Molecular characterization of Listeria monocytogenes strains isolated from clinical samples in Urmia patients

doi:10.21203/rs.3.rs-2063158/v1

Background

The foodborne bacterium Listeria monocytogenes is common in many settings, especially hospitals. The bacterium poses a significant threat to the healthcare system. Thus, work has been conducted to learn more about their serovars, pathogenicity, and antibiotic resistance patterns.

Methods

A total of 221 clinical samples were collected. All specimens were analyzed using the standard double enrichment procedure defined in ISO 11290:1. Gram staining and biochemical features were employed to identify L. monocytogenes. The disc diffusion assay was used to test the sensitivity of all L. monocytogenes strains to 13 antibiotics. Multiplex PCR was used to identify the presence of virulence genes and serogroups (1/2a, 1/2b, 1/2c, and 4b). ERIC-, REP-, and RAPD-PCR were used to perform genomic fingerprinting.

Results

22 out of 221 samples contained L. monocytogenes on average (9.95%). 11 (12.79%) of the 86 stool samples tested positive for L. monocytogenes, with serotypes 1/2a, 1/2b, and 4b showing frequencies of 18.18%, 27.27%, and 654.55% respectively. Among these serotypes, 4b showed the highest distribution (57.14%). Trimethoprim/sulfamethoxazole (100%), and Tetracycline (90.91%), were the two antibiotics to which L. monocytogenes showed the highest levels of resistance, respectively. All 22 (100%) isolates were positive for the genes mpl, inlB, plcB, and prfA. The hlyA, actA, and iap genes were found in 95.45% of the isolates. The distribution of virulence genes llsX, ptsA, inlA was 8 (36.36%), 12 (54.55%) and 16 (72.43%), respectively. The genomic DNA from L. monocytogenes isolates in the samples was used in the ERIC-PCR to generate four fingerprint profiles. These profiles have a base range of 240 to 1500 and 6 to 14 bands overall. The REP- and RAPD-PCR of genomic DNA from L. monocytogenes from samples revealed amplification of numerous DNA fragments 100 to 3000 base (REP-PCR), 280 to 3000 base (RAPD-PCR) and were made up of 6 to 12 bands (REP-PCR) and 3 to 4 bands (RAPD-PCR). in Comparing the data from the dendrograms that were examined, which employed the Rep-type, RAPD-type, and ERIC-type techniques to count the bands, it was 12 − 6, 3–4, and 14 − 6, respectively, while the similarity for Rep-Type, RAPD-Type, and ERIC-Type was 100 − 53.80%, 96-54.30%, and 100 − 52.50%, respectively.

Conclusions

The findings, which strongly suggest that MDR L. monocytogenes 1/2a and 4b may be present among Iranian patients, should be viewed as having important public health ramifications.

L. monocytogenes

ERIC-

REP-

and RAPD-PCR

Serotype identification

Virulence genes.

The foodborne Listeria monocytogenes cause opportunistic infections, which have a high fatality rate (30%) and are currently regarded as a severe public health issue (1). The bacterium can withstand a variety of environments, including low temperature, low pH, and high salt concentrations, and it can cause bacteremia, pneumonia, and meningoencephalitis in older adults, newborns, pregnant women, and those with impaired immune systems (2, 3).

L. monocytogenes are typically susceptible to a variety of medicines, although it has also been shown to develop resistance to some of them (4). The infectivity of L. monocytogenes is dramatically regulated by the existence of several virulence genes, including internalizing (encoded by inlA, and inlB), prfA-regulated virulence gene cluster (prfA), Thrombopoietin Receptor (mpl), putative PTS multi-phosphoryl transfer protein (ptsA), Listerio-lysin S-X (llsX), actin (actA), phosphatidylinositol-phospholipase (plcA, plcB), invasion associated protein encoded (iap), α-hemolysin (HlyA) and virulence regulator (5, 6).

There are at least 12 different serovars of Listeria monocytogenes, including serovars 1/2a, 1/2b, 1/2c, 3a, 3b, 3c, 4a, 4b, 4c, 4d, 4e, and 7. Serotypes 1/2a, 1/2c, 1/2b, and 4b were shown to be responsible for 98 percent of cases of human listeriosis, suggesting that Listeria monocytogenes' pathogenicity is serotype dependent (7, 8). Despite regular detection from a range of dietary and ecological specimens, the 4a and 4c serovars of lineage are infrequently linked to disease outbreaks. Therefore, serotyping can offer helpful information on the possible dangers presented by Listeria monocytogenes isolates from diverse sources. Various L. monocytogenes serotypes from distinct sources had specific virulence characteristics. Small numbers of serovars 1/2a, 1/2b, and 4b comprised the strains from dietary and ecological specimens (9, 10).

The standard serotyping slide agglutination approach has been applied in clinical and epidemiological research with excellent effectiveness, but it is not frequently utilized since it is expensive to buy all the different types of specialized antisera (11, 12). The reliability of the approach is known to be hampered by a lack of reagent uniformity. The potential for quick serotyping of L. monocytogenes has led to the development of an enzyme-linked immunosorbent assay (ELISA), although there has been documented lack of agreement between the ELISA and hemolysis findings (13). This limitation has prompted researchers to look for alternative-based typing systems that work on all platforms. Consequently, PCR-based serotyping methods for L. monocytogenes have been disclosed, and they demonstrate how a simple DNA-based serotyping system may be created (14). At this time, L. monocytogenes may be classified into three evolutionary lineages. The lineage I subgroup includes serotypes 1/2b, 3b, 4b, 4d, and 4. Lineage II includes all serotypes except 1/2a, 1/2c, 3a, and 3c. Lineage III has all three serotypes, 4a, 4c, and 4b. Although PCR-based serotyping approaches are crucial for identifying subgroups of epidemiological significance, they must be used in concert with subtyping techniques that have stronger discriminating power to accurately monitor epidemic strains (13, 14). Listeria monocytogenes computerized ribotyping has been utilized successfully in several studies as an alternate DNA-based typing method. Because specialized equipment has to be obtained in order to examine the findings, this approach is, however, prohibitively expensive (15).

