2.1 Chemicals and reagents
Beberine (purity ≥ 99%, was dissolved in 0.1% DMSO) was purchased from Division of Chinese Material Medical and Natural Products, National Institute for the Control of Pharmaceutical and Biological Products, Ministry of Public Health (Beijing, China). Angiotensin IV and MK886 were purchased from Sigma-Aldrich (St. Louis, MO, USA). NG-nitro-L-arginine-methyl ester (L-NAME), BCA Protein Assay Kit, and Nitrite Detection Kit were purchased from Beyotime (Jiangsu, China). NOS Detection Kit was purchased from Nanjing Jiancheng Bioengineering Institute (Jiangsu, China). Trizol, Reverse Transcription Kit, SYBR-Green Supermix, and PCR primers were purchased from Takara Biotech. Co. Ltd. (Jiangsu, China). Mouse anti-rat PPARα monoclonal antibody was from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Mouse anti-rat β-actin antibody was from Proteintech Group, Inc. (Hubei, China). All other reagents were of analytical grade.
2.2 Primary neonatal rat cardiomyocyte isolation and culture
The Animal Laboratory Administration Center and Ethics Committee of Chongqing Medical University [SYXK (Chongqing) 2007-0001] approved the experimental procedures. Ventricular myocytes from 1 to 3 days old Sprague-Dawley rats (Animal Laboratory Center of Chongqing Medical University, Chongqing, China) were prepared and cultured for 48 h in Dulbecco’s modified Eagle’s medium (DMEM) containing 20% fetal bovine serum and 0.1 mmol/L 5'-bromodeoxyuridine. The seedings density at 0.5 × 105 to 1 × 105 cells/mL was used for measuring cell surface area, and 1.5 × 106 to 3 × 106 cells/mL was for mRNA extraction, evaluating cellular total protein content, and determining NOS activity and NO concentration in the media. The medium was replaced with serum-free DMEM for another 48 h before pharmacological treatment. Angiotensin Ⅳ (1 nmol/L) was used to stimulate the hypertrophy of cardiomyocytes. The anti-hypertrophic effects of berberine (from 10 μmol/L to 100 μmol/L) were studied. In addition, MK886 (0.3 μmol/L), a PPARα antagonist, and L-NAME (100 μmol/L), a NOS inhibitor, were used for investigating the relationship between the effects of berberine and the PPARα/NO pathway.
2.3. Morphometric analysis
Cellular hypertrophy was evaluated by measuring cardiomyocyte cell surface using a digital image analysis system (Leica QwinV3, Leica Microsystems Ltd., Cambridge, UK). Five random fields (with approximately 10 to 15 cells per field) from every sample were averaged and expressed as µm2/cell. All experiments were repeated three times.
2.4. Measurement of cardiomyocyte protein content
Collected cardiomyocytes were separated by trypsin and counted; they were then washed three times with ice-cold phosphate buffered solution (PBS), and then homogenized with RIPA lysis buffer and finally centrifuged at 12 000 g for 20 min at 4˚C. The protein concentration in the supernatant was determined with a BCA Protein Assay Kit, and then the protein concentration per 106 cells was calculated for a six times repeating.
2.5. Real time RT-PCR analysis of mRNA
Total RNA was extracted from the cells using a Trizol reagent, quantified by ultraviolet spectrometric detection (Eppendorf, Germany) and reverse transcribed into cDNA using a PrimeScript™ RT reagent kit, according to the manufacturer’s instructions. The primer sequences used were shown in Table 1. According to the standard protocol of SYBR® Premix Ex Taq™ II on the IQ5 real time RT-PCR system (Bio-Rad, USA). The standard cycling conditions were 95˚C for 8 min, followed by 40 cycles of 95˚C for 15 s, annealing for 1 min at different temperature [atrial natriuretic factor (ANF): 61.8˚C; PPARα: 60.9˚C; endothelial NOS (eNOS): 59.1˚C; β-actin: 59.1˚C), and 72˚C for 40 s. The amount of target gene mRNA relative to the internal control gene, β-actin, was calculated using the ∆Ct (Ct = cycle threshold) method as follows: the relative expression = 2‾ ∆Ct, ∆Ct = Ct (target gene) _ Ct (β-actin). Results of three independent experiments were used for statistical analysis.
TABLE 1: Oligonucleotide sequences for real time RT-PCR
Gene
|
Forward (5′-3′ orientation)
|
Reverse (5′-3′ orientation)
|
ANF
|
TGACAGGATTGGAGCCCAGAG
|
TCGAGCAGATTTGCTGTTATCTTC
|
PPARα
|
CTGACATTTGTGACTGGTCAAGCTC
|
TTTCCAGGTCATCTGCTTCAAGTG
|
eNOS
|
TGCAACAAACCGAGGCAATC
|
CACCAGCTGGCTGTTCCAGA
|
β-actin
|
GGCCAACCGTGAAAAGATGA
|
CAGCCTGGATGGCTACGTACA
|
Note: ANF: atrial natriuretic factor; eNOS: endothelial nitric oxide synthase; PPARα: peroxisome proliferator- activated receptor-α.
2.6. Western blot analysis of protein
The protein samples (50 mg) from cardiomyocytes were subjected to SDS-polyacrylamide gel electrophoresis and transferred to the membrane by wet method. Antibodies [PPARα (1:400), eNOS (1:900) and β-actin (1:800)] were added and incubated overnight after closed with BSA. The membranes were incubated with horseradish peroxidase-conjugateds econdary antibody (1:1000) for 2 h. ECL luminescence was used for visualization and Bio-Rad gel imaging system was used to analyze images. Repeat three times for each group.
2.7. NOS activity assay
NOS activity in the conditioned medium of cardiomyocytes was measured using the NOS Detection Kit according to the manufacturer’s instructions. The optical density values of the samples were measured at 530 nm with a spectrophotometer. The enzyme activity was expressed as units per mg of protein. Results of six independent experiments were used for statistical analysis.
2.8. Nitrite production assay
Levels of the NO derivative nitrite were determined in the conditioned medium of cardiomyocytes with the Griess reaction. A Nitrite Detection Kit was used according to the manufacturer’s instructions, and a standard curve using NaNO2 was generated for quantification. Briefly, 50 ml of medium or standard NaNO2 was mixed with 50 ml of Griess Reagent I and 50 ml of Griess Reagent II in a 96-well plate. After 15 min, optical density was read in a microplate reader (Tecan Austria Ges.m.b.H) at 540 nm. Results of six independent experiments were used for statistical analysis.
2.9. Statistical analysis
Results are expressed as mean ± SD. Statistical analyses were performed by one-way ANOVA or SNK-q test using SPSS statistical package (version17.0). The statistical significance was defined as P < 0.05.