Mice
Vhl +/mu mice(C57BL/6J background)were generated by CRISPR-Cas9-mediated gene editing. A gene-targeting construct containing the ATC(I) to TTC(F) missense mutation and neomycin-resistant gene flanked by loxP sites was electroporated into murine embryonic stem cells (ESCs). G418-resistant clones were identified by PCR and two positive clones were injected into blastocysts collected from C57BL/6J mice independently to achieve chimeras. The chimeras were subsequently crossed with EIIA-Cre transgenic female mice to remove the loxP-flanked neo-resistant gene (Neo). The resulting neo-deleted Vhl +/mu mice were genotyped by PCR with specific primers: Forward- TCTAGCCTTCTAACCCAGGTTGTCC, Reverse- GCCACAGCATCATTTTTACTTTCCA. All animals were maintained under a specific pathogen-free condition. All animal experiments were approved by the Ethics Committee of Peking University Health Science Center (LA2021487).
Cell lines
Human embryonic kidney (HEK) 293T (HEK-293T) cells, 786-O, human kidney-2 (HK-2) cells were from American Type Culture Collection (ATCC). HEK-293T cells were cultured in DMEM supplemented with 10% FBS plus 1% penicillin–streptomycin in a humidified atmosphere of 5% CO2. 786-O and HK-2 cells were cultured in RPMI-1640 supplemented with 10% FBS plus 1% penicillin–streptomycin in a humidified atmosphere of 5% CO2.
Constructs
All constructs used for this study were prepared by standard molecular biology techniques and coding sequences entirely verified. All truncations and mutants were constructed by standard molecular biology techniques and confirmed by sequencing.
Reagents
The reagents used in this study were as follow: Z-VAD-FMK, Erastin, RSL3, ferrostatin-1 (Fer-1), Deferoxamine (DFO), Vemurafenib, Selleck; H2O2, DMSO, Calcium Oxalate Monohydrate (COM), Sigma; Necrostatin-1 (Nec-1), abcam; Puromycin, ACROS; Cycloheximide (CHX), Biorbyt; MG132, Calbiochem; Recombinant human IFN-γ, Peprotech; Glyoxylic Acid (GA), TCI; Streptavidin magnetic beads, Beaverbio.
CaOx nephrocalcinosis mouse model
For induction of CaOx nephrocalcinosis, 6-8-week-old female Vhl +/mu and wild-type (WT) mice were received intraperitoneal injection with 45 mg/kg of glyoxylate (glyoxylic acid, GA) (TCI, G0366) every day for 7 days and body weights were recorded every day.
Histological and biochemical analyses
Mouse kidney tissues were fixed with formalin, embedded with paraffin and cut into 4 μm sections. For detection of kidney CaOx crystals, sections were stained using the von Kossa staining method (BestBio, BB-44711) following the manufacturer’s instructions. To assess kidney tissue damage, sections were stained with periodic acid-Schiff (PAS) (Beyotime, C0142S) following the manufacturer’s instructions. For haematoxylin-eosin (H&E) staining, sections were stained following a standard histopathological protocol. For detecting the expression of VHL, sections were transferred in antigen retrieval solution (Tris-EDTA, pH 6.0), after deparaffinization, blocking of endogenous peroxidase. Thereafter, sections were incubated overnight at 4°C with anti-VHL antibody (Abcam, ab77262) and then detected using the Envision Detection System (Gene Tech, GK600705) according to the manufacturer’s instructions. All images were acquired using an Olympus IX51 microscope.
The levels of serum creatinine (SCR), blood urea nitrogen (BUN), blood uric acid (UA) and blood lactate dehydrogenase (LDH) were detected using a Mindray BS-180 Chemistry Analyzer. The levels of malondialdehyde (MDA) was detected using Lipid Peroxidation MDA Assay Kit (Beyotime, S0131S), the levels of reduced glutathione (GSH) were detected using GSH assay kit (Nanjing Jiancheng, A006-2-1), the levels of tissue calcium were detected using Calcium Colorimetric Assay Kit (Elabscience, E-BC-K103-M) and the levels of tissue iron were detected using Iron Colorimetric Assay Kit (Elabscience, E-BC-K139-M) according to the manufacturer’s instructions.
Lentiviral packing and infection
To obtain VHL and BICD2 stably transfected cells, the sequences of VHL and BICD2 were cloned into pCDH-CMV-MCS-EF1-copGFP lentiviral vector respectively. HEK293T cells were transfected with psPAX2, pMD2.G and lentiviral constructs. Supernatants were collected at 48 hours post-transfection. After passing through 0.45-µm filters, viruses were used to infect target cells supplemented with 8 μg/ml polybrene. Subsequently, GFP+ cells were sorted by flow cytometry.