In terms of sub-typing bacterial isolates, PCR-based typing technologies continue to be a popular and economical choice. PCR-based typing technologies also have the added benefit of being quick. The "gold standard" among the several methods for molecularly identifying L. monocytogenes has been RAPD-PCR because of its great repeatability and discriminating power (16). However, Enterobacterial Repetitive Intergenic Consensus (ERIC)-PCR and Repetitive Element Sequence (REP) are somewhat easy, inexpensive, and discriminating to the type genera Listeria that yield DNA fingerprint similar to RAPD-PCR that enables differentiation within a specific species of bacteria. REP-typing is a highly selective classifying method that has been successfully employed in demographic monitoring of important bacterial infections, such as Listeria (16–18). On the presence of this infection in Iranian patients, there is minimal information. This investigation offered the chance to evaluate the durability and suitability of the biological markers supporting these DNA-based characterization approaches in defining isolates from a geographically unique location. These approaches have mostly been applied in isolates from Europe and North America. In the current investigation, we assessed the virulence genes, serovar, and antibiotic resistance patterns of L. monocytogenes obtained from Iranian patients. ERIC-, REP-, and RAPD-PCR techniques were utilized to determine the clonal connections among the strains.

Sample collection

A total of 221 samples, including 86 each from stool, 12 each from blood, 35 samples from urine, 35 samples from vaginal fluid, and 53 samples from placental pieces, were obtained from the Urmia hospitals in Iran between February 2021 and May 2021. Each sample was collected at aseptic conditions, transferred to the lab cooled, and analyzed within 24 hours of collection.

Isolation and characterization of L. monocytogenes

The common double enriching technique outlined in ISO 11290:1 was used to analyze all specimens, with a few minor adjustments (19). 10 ml of half-Fraser broth (DifcoUSA) was mixed with 2 ml of each specimen in a separate addition (60 s). At 30°C for 24 hours, the cultures were analyzed. 0.1 ml of the 24 hrs culture was added to 10 ml of the selective agents' full strength (Fraser broth, Difco, USA) and incubated for 48 hours at 37°C before being spread out onto PALCAM agar (Difco) and re-incubated for 48 hours at the same temperature. This second enrichment was carried out (48 h, 37°C). Gram staining, biochemical characteristics like catalase, the methyl red-Voges-Proskauer (MR-VP) reaction, nitrate reduction, motility (20–25°C), acid generation from rhamnose, xylose, mannitol, and -methyl-D-mannopyranoside, and the CAMP assess with Staphylococcus aureus and Rhodococcus equi were used to identify grey-greenish colonies. As a control, L. monocytogenes MTCC1143, S. aureus MTCC1144, and R. equi MTCC1135 were used. For use in the ensuing study, tryptic soy agar slants were used to maintain all of the L. monocytogenes strains and control organisms at room temperature. These protocols were following SOP ISO17025 of AmitisGen Company (Tehran, Iran).

Sensitivity Screening For Antibiotics

Using the disc diffusion assay developed by Kirby-Bauer, all L. monocytogenes strains were evaluated for their sensitivity to 13 antibiotics often prescribed to humans. The appropriate antibiotic disc dosages (Oxoid, UK) were used: Penicillin G (10µg), Amoxicillin (30µg), Gentamicin (10µg), Streptomycin (10µg), Ciprofloxacin (5µg), Levofloxacin (5µg), Erythromycin (15µg), Vancomycin (30µg), Tetracycline (30µg), Doxycycline (30µg), Chloramphenicol (30µg), Rifampin (5µg), Trimethoprim/sulfamethoxazole (1.25/23.75µg). According to the Clinical and Laboratory Standards Institute's (CLSI) recommendations for Gram + ve bacteria, the width of the clearing zone was measured and evaluated (20).

Dna Extraction

Following the instructions of the Cinnaclone DNA extraction kit, genomic DNA was extracted from L. monocytogenes strains cultured overnight (37°C) in brain heart infusion broth (Ibresco, Iran). The collected biomass was centrifuged (7500 rpm, 10 min), re-suspended in 180 µl of lysis buffer, and then incubated for 30 min at 37°C. 25 µl of Proteinase K and 200µl of Buffer AL (without ethanol) were added, vortexed, and the solution was again incubated at 56°C (30 min). Then, 4 µl of RNaseA (100 mg/ml) was introduced, and the mixture was let sit for 2 minutes at room temperature.

Identification Of Serogroups And Genes Unique To Species And Pathogenicity

Through the use of multiplex PCR, the presence of internalin genes (inlA and inlB), virulence-associated genes (mpl, llsX, ptsA, plcA, plcB, actA, hlyA, iap, and prfA), and serogroups (1/2a, 1/2b, 1/2c, and 4b) were identified. Each reaction mixture had an overall volume of 25µL, including 2.5µL 10X Buffer (Mg2 + free), 4µL (25mM) Mgcl2, 0.75µL dNTP (10mM each), 0.25L (5 U/µL Taq DNA Polymerase Vazyme, China), 1µL forward primer, 1µL reverse primer, 2µL DNA, and 13.5µL ddH2O. The PCR procedure was performed as follows: Pre-denaturation at 95°C for 5 minutes, followed by denatured proteins at 95°C for 60 seconds, annealing at 55°C for 40 seconds, elongation at 72°C for 45 seconds, 35 cycles, and a final extension at 72°C for 10 minutes. The PCR results were examined using agarose (1.0% gel electrophoresis), stained with DNA Safe Stain (CinnaGen, Iran), and seen using a UV transilluminator (UVtech, UK). Table 1 lists the specific oligonucleotide sequences (CinnaGen, Iran) and PCR cycling parameters employed in this work.

