2.1Clinical samples
50 pairs of gastric cancer tissues and corresponding adjacent tissues and 66 gastric cancer samples from patients who underwent surgery more than 5 years were obtained from the General Surgery Department of the Nanjing Drum Tower Hospital. The research protocol complies with the ethical guidelines of the 1975 Declaration of Helsinki. All experiments with human samples have been reviewed and approved by the Ethics Committee and Animal Welfare Committee of Nanjing Drum Tower Hospital. Obtain written informed content from each participant before learning.
2.2 Immunohistochemical (IHC) staining
The tissue is fixed in formalin and embedded in paraffin, and then cut into thin slices. The sections were deparaffinized with xylene and hydrated with ethanol, and then the antigen was recovered by pressure cooking. At room temperature, slice the section with TNC primary antibody (ab108930, Abcam, Cambridge, MA), MMP9 (Abcam, ab76003, 1:1000 dilution), MMP2 (Abcam, ab92536, 1:1000 dilution) and CD31 (ab134168, Abcam) Incubate for 60 minutes and then incubate with IgG H&L (HRP; 1:200 dilution, Abcam, Cambridge, UK). Then, the sections were stained with chromogen and counterstained with hematoxylin. The score is based on the intensity of staining (0 means no staining, 1 means weak staining, 2 means moderate staining, and 3 means strong staining). Calculate the product of the two levels as the final expression score.
2.3 Cell culture
Three human gastric cancer cell lines AGS, BGC-823 and Hs746T were purchased from the American Type Culture Collection (Manassas, Virginia, USA). The AGS, BGC-823 and Hs746T cells were supplemented with 10% fetal bovine serum (FBS; Gibco, Waltham, MA, USA) in RPMI 1640 medium (Gibco, Waltham, MA, USA) and 1% penicillin/streptomycin (Gibco, Waltham, Massachusetts, USA). Refresh the medium and pass the cells every three days.
2.4 siRNA transfection assay
According to the manufacturer's instructions, GC cells were transfected with siRNA (Guangzhou Ribobio Co., Ltd.) specifically targeting TNC using interferon reagent (Polyplus, New York, USA). Firstly, 5 pmol of siRNA was diluted in 200 µL of medium without serum, vortexed for 20 s, and centrifuged briefly. Then, 8 µL of interferin reagent was added, vortexed for 20 s, centrifuged briefly, and then incubated for 10 min at room temperature. During the incubation time, 2 ml of serum-containing medium was prepared. Finally, the transfection mix was added to the cells in serum-containing medium. The siRNA target sequence is TAACCATTTCCGACATTAA. The knockdown efficiency of TNC siRNA was checked by Western blot.
2.5 Lentiviral transduction
Control lentivirus vectors and lentiviral vector encoding a gene-specific shRNA against TNC's scrambled shRNA purchased from Shanghai Gene-Pharma Co., Ltd (Shanghai, China). The human GC cell line was transduced with lentiviral particles along with polybrene, and screened with puromycin (1 mg/mL) (Thermo Fisher Scientific, Waltham, Massachusetts, USA) for 2 weeks. Detection of knockdown efficiency by western blot.
2.6 Western blot analysis
The cell lysates were collected, and 30 mg protein of each sample was separated using 10% SDS-PAGE. The protein was then electrotransferred onto PVDF membrane (Millipore, Boston, Massachusetts, USA). The PVDF membrane was sealed in 10% skimmed milk. Then incubate the membrane with primary antibodies, including anti-TNC (Abcam, ab108930, 1:1000 dilution), anti-GAPDH (Abcam, ab181602, 1:10000 dilution), and anti-ERK (Abcam, ab184699, 1:1000 dilution) ), anti-p-ERK (Abcam, ab201015, 1:1000 dilution), anti-MMP9 (Abcam, ab76003, 1:1000 dilution), anti-MMP2 (Abcam, ab92536, 1:1000 dilution), anti-E-cadherin ( Abcam, ab1416, 1:1000 dilution), anti-N-cadherin (Abcam, ab18203, 1:1000 dilution), anti-vimentin (Abcam, ab92547, 1:1000 dilution), anti-snail (Abcam, ab216347, 1: 1000 dilution), anti-clumping (Abcam, ab27568, 1:1000 dilution) and anti-TWIST1 (Abcam, ab50887, 1:1000 dilution) overnight. Then the membrane and horseradish peroxidase-conjugated secondary antibody (Abacm AB6721, 1:10000 dilution) were incubated for 2 hours at room temperature. Chemiluminescence detection reagent (Millipore, Boston, MA, USA) was used to visualize protein bands.