For knockdown HIF1A and BICD2 in 786-O cells, shRNAs targeting HIF1A (1#: CGGCGAAGTAAAGAATCTGAA; 2#: GTGATGAAAGAATTACCGAAT), BICD2 (1#: CCAGGTGTGACGAGTACATTA; 2#: GCCAACCTGAAGAGCAAGTAT) were cloned into pLKO.1 plasmid. 786-O cells were transfected with psPAX2, pMD2.G and lentiviral constructs. After viral infection, positive cells were selected by 2 μg/ml puromycin.
Quantitative real-time PCR
Total RNA was extracted with Trizol reagent (Invitrogen) and reverse transcribed into cDNA with GoScriptTM Reverse Transcription System (Promega) according to the manufacturer's protocol. qRT-PCR was performed using SYBR qPCR Master Mix (Vazyme) and ABI 7500 Detection System. All primers are listed in Table S1.
Co-immunoprecipitation and immunoblot analysis
Cells were transfected with appropriate plasmids and lysed by co-immunoprecipitation lysis buffer (10% glycerol, 0.5% NP-40, 150 mM NaCl, 0.1 mM EDTA) supplemented with protease inhibitor cocktail (Roche). Cell lysates were incubated with the S-protein Agarose beads (Millipore, 69704) or indicated primary antibody and protein A/G agarose beads (Santa Cruz Biotechnology, sc-2003). The immunocomplexes were then washed by PBSN (PBS containing 0.1% NP-40) three times and subjected to SDS-Page. For subcellular fractionation, nuclear and cytoplasmic extracts were isolated with a nuclear-cytoplasmic extraction kit (Applygen, P1200) following the manufacturer's protocol.
Antibodies used in this study were as follows: anti-VHL (Abcam, ab77262), anti- EPAS-1/HIF-2 alpha (Santa Cruz Biotechnology, sc-13596), anti-BICD2 (Abcam, ab237616), anti-GAPDH (TransGen Biotech, HC301-01), anti-β-Tubulin (ABclonal, AC021), anti-β-Actin (ABclonal, AC004), anti-HDAC1 (ABclonal, A19571), anti-FLAG (Sigma, F3165), anti-HA (Santa Cruz Biotechnology, sc-7392) and anti-GFP (MBL, 598).
Ubiquitination assay
HEK293T cells were transfected with appropriate plasmids. 24 hours later, cells were treated with 10 μM of the proteasome inhibitor MG132 (Calbiochem) for 10 hours. Cells were harvested and extracted in 100 µL of co-immunoprecipitation lysis buffer mentioned above supplemented with 1% SDS. Cell extracts were heat-denatured for 5 min at 100℃ and diluted with co-immunoprecipitation lysis buffer containing protease inhibitors (Roche) and 20 μM MG132 to an SDS concentration of ≤0.1%. Diluted cell lysates were sonicated and centrifuged to clarify, followed by immunoprecipitation as described above.
Protein half-life assay
For the half-life assay, HEK293T cells were transfected with appropriate plasmids. 24 hours later, cells were treated with the protein synthesis inhibitor cycloheximide (Biorbyt, 200μg/ml) with or without the proteasome inhibitor MG132 (Calbiochem) for the indicated durations before collection. Cells were harvested and lysed for immunoblot analysis.
TurboID-based proximity labeling technology
TurboID-based proximity labeling assay was performed as previously described (33). In brief, HEK293T cells were transfected with the VHL-TurboID or Mock-TurboID plasmid. After 24 hours, biotin was added at a final concentration of 500uM for 10 minutes. Cells were harvested and lysed with RIPA lysis buffer (50 mM Tris, 150 mM NaCl, 0.1% SDS, 0.5% sodium deoxycholate, 1% Triton X-100) with protease inhibitor cocktail (Roche) at 4°C for 30 minutes. The lysates were centrifuged to clarify and the supernatants were incubated with Streptavidin magnetic beads (Beaverbio, 22305-1) overnight at 4°C. Subsequently, the beads were washed twice with RIPA lysis buffer, once with 1M KCl, once with 0.1 M Na2CO3, once with 2 M urea in 10 mM Tris-HCl (pH 8.0), and twice with RIPA lysis buffer. Finally, biotinylated proteins were eluted by boiling the beads in 100 ul of elution buffer (55 mM pH 8.0 Tris-HCl, 0.1% SDS, 6.66 mM DTT, 0.66 mM biotin) for 10 minutes at 100°C. The eluted samples were subjected to NuPAGE 4–12% gel (Invitrogen) and sliver staining (Pierce, 24612). The excised gel segments were subjected to mass spectrum analysis.