Table 1

Sequence of primers used to study of *L. monocytogenes*
Primer name	Primer sequence (5’-3’)	Target gene	Product size (bp)	Reference
plc A-F plc A-R	CTGCTTGAGCGTTCATGTCTCCATCCCCC CATGGGTTTCACTCTCCTTCTAC	plcA gene	1484	21
prf A-F prf A-R	CTGTTGGAGCTCTTCTTGGTGAAGCAATCG AGCAACCTCGGTACCATATACTAACTC	prfA gene	1060	21
act A-F act A-R	CGCCGCGGAAATTAAAAAAAGA ACGAAGGAACCGGGCTGCTAG	actA gene	839	21
hly A-F hly A-R	CTTGCAACTGCTCTTTAGTAACAGC ACAAGCTGCACCTGTTGCAG	hlyA gene	706	21
iap-F iap-R	ACAAGCTGCACCTGTTGCAG TGACAGCGTGTGTAGTAGCA	iap gene	131	21
plcB F plcB R	CTGCTTGAGCGTTCATGTCTCATCCCCC CATGGGTTTCACTCTCCTTCTAC	plcB gene	436	21
inlB-F inlB-R	GATATTGTGCCACTTTCAGGT CCTCTTTCAGTGGTTGGGT	inl B gene	367	21
inlA F inlA R	CTTACCTAGTTATACAAA TTCATTGTACTTGTTGTG	inl A gene	880	22
mpl F mpl R	ATAGCTTTTCAGGCTCATTTCA ATAGCTTTTCAGGCTCATTTCA	mpl gene	1184	21
llxS-F llxS-R	TTATTGCATCAATTGTTCTAGGG CCCCTATAAACATCATGCTAGTG	llxS gene	200	21
ptsA-F ptsA-R	CCTTTTTCTTTGTTGCGGA TCTGAAGCTGTACGAAGACA	ptsA gene	450	21
lmo0737F mo0737R	AGGGCTTCAAGGACTTACCC ACGATTTCTGCTTGCCATTC	L. monocytogenes serovar1/2a	691	6
ORF2819F ORF2819R	AGCAAAATGCCAAAACTCGT CATCACTAAAGCCTCCCATTG	L. monocytogenes serovar1/2b	471	6
ORF2110F ORF2110R	AGTGGACAATTGATTGGTGAA CATCCATCCCTTACTTTGGAC	L. monocytogenes serovar 4b	597	6
Imo1118F Imo1118R	AGGGGTCTTAAATCCTGGAA CGGCTTGTTCGGCATACTTA	L. monocytogenes serovar 1/2c	906	23
16srRNA F 16srRNA R	GCTAATACCGAATGATAAGA GGCTAATACCGAATGATGAA	16srRNA	287	24
Prs 01 Prs 02	GCTGAAGAGATTGCGAAAGAAG CAAAGAAACCTTGGATTTGCGG	phosphoribosyl pyrophosphate synthetase (prs)	370	6
ERIC 1R ERIC 2	ATGTAAGCTCCTGGGGATTCAC AAGTAAGTGACTGGGGTGAGCG	Repetitive elements	-	25
RAPD (OPA15)	TTC CGA ACC C	Repetitive elements	-	26
REP 1R-I REP 2-I	IIIICGICGICATCIGGC ICGICTTATCIGGCCTAC	Repetitive elements	-	25

Eric- Rep- And Rapd-pcr-based Genomic Fingerprinting

According to the instructions provided by Jersek et al. (25) and Lee et al. (26), respectively, ERIC-, REP- and RAPD- PCR were carried out. The PCR reactions were verified by resolving them in 3% agarose gel in a 5x TBE buffer, stained with DNA Safe Stain at 90 volts for 240 min and viewed. DNA fingerprints were analyzed with computer-assisted pattern analysis using the GelJ v.2.0. software (27). The relatedness of the isolates was compared and dendrograms were constructed by UPGMA and cluster analysis was used to determine the relationships between each isolate. The value of discriminatory power (D) was determined using an online calculator for discriminatory power as reported.

Statistical analysis

Position bias in gels, band designation, and varied Bio- Numerics program options can all have an impact on the clustering analysis of the ERIC-, REP-, and RAPD-PCR profiles. As a result, the mean simple-match similarity array and the standard cluster parameters of 0% efficiency and 1% band position sensitivity were used to determine how comparable the ERIC- and REP-PCR fingerprint patterns were. GelJ software was used to examine the data and perform statistical tests. A one-way analysis of variance (ANOVA) was used to compare means, followed by a Tukey– Kramer post hoc test with a 95 percent confidence interval. Differences were considered significant at p < 0.05.

Prevalence of L. monocytogenes

The overall prevalence of L. monocytogenes in 221 samples was 22 (9.95%). Of the 86 stool samples, 11 (12.79%) of these were positive for L. monocytogenes which serotypes 1/2a, 1/2b and 4b showed the frequency of 2 (18.18%), 3 (27.27%), and 6 (54.55%), respectively. After stool samples, the highest frequency of listeria was related to placental bits with the number of 7 (3.17%). Out of 53 samples of placental bits, 7 samples were infected, which showed a distribution of 13.21%. Among these serotypes, 4b with the number of 4 samples (57.14%) had the highest distribution, followed by 1/2c, 1/2b, and 1/2a serotypes had a dispersion of 1 (14.29%), 1 (14.29%) and 1 (14.29%), respectively. after stool and placental bits, Vaginal samples, blood, and urine with 0.90%, 0.45%, and 0.45% had the highest density, and 100% of the contamination in blood and urine samples was related to serotype 4b, while in vaginal samples, 50% was related to serotype 4b and 50% of the contamination was due to serotype 1/2a (Table 2).