2.7 Reverse transcription quantitative real-time polymerase chain reaction (RT-qPCR)
Total RNA was extracted from GC cells, and then reverse transcribed into cDNA using an RT-PCR kit (Vazyme, China). Gene-specific primers were designed using Primer Express version 2.0 software (Applied Biosystems Inc., Milan, Italy), and are listed in Table 1. RT-PCR analysis was performed using SYBR Green Premix Ex Taq. Human GAPDH was used as an internal reference gene. The relative mRNA expression was calculated according to the 2−ΔΔCt method.
Table 1
Primer used in quantitative real-time PCR assays.
Primer | Sequences (5’→ 3’) |
---|
GAPDH-F | GGAGTCCACTGGCGTCTTCA |
GAPDH-R | GTCATGAGTCCTTCCACGATACC |
TNC-F | TCCCAGTGTTCGGTGGATCT |
TNC-R | TTGATGCGATGTGTGAAGACA |
E-cadherin-F | CGAGAGCTACACGTTCACGG |
E-cadherin-R | GGGTGTCGAGGGAAAAATAGG |
N-cadherin-F | AGCCAACCTTAACTGAGGAGT |
N-cadherin-R | GGCAAGTTGATTGGAGGGATG |
Vimentin-F | GACGCCATCAACACCGAGTT |
Vimentin-R | CTTTGTCGTTGGTTAGCTGGT |
Slug-F | TGTGACAAGGAATATGTGAGCC |
Slug-R | TGAGCCCTCAGATTTGACCTG |
Snail-F | TCGGAAGCCTAACTACAGCGA |
Snail-R | AGATGAGCATTGGCAGCGAG |
Twist1-F | GTCCGCAGTCTTACGAGGAG |
Twist1-R | GCTTGAGGGTCTGAATCTTGCT |
MMP9-F | GGGACGCAGACATCGTCATC |
MMP9-R | TCGTCATCGTCGAAATGGGC |
MMP2-F | GATACCCCTTTGACGGTAAGGA |
MMP2-R | CCTTCTCCCAAGGTCCATAGC |
2.8 Bioinformatics analysis
We used the ACRG database to analyze the relationship between TNC expression and the prognosis of gastric cancer. The gene expression data was derived from The Cancer Genome Atlas (TCGA; https://portal.gdc.cancer.gov/projects/TCGA-LIHC) and analyzed using Gene Set Enrichment Analysis (GSEA).
2.9 Cell viability assays
The AGS, BGC-823 and Hs746T cell lines were seeded into 96-well microplates at a density of 5,000 cells per well. The cell proliferation was determined using the Cell Counting Kit 8 (CCK-8) assay (Dojindo, Kumamoto, Japan) according to the manufacturer's instructions. Briefly, add 10 µL of LCCK-8 working solution per 100 µL of medium to the microtiter plate and incubate the cells for 1.5 hours. The OD450 value was determined by using the MRX II microplate reader (Dynex, Chantilly, VA, USA).
2.10 EdU staining
The GC cells were incubated with 10 µM Edu (C0071L, Beyotime, Shanghai, P.R. China) for 2 hours, and fixed with 4% paraformaldehyde for 15 minutes at room temperature. Then, GC cells were washed with 3% BSA in PBS 3×5 minutes, and containing 0.3% Triton PBS X-100 penetration 10-15min. The cells were washed thoroughly with PBS containing 3% BSA, and then incubated with Click Additive Solution for 30 minutes in the dark. Next, the cells were washed with PBS containing 3% BSA for 3×5 minutes, and then incubated with Hoechst 33342 for 10 minutes in the dark. Finally, the cells were washed and observed under an Olympus microscope.
2.11 Cell cycle analysis
GC cells were treated with propidium iodide (PI; Dawen) and were analyzed by flow cytometry. Modfit Software (Verity Software House) was used for quantitative analysis of the cell cycle.