Flag pull-down assay
FLAG pulldown assay was performed as previous study (34). Briefly, HEK293T cells were transfected with plasmid expressing mock or FLAG-tagged BICD2. 24 hours later, cells were harvested and lysed with co-immunoprecipitation lysis buffer at 4°C for 30 minutes. The lysates were centrifuged to clarify and the supernatants were enriched with anti-FLAG M2 beads (Sigma, F2426) at 4°C overnight. The binding components were eluted with 3×FLAG peptide (Sigma, F4799). The samples were subjected to NuPAGE 4–12% gel (Invitrogen) and sliver staining (Pierce, 24612). The excised gel segments were subjected to mass spectrum analysis.
Mass spectrum analysis
Mass spectrum analysis was performed as previously described (35). Briefly, after sliver staining of a gel, the gel was excised and subjected to in-gel trypsin digestion and dried. Peptides were dissolved in 10 μL 0.1% formic acid and auto-sampled directly onto a 100 μm × 10 cm fused silica emitter made in our laboratory packed with reversed-phase ReproSil-Pur C18-AQ resin (3 μm and 120 Å; Ammerbuch, Germany). Samples were then eluted for 50 min with linear gradients of 5–32% acetonitrile in 0.1% formic acid at a flow rate of 300 nl/min. Mass spectrometry data were acquired with an LTQ Orbitrap Elite mass spectrometer (Thermo Fisher Scientific) equipped with a nanoelectrospray ion source (Proxeon Biosystems). Fragmentation in the LTQ was performed by collision-induced dissociation (normalized collision energy, 35%; activation Q, 0.250; activation time, 10 ms) with a target value of 3,000 ions. The raw files were searched with the SEQUEST engine against a database from the UniProt protein sequence database.
Preparation of lymphocytes
To isolate lymphocytes infiltrating in the kidney, minced tissues were incubated with digestion solution containing 0.5 mg/ml collagenase D (Roche, 11088866001) and 25μg/ml DNase I (Sigma, DN25) at 37°C for 45 min with slow rotation. Then the tissues were grinded, and filtered through a 75 μm strainer. Mononuclear cells were isolated through 40/80% Percoll (GE Healthcare) by gradient centrifuging 800 × g for 20 min. Cells at the inter-layer were collected and counted for further operation.
Flow cytometry
To analyze cell surface maker expression, cells were incubated with specific antibodies for 30 min at room temperature. The flow cytometry analyzer (BD Biosciences) were used for acquiring the cells. The FACS data were analyzed with FlowJo v10 software.
Following antibodies were used: anti-CD4 (GK1.5, 100408, 1:250), anti-CD8a (53-6. 7, 100712, 1:250), anti-CD45 (30-F11, 03113, 1:250), Anti-CD3ε (145-2C11, 100326, 1:250), anti-CD11b (M1/70, 101206, 1:250), anti-F4/80 (BM8, 123116, 1:250), anti-Ly6G (1A8, 127654, 1:250), anti-Ly6C (HK1.4, 128008, 1:250) (all from Biolegend); anti-CD19(eBio1D3, 25-0193-82, 1:250), anti-NK1.1 (PK136, 11-5941-82, 1:250) (all from eBioscience).
LDH, ATP and CCK-8 assay
Relevant cells were seeded in 96-well plates and treated as indicated. LDH Cytotoxicity Assay Kit (Beyotime Biotech, C0017) was used to determine lactate dehydrogenase (LDH) release and cytotoxicity, ATP Assay Kit (Beyotime Biotech, S0026) was used to determine adenosine triphosphate (ATP) release and a Cell counting Kit-8 (CCK-8, Dojindo) assay was used to detect the cell viability. All assays were performed according to the manufacturer’s instructions.
Annexin V/7-AAD staining
Relevant cells were seeded in 6-well plates and treated as indicated. Annexin V/7-AAD staining was performed using Annexin V-PE/7-AAD Apoptosis Detection Kit (Vazyme, A213), following the manufacturer’s instructions.
Detection of ROS production
Reactive Oxygen Species Assay Kit (Beyotime Biotech, S0033) was used to detect generation of ROS in cultured cells. Briefly, cells were washed with PBS twice, followed by staining with 10μM DCFDA for 20 min at 37 °C. After washing with PBS, stained cells were subjected to flow cytometry analysis.
Quantification and statistical analysis
Prism GraphPad software v8.0.2 was used for statistical analysis. The statistical significance between different groups were calculated using a two-tailed Student’s t-test. P < 0.05 was considered significant. All experiments were independently replicated at least three times and similar results were generated.