Table 2

Collected samples and frequency of *L. monocytogenes* contamination
Clinical specimens		Frequency			Serovar
specimens	NO.	NO. Positive	% (in the sample)	% (in the Total)	1/2a (%)	1/2b (%)	1/2c (%)	4b (%)
Stool	86	11	12.79	4.98	2 (18.18)	3 (27.27)	-	6 (54.55)
Blood	12	1	8.33	0.45	-	-	-	1 (100)
Urine	35	1	2.86	0.45	-	-	-	1 (100)
Vaginal	35	2	5.71	0.90	1 (50)	-	-	1 (50)
Placental bits	53	7	13.21	3.17	1 (14.29)	1 (14.29)	1 (14.29)	4 (57.14)
Total	221	22	-	9.95	4 (18.18)	4 (18.18)	1 (4.55)	13 (59.09)

Sensitivity To Antibiotics

L. monocytogenes isolates from samples were tested for their antibiotic susceptibility. All 22 bacterial strains isolated from different samples showed 100% resistance to the Folate pathway inhibitor (Trimethoprim/sulfamethoxazole). Following the Folate pathway inhibitor, the highest resistance was observed among the isolated strains against Tetracycline, 20 out of 22 (90.91%) strains were resistant to Tetracycline (Table 3). Of these, 10/22 strains (90.91%) were isolated from stool samples, followed by placental bits, vaginal, urine, and blood samples with values of 6 (85.71%), 2 (100%), and 1 (100%) respectively. Out of 22 isolates from samples, 15 (68.18%) were resistant to Aminoglycosides (Gentamicin and Streptomycin), while 3 (13.64%) only were resistant to Macrolides (Erythromycin) and phenicols (Chloramphenicol).

Table 3

Frequency results of antibiotic resistance in *L. monocytogenes* isolates
Antibiotics group	Disc Antibiotic (µg)	Stool 11	Blood 1	Urine 1	Vaginal 2	Placental bits 7	Total 22
β - Lactam	Penicillin G (10)	-	-	-	-	-	-
β - Lactam	Amoxicillin (30)	-	-	-	-	-	-
Aminoglycosides	Gentamicin (10)	9 (81.82)	-	-	2 (100)	4 (57.14)	15 (68.18)
Aminoglycosides	Streptomycin (10)	8 (72.73)	-	1 (100)	2 (100)	4 (57.14)	15 (68.18)
Fluroquinolons	Ciprofloxacin (5)	-	-	-	-	-	-
Fluroquinolons	Levofloxacin (5)	-	-	-	-	-	-
Macrolides	Erythromycin (15)	2 (18.18)	-	-	1 (50)	-	3 (13.64)
Glycopeptides	Vancomycin (30)	-	-	-	-	-	-
Tetracycline’s	Tetracycline (30)	10 (90.91)	1 (100)	1 (100)	2 (100)	6 (85.71)	20 (90.91)
Tetracycline’s	Doxycycline (30)	-	-	-	-	-	-
phenicols	Chloramphenicol (30)	2 (18.18)	-	-	1 (50)	-	3 (13.64)
Ansamycins	Rifampin (5)	4 (36.36)	-	1 (100)	-	-	5 (33.33)
Folate pathway inhibitor	Trimethoprim/sulfamethoxazole (1.25/23.75)	11 (100)	1 (100)	1 (100)	2 (100)	7 (100)	22 (100)

Also, 5 strains (33.33%) showed resistance to Ansamycins (Rifampin), 4 strains (36.36%) were isolated from stool samples and only 1 strain was isolated from vaginal samples (Fig. 1A). Among the samples resistant to Aminoglycosides, the strains isolated from stool had the highest distribution of resistance, so 81.82% resistance distribution was to Gentamicin and 72.73% to Streptomycin. The results showed that the strains isolated from stool had more resistance to antibiotics than other strains. Additionally, the L. monocytogenes strains that were isolated from the different samples were completely susceptible (100%) to β-Lactams (Penicillin-G and Amoxicillin), and Fluoroquinolones (Ciprofloxacin and Levofloxacin), Glycopeptides (Vancomycin), and Doxycycline (Fig. 1B). Virulence-associated genes and serovar identification

All 22 isolates from strains analyzed positive for the internalin A (inlA) gene, suggesting that they were all L. monocytogenes. In serotype-specific multiplex PCR, 13 (59.09 percent) isolates tested positive for the ORF2110 and ORF2819 genomes, revealing that they were all 4b serogroup (Table 2). 22 isolates of L. monocytogenes from samples were screened for the presence of virulence genes. All the 22 (100%) isolates from samples were positive for inlB, plcB, plcA, mpl and prfA genes. Similarly, 21 (95.45%) isolates were for hlyA, actA and iap gene (Table 4).

Table 4

Distribution of virulence genes in isolates of *L. monocytogenes*
Sample	LM strain	prfA	mpl	plcA	plcB	inlB	inlA	ptsA	llsX	iap	actA	hlyA
Stool	11	11	11	11	11	11	9 (81.81)	7 (36.64)	6 (54.55)	11	11	11
Blood	1	1	1	1	1	1	1	-	-	1	1	1
Urine	1	1	1	1	1	1	-	-	-	1	1	1
Vaginal	2	2	2	2	2	2	1 (50)	1 (50)	-	1	1	1
Placental bits	7	7	7	7	7	7	5 (71.43)	4 (57.14)	2 (28.57)	7	7	7
Total	22	22 (100)	22	22	22	22	16 (72.43)	12 (54.55)	8 (36.36)	21 (95.45)	21 (95.45)	21 (95.45)

The distribution of virulence genes llsX, ptsA, inlA was 8 (36.36%), 12 (54.55%) and 16 (72.43%), respectively. 100% of isolated bacteria have inlB, plcB, plcA, mpl, hlyA, actA, iap, prfA genes While only bacteria isolated from stool and placental bits had llsX, ptsA and inlA genes. The distribution of llsX, ptsA, and inlA genes in stool were 6 (%54.55), 7 (%36.64), and 9 (%81.81) respectively, while the distribution of llsX, ptsA, and inlA genes in placental bits was 2 (%28.57), 4 (%57.14), and 5 (%71.43) respectively (Fig. 2).

