at this time was 0.1%. Hypoxia was induced by incubation under 37 ℃.
2.10 Myocardial fibroblasts isolation and culture
Primary neonatal rat fibroblasts were isolated from the heart of 1- to 3-day-old SD rats. The fibroblasts were distinguished from myocytes by a shorter adherent time to the well. After centrifugation, cells were cultured in DMEM/F-12 (Gibco), supplemented with 10% fetal bovine serum (Gibco), 50 U/mL penicillin, 50µg/mL streptomycin in a 37°C, 5% CO2 incubator in NHC key Laboratory of Assisted Circulation. The second generation of the CFs was used for the experiments. Cells were treated with virus or siRNA and were cultured in a serum-free medium at least 24 hours before being treated with 5ng/ml TGF-ß1 for 12 hours.
2.11 Cell counting kit-8 (CCK-8) assay and EDU assay
CFs were transferred into 24-well plates. Cells were treated with Virus or siRNAs and were cultured for at least 24 hours in a serum-free medium before being treated with 5ng/ml TGF-ß1 for 12 hours. The proliferation of cells was determined by a CCK-8 kit (MCE) and an EDU kit (KTA2030, Abbkine). The optical density (OD) of each well was examined at 450 nm using a microplate reader (Thermo Scientific). The proliferation rate was calculated by the results of OD and fluorescence.
2.12 Transwell assay
Transwell assay was performed on the second generation of the CFs. Cells were treated with Virus or siRNAs and were cultured for at least 24 hours in a serum-free medium before being co-incubated with 5ng/ml TGF-ß1 and the Transwell inserts for 12 hours. CF cells were plated on the upper side of the chambers. After 12 hour’s incubation, the cells that migrated to the lower side of the chambers were counted through DAPI staining.
2.13 TUNEL assay
After adenovirus transductions, apoptotic cells in each well (24-well plates) were visualized using the TUNEL assay following the manufacturer's instructions (Roche). The results of TUNEL assay were observed and imaged under a confocal microscope (LSM 880, Zeiss, Germany).
2.14 Statistical analysis
All data were presented as the means ± standard deviation (SD). The results were analyzed by one-way analysis of variance (ANOVA) or the Student t-test, and a p < 0.05 was considered to be statistically significant.