2.12 Cell apoptosis analysis
The death of apoptotic cells was detected by flow cytometry using Annexin V-FITC Apoptosis Detection Kit II (KeyGEN BioTECH, Nanjing, China). The cells were harvested and washed twice with PBS. Then, cells were resuspended with 5µLAnnexin V-FITC and 500µL1×5µLPI binding buffer, and incubated for 15 minutes in the dark at room temperature. Then, the percentage of apoptotic cells was analyzed by flow cytometry.
2.13 Wound healing assay
The cells were seeded in a 6-well plate at a density of 5×105/well and cultured to 90% confluence. Use a plastic spatula to make a wound track on each plate, and wash the plate with PBS to remove loose cell debris. After 48 hours of incubation, an Olympus microscope was used to measure the migration distance and calculate the migration rate. All experiments were repeated three times.
2.14 Cell migration assay
The Transwell chamber (Corning) is used to evaluate migration in Transwell analysis. The cells were seeded in the upper cavity at a density of 5×104/cavity, and RPMI-1640 containing 10% fetal calf serum was added as a chemotactic agent in the lower cavity. After 24 hours of incubation at 37°C, the cells in the upper chamber were removed with cotton swabs, and the cells in the lower chamber were fixed with formaldehyde for 30 minutes and stained with 0.1% crystal violet for 20 minutes. All experiments were repeated three times. Ten fields of view were randomly selected, and the positively stained cells were counted using an Olympus microscope.
2.15 Cell invasion assay
Precoat the Transwell chamber (6.5 mm, Costar, Corning, New York, USA) with Matrigel for 30 minutes. Then, 1×105 cells suspended in serum-free RPMI 1640 medium were inoculated into the upper chamber, and RPMI 1640 medium containing 10% fetal bovine serum was added to the lower chamber. After incubating for 24 hours at 37°C, the cells in the upper chamber were removed with a cotton swab, the cells in the lower chamber were fixed with formaldehyde for 30 minutes, and stained with 0.1% crystal violet for 20 minutes. All experiments were repeated three times. Ten fields of view were randomly selected, and the positively stained cells were counted using an Olympus microscope.
2.16 Three-dimensional culturing
Three-dimensional culture is used to evaluate the formation of VM. Add 50µl of Matrigel (BD Biosciences, Sparks, MD) to a 96-well plate and incubate at 37°C for 30 minutes. Then, the cell suspension was coated on Matrigel and incubated at 37°C for 8 hours. A brightfield microscope was used to image five random fields of view of each well.
2.17 Pseudopodia Formation Detection
The GC cells were seeded on glass slides for 24 hours and cultured. The cells were then fixed with 4% paraformaldehyde and infiltrated with 0.3% Triton X-100. F-actin is an important pseudopodia component and is labeled with phalloidin labeled with Alexa Fluor 555 (A34055, Invitrogen, USA). Then follow the instructions for Cortactin and DAPI (4',6-dimidyl-2-phenylindole) labeling. The slides were fixed with ProLongTM Gold Antifade Mountant (P36930 from Life Technologies, USA). Use FV3000 confocal laser scanning microscope (Olympus Japan) to obtain confocal micrographs under the control of supporting software.
2.18 Xenograft and Peritoneal Dissemination Model
Four-week-old female BALB/c nude mice were purchased from the Model Animal Research Center of Nanjing University and placed in a pathogen-free environment in the animal laboratory of Nanjing University. For the xenograft model, resuspend TNC knockdown and control GC cells (2×106) in 200 µL PBS. Then inject into the ventral side of nude mice (5 mice/group). 21 days after tumor cell implantation, mice were sacrificed. The tumor was removed and weighed at autopsy. For the peritoneal diffusion model, 400µL of TNC knockdown and control GC cells (3×106) in PBS were injected into the peritoneal cavity. The peritoneal metastasis was checked and recorded when the mice were sacrificed on the 14th day after injection.
2.19 Statistical analysis
We used SPSS 22.0 (IBM) to statistically analyze the data. Three or more independent experiments are expressed as mean ± standard deviation. The comparison between the two groups was performed using the student t test. One-way analysis of variance was used to compare the three groups. Counting data were compared by chi-square test. Linear regression was used to analyze the correlation between the two variables. The difference was considered statistically significant at at a P-value of P < 0.05