Multi-antibiotic-resistance and phenotypic antibiotic resistance profiles in L. monocytogenes

The resistance of different strains to different antibiotics was evaluated. According to the definition, bacterial strains that are resistant to at least 4 or more antibiotics are identified as MDR. In this study, LM1, LM2, and LM18 strains were resistant to more than 6 antibiotics, which indicates that these strains are MDR. In addition, the strains LM5, LM7, LM8, LM9, LM10, LM11, LM13, LM20, and LM22 were also resistant to at least 4 antibiotics. More than 50% of these resistant strains were isolated from stool samples (Table 5).

Table 5. Frequency results of multi-antibiotic-resistance in L. monocytogenes isolates

Table 6 displays a histogram of the phenotypic profile of antimicrobial sensitivity, the presence of virulence genes, and the differences between each strain tested in the study. This tendency could be a reflection of the biological profile of the strains and demonstrate the efficacy of each drug against the specific strain. The number of L. monocytogenes strains that displayed morphological resistance to the different antibiotics examined varied from 1 to 22. In LM1, notably in strains isolated from Stool, high rates of antibiotic-resistant L. monocytogenes were detected. Additionally, the hlyA, actA, iap, llsX, ptsA, inlA, inlB, plcB, plcA, mpl, and prfA genes were fully (100%) expressed in the organisms with strong antibiotic resistance. The virulence genes llsX, ptsA, and inlA were not found in the bacteria with low resistance. These findings demonstrate a direct correlation between the rise in antibiotic resistance and the existence of the virulence genes llsX, ptsA, and inlA. The prevalence of virulence genes and strains of L. monocytogenes that exhibit phenotypical antibiotic resistance was shown to be correlated, according to the findings, statistically significantly (p < 0.01).

Table 6. Characteristics of each isolate of L. monocytogenes studied

Eric-, Rep- And Rapd-pcr Fingerprint Analysis

Four fingerprint profiles were produced by the ERIC-PCR of the genomic DNA from L. monocytogenes isolates in the samples. These profiles were made up of 6 to 14 bands with a base range of 240 to 1500. (Fig. 3A). While two of the stool isolates had the same fingerprint pattern, other isolates had ones that were quite close. Similar to this, all of the isolates had identical profiles, and one of them had one that was quite similar. Isolates from stool yielded 4 distinct fingerprint clusters in 80% which Main clusters were clusters A and B.

The REP-PCR of genomic DNA from L. monocytogenes from samples showed amplification ofmultiple DNA fragments (100 to 3000 base) and were made up of 6 to 12 bands (Fig. 3B). Likewise, the ERIC-profile of isolates from stool revealed identical to closely related fingerprints and while the remaining isolates had related to distinct fingerprints. Whereas isolates from Placental bits, Urine, and blood samples had similar to identical fingerprints, isolates from vaginal samples had identical but different fingerprints. No correlation in fingerprint profile between the isolates was observed.

The genomic DNA from L. monocytogenes samples amplified numerous DNA fragments (280 to 3000 base) in 3 to 4 bands using RAPD-PCR (Fig. 3C). Similar results were obtained for the ERIC- and REP-profiles of stool strains, whereas the other serotypes showed similar but unique fingerprints. While the fingerprints of the strains from placental parts, urine, and blood samples were almost the same, the fingerprints of the isolates from vaginal samples were the same yet different. There was no discernible link between the isolates' fingerprint profiles.

Comparing the information from the dendrograms that were investigated, which used the Rep-type, RAPD-type, and ERIC-type methodologies to count the bands, It was 12 − 6, 3–4, and 14 − 6, respectively, while the similarity for Rep-Type, RAPD-Type, and ERIC-Type was 100 − 53.80%, 96-54.30%, and 100 − 52.50%, respectively. Additionally, clusters A and B served as the main clusters for ERIC-Type, whereas clusters B and C served as the main cluster for RAPD-Type, and Rep-Type, respectively (Table 7).

Table 7

Comparison of the data of the studied dendrograms
	ERIC-Type	RAPD-Type	Rep-Type
N.O. band	6–14	3–4	6–12
Size of band	240-1500bp	280-3000bp	100-3000bp
Similarity	52.50–100%	54.30–96%	53.80–100%
N.O. clusters in 80%	4	5	5
N.O. separate files	12	5	6
Total profile in 80%	16	10	11
Main cluster	A&B	B	C

L. monocytogenes is a pathogen with serious medical significance that occasionally causes nutrition outbreaks (28). L. monocytogenes is without a doubt one of the most dangerous foodborne pathogens in the world (28, 29). There is currently a dearth of information regarding the detection of L. monocytogenes contamination in Iranian patients. In this investigation, 221 commercially available patient samples in Iran were studied, of which 22 (9.95 percent) were positive for L. monocytogenes (Table 2). The highest contamination rate (4.98 percent) was found in a Stool sample. We found a wide spread of L. monocytogenes in Iranian patients in this study, highlighting the significant health risk. However, there is presently no accepted recommendation for the threshold for L. monocytogenes counts in patients from Iran. This led to the adoption of the predicted infectious agent of 102–1010 CFUs of oral doses from a dosimetric analysis that used rhesus monkeys as a surrogate since susceptibility and the pathogenesis of listeriosis disease should be the same in people and primates (29).

9.95% of the samples were positive for L. monocytogenes, which indicates that the pathogen is rather common. The frequency of L. monocytogenes found in our study is lower than the 59.4% frequency in specimens published by Mpondo et al. (30) in a prior South African investigation. A greater incidence of 84 percent free-living and 59–75 percent planktonic L. monocytogenes obtained from the specimens in South Africa was also reported earlier by Odjadjare et al (31). It varies how often L. monocytogenes are present in samples taken from other areas. A previous study by Lyautey et al. (32) revealed a lower proportion of L. monocytogenes retrieved from specimens in Ontario, Canada—10% and that in New York at 13% (33).

In the current investigation, the frequency of L. monocytogenes in Iranian specimens was the lowest recorded (9.95%), whereas the greatest contaminated specimens were stool (12.79%) and placental pieces (13.21%). Additionally, compared to the Vaginal (5.71 percent) and Blood samples (8.33 percent), the prevalence of confirmed L. monocytogenes strains was larger in the stool (12.79%). Similar findings were made by Dijkstra (34), who noted a greater prevalence of L. monocytogenes in the stool and placental pieces compared to the Netherlands' stool specimen L. monocytogenes frequency of 21%. A prior study also showed that L. monocytogenes was prevalent in feces (18.5%), placental pieces (83%), and vaginal tissues (50%) in Iran (35). The high incidence of L. monocytogenes found in stool samples in our investigation may reflect the contamination.

Investigations were conducted into the serotypes and virulence factors of L. monocytogenes strains. In comparison to serotypes 1/2a (18.18%), 1/2b (18.18%), and 1/2c (4.55%), serotype 4b (59.09%) was more common. Our results supported a previous report of L. monocytogenes isolates found in specimens from Canada and Switzerland, where the pathogens were either serotype 1/2a or 4b (32, 36). In addition, another investigation on a specimen from Nova Scotia, Canada, discovered that serotypes 4b/4d/4e were the most typical isolates observed in specimens (37). Our research backs up earlier reports that patients' samples included L. monocytogenes serotypes that are typically detected in different cases of human listeriosis (36). Notably, 90% of L. monocytogenes found in clinical specimens is of serovars 1/2a, 1/2b, 1/2c, and 4b (38, 39). This suggests that clinical specimens in hospitals may pose harm to people's health.

Various virulence factors boost L. monocytogene's cellular invasion and survivability because it can survive in the digestive system (36, 39). All (100%) of the isolates had the virulence factors inlB, plcB, plcA, mpl, and prfA, whereas (95.45%) of the strains had the virulence factors hlyA, actA, and iap. There were differences in the distribution of llsX (36.36%), ptsA (54.55%), and inlA (72.43%) among the strains. Likewise, it was observed that all L. monocytogenes strains in Switzerland included inlA and B (36). There was a greater frequency (100%) of the internalin C and J genes reported (40). The prfA gene was also found in all L. monocytogenes strains from different resources, according to a prior investigation (36). As a contrast to our research, Olaniran et al. (41) findings on the frequency of actA and plcA were significantly lower. The plcB and hly genotypes were shown to be more prevalent, though, in prior research (40). It is established that the expression of these genetic variants in L. monocytogenes might affect the pathogen's capacity for pathogenicity. The llsX virulence genes regulate the key processes of intracellular pathogens. For example, the internalin genes regulate cellular adherence and absorption within the host's epithelial tissue. The stimulation of plcB, invasion of epithelial cells, and vacuole escape are all controlled by metalloprotease (mpl). The actA gene also promotes angiogenesis and cell-to-cell dissemination. The hly gene makes ensuring that germs are released into the host's cell (42, 43). Given the presence of the genetic variants, it is highly likely that the L. monocytogenes strains from the samples examined in our investigation were capable of inflicting listeriosis in people. The increased presence of L. monocytogenes in clinical specimens that is resistant to antibiotics poses a risk to human health. When used to treat germs, antibiotics have varying effects. For example, sulphonamides work by preventing the production of folic acid, tetracyclines prevent the production of a polypeptide, and β-lactams prevent the last stage in the creation of bacterial cell walls (44). Because of how less harmful these antibiotics are, they are frequently used to treat microbial infections. The aminoglycosides prevent bacterial ribosomes from synthesizing peptides by attaching them. Protein translation during protein biosynthesis is inhibited by chloramphenicol. Due to a side effect that led to aplastic anemia, it was outlawed. Antimicrobial agent resistance is relatively high, which is a direct result of widespread and excessive use (45).

Even though L. monocytogenes had previously been exposed to several medicines that were effective against Gram-positive bacteria (46). The L. monocytogenes strains in this investigation varied in their responsiveness to the tested antibiotics. Sensitivity (100%) data for β- Lactams, Glycopeptides, and Fluoroquinolones is positive as it confirms the medical usage of these medications, the preferred medication advised for treating listeriosis infection, is still successful. Several studied antibiotics showed observable susceptibilities of greater than 50%, ranging from 86.36 percent (Macrolides and phenicols) to ansamycins (66.67 percent). In contrast to Manjur et al. (47) result, our investigation found lesser susceptibilities to imipenem and vancomycin. Similar to the results of Keet et al. (48) L. monocytogenes strains had varied proportions of tolerance to all tested antibiotics excluding ampicillin, for which no tolerance was noted. Sulfamethoxazole (63.16 percent), oxytetracycline (54.39 percent), and amoxicillin (50.88 percent) all had high rates of resistance. In contrast to what we reported, Manjur et al. (47) found that L. monocytogenes from surface water in Bangladesh were highly resistant to ampicillin, trimethoprim-sulfamethoxazole, and penicillin, as well as 100% resistant to erythromycin. Rodas-Suarez et al. (49) Found that tetracyclines, a subclass of oxytetracyclines, are more resistant. A significant correlation between the prevalence of resistance genes among L. monocytogenes strains was found by statistical analysis.

Significant genetic diversity was found among the L. monocytogenes strains examined by ERIC-, REP-, and RAPD-PCR typing. The dendrogram generated by the computer-assisted study, which generated five clusters, is proof of the strains' significant genetic variation. Clinical sample L. monocytogenes isolates developed clusters that revealed a historical connection between the strains. Maćkiw et al. (50) also found evidence of genetic variability among L. monocytogenes isolates obtained from clinical samples. The genetic variety found in the strains from clinical samples gathered from various sources demonstrated the usefulness and probable utility of this typing approach in source tracing L. monocytogenes, especially during epidemic examinations (50).

This investigation found that clinical samples had a significant proportion of resistant L. monocytogenes and ARGs. It is important from an epidemiological perspective that L. monocytogenes isolates have a high frequency of virulence genes. This brought to light the possible health risk posed by L. monocytogenes isolates found in clinical samples. Future concerns for both human and animal health arising from the frequency of multidrug-resistant L. monocytogenes may portend the advent of superbugs with clinical significance. Therefore, we suggest the adequate implementation of sensitization on the health implications of the indiscriminate use of antibiotics. Finally, L. monocytogenes strains found in clinical specimens that belonged to serogroup 4b, 1/2a, 1/2b, and 1/2c showed a variety of antibiotic resistance as well as the presence of all virulence genes. Although there is no conclusive proof of a listeriosis epidemic in Iran, the study shows that L. monocytogenes is frequently found in clinical samples. Additionally, the development of antibiotic resistance in the isolates under study represents the possible negative effects on public health.

Ethics approval and consent to participate

The research was extracted from the Ph.D thesis in the field of Microbiology and was ethically approved by the Council of Research of the Faculty of Basic Science, Shahrekord Branch, Islamic Azad University, Shahrekord, Iran (Consent Ref Number IR.IAU.SHK.REC.1400.099). Verification of this research project and the licenses related to sampling process were approved by the Prof. Hassan Momtaz (Approval Ref Number MIC201946). Informed consent was obtained from the patient. I confirm that all methods were performed in accordance with the relevant guidelines and regulations or in accordance with the Declaration of Helsinki.

Consent for publication

Not applicable.

Availability of data and materials

All data analyzed during this study are included in this published article.

Conflict of Interest

The authors declare that they have no Conflict interests.

Funding

Hassan Momtaz received Research grants for Research at Islamic Azad University, Shahrekord Branch, Shahrekord, Iran (grant number 01/1023). The present work was also financially supported by the Islamic Azad University, Shahrekord Branch, Shahrekord, Iran (grant number 01/1023). Funding was specified to designation of the study, samples collection, analysis, data interpretation and writing of the manuscript.

Authors Contributions

HM, and LF carried out the molecular genetic studies, participated in the primers sequence alignment and drafted the manuscript. RK and ZB carried out the sampling and culture method. HM and LF participated in the design of the study, performed the statistical analysis and writing the manuscript. All authors read and approved the final manuscript.

Acknowledgements

The authors would like to thank Dr. Abbas Doosti and the staff members of the Biotechnology Research Center of the Islamic Azad University of Shahrekord Branch in Iran for their help and support. This research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors.

Lomonaco S, Nucera D, Filipello V. The evolution and epidemiology of Listeria monocytogenesin Europe and the United States. Infection, Genetics and Evolution. 2015; 35: 172-83.
NicAogáin K, O’Byrne CP. The role of stress and stress adaptations in determining the fate of the bacterial pathogen Listeria monocytogenesin the food chain. Frontiers in Microbiology. 2016; 7: 1865.
Chen BY, Pyla R, Kim TJ, Silva JL, Jung YS. Antibiotic resistance in Listeria species isolated from catfish fillets and processing environment. Letters in Applied Microbiology. 2010; 50 (6): 626-32.
Sharifzadeh A, Momeni H, Ghasemi-Dehkordi P, Doosti A. Presence of Listeria monocytogenesin silage products of Shahrekord city. Asian Pacific Journal of Tropical Disease. 2015; 5: S133-6.
Maghsoudi S, Doosti A, Nayeri H, Chehelgerdi M. The frequency of ctpA gene in Listeria monocytogenesisolated from poultry using PCR. Journal of Microbial World. 2014; 6 (4): 312-9.
Momtaz H, Yadollahi S. Molecular characterization of Listeria monocytogenesisolated from fresh seafood samples in Iran. Diagnostic Pathology. 2013; 8 (1): 1-6.
Duze ST, Marimani M, Patel M. Tolerance of Listeria monocytogenesto biocides used in food processing environments. Food Microbiology. 2021; 97: 103758.
Kayode AJ, Semerjian L, Osaili T, Olapade O, Okoh AI. Occurrence of multidrug-resistant Listeria monocytogenesin environmental waters: a menace of environmental and public health concern. Frontiers in Environmental Science. 2021; 9: 737435.
Kurpas M, Osek J, Moura A, Leclercq A, Lecuit M, Wieczorek K. Genomic characterization of Listeria monocytogenesisolated from ready-to-eat meat and meat processing environments in Poland. Frontiers in Microbiology. 2020; 11: 1412.
Morobe IC, Obi CL, Nyila MA, Matsheka MI, Gashe BA. Molecular characterization and serotyping of Listeria monocytogeneswith a focus on food safety and disease prevention. Biochemical Testing. 2012; 8: 197-216.
Soni DK, Singh M, Singh DV, Dubey SK. Virulence and genotypic characterization of Listeria monocytogenesisolated from vegetable and soil samples. BMC Microbiology. 2014; 14 (1): 1-0.
Farber JM, Peterkin P. Listeria monocytogenes, a food-borne pathogen. Microbiological Reviews. 1991; 55 (3): 476-511.
Chen BY, Pyla R, Kim TJ, Silva JL, Jung YS. Prevalence and contamination patterns of Listeria monocytogenesin catfish processing environment and fresh fillets. Food Microbiology. 2010; 27 (5): 645-52.
CDC. Centers for Disease Control and Prevention, Centers for Disease Control and Prevention. Investigation update: multistate outbreak of human Salmonella I 4,[5], 12: i:-infections linked to alfalfa sprouts. On the World Wide Web at http://www. cdc. gov/salmonella/i4512i-/021011/index. Html. 2011.
Todd EC, Notermans S. Surveillance of listeriosis and its causative pathogen, Listeria monocytogenes. Food Control. 2011; 22 (9): 1484-90.
Swetha CS, Porteen K, Elango A, Ronald BS, Kumar TS, Milton AP, Sureshkannan S. Genetic diversity, virulence and distribution of antimicrobial resistance among Listeria monocytogenesisolated from milk, beef, and bovine farm environment. Iranian Journal of Veterinary Research. 2021; 22 (1): 1.
Sun Q, Cai S, Cheng J, Zhang Y, Lin R, Ye Q, Xue L, Zeng H, Lei T, Zhang S, Luo X. Distribution, contamination routes, and seasonal influence of persistent Listeria monocytogenesin a commercial fresh Hypsizigus marmoreus production facility. Food Control. 2021; 127: 108118.
Barbuddhe SB, Malik SV, Kumar JA, Kalorey DR, Chakraborty T. Epidemiology and risk management of listeriosis in India. International Journal of Food Microbiology. 2012; 154 (3): 113-8.
ISO 11290-1:2017: Microbiology of the food chain — Horizontal method for the detection and enumeration of Listeria monocytogenes and of Listeria spp. — Part 1: Detection method.
CLSI. Performance Standards for Antimicrobial Susceptibility
Testing. Clinical and Laboratory Standards Institute (CLSI). 31st Edition, M-100, 2021.
Chen M, Chen Y, Wu Q, Zhang J, Cheng J, Li F, Zeng H, Lei T, Pang R, Ye Q, Bai J. Genetic characteristics and virulence of Listeria monocytogenes isolated from fresh vegetables in China. BMC Microbiology. 2019;19(1):1-9.
Jonquières R, Bierne H, Mengaud J, Cossart P. The inlA gene of Listeria monocytogenes LO28 harbors a nonsense mutation resulting in release of internalin. Infection and Immunity. 1998;66(7):3420-2.
Doumith M, Buchrieser C, Glaser P, Jacquet C, Martin P. Differentiation of the major Listeria monocytogenes serovars by multiplex PCR. Journal of Clinical Microbiology. 2004;42(8):3819-22.
Somer L, Kashi Y. A PCR method based on 16S rRNA sequence for simultaneous detection of the genus Listeria and the species Listeria monocytogenes in food products. Journal of Food Protection. 2003;66(9):1658-65.
Jersek B, Gilot P, Gubina M, Klun N, Mehle J, Tcherneva E, Rijpens N, Herman L. Typing of Listeria monocytogenes strains by repetitive element sequence-based PCR. Journal of Clinical Microbiology. 1999;37(1):103-9.
Lee HY, Chai LC, Pui CF, Tunung R, Wong WC, Shuhaimi M, Cheah YK, Farinazleen MG, Nishibuchi M, Son R. Using RAPD-PCR as molecular assessment on the performance of CHROMAgar Listeria and PALCAM agar on isolation of Listeria spp. and L. monocytogenes from foods. International Food Research Journal. 2011;18(2):501-6.
Heras J, Domínguez C, Mata E, Pascual V, Lozano C, Torres C, Zarazaga M. GelJ–a tool for analyzing DNA fingerprint gel images. BMC Bioinformatics. 2015;16(1):1-8.
Borena BM, Dilgasa L, Gebremedhin EZ, Sarba EJ, Marami LM, Kelbesa KA, Tadese ND. Listeria Species Occurrence and Associated Risk Factors and Antibiogram of Listeria monocytogenesin Milk and Milk Products in Ambo, Holeta, and Bako Towns, Oromia Regional State, Ethiopia. Veterinary Medicine International. 2022; 2022.
Smith J, Manoranjan J, Pan M, Bohsali A, Xu J, Liu J, McDonald KL, Szyk A, LaRonde-LeBlanc N, Gao LY. Evidence for pore formation in host cell membranes by ESX-1-secreted ESAT-6 and its role in Mycobacterium marinum escape from the vacuole. Infection and Immunity. 2008; 76 (12): 5478-87.
Mpondo L, Ebomah KE, Okoh AI. Multidrug-resistant Listeria species shows abundance in environmental waters of a key district municipality in South Africa. International Journal of Environmental Research and Public Health. 2021;18 (2): 481.
Odjadjare EE, Obi LC, Okoh AI. Municipal wastewater effluents as a source of listerial pathogens in the aquatic milieu of the Eastern Cape Province of South Africa: A concern of public health importance. International Journal of Environmental Research and Public Health. 2010; 7 (5): 2376-94.
Lyautey E, Lapen DR, Wilkes G, McCleary K, Pagotto F, Tyler K, Hartmann A, Piveteau P, Rieu A, Robertson WJ, Medeiros DT. Distribution and characteristics of Listeria monocytogenesisolates from surface waters of the South Nation River watershed, Ontario, Canada. Applied and Environmental Microbiology. 2007; 73 (17): 5401-10.
Weller D, Wiedmann M, Strawn LK. Irrigation is significantly associated with an increased prevalence of Listeria monocytogenesin produce production environments in New York State. Journal of Food Protection. 2015; 78 (6): 1132-41.
Dijkstra RG. The occurrence of Listeria monocytogenesin surface water of canals and lakes, in ditches of one big polder and in the effluents and canals of a sewage treatment plant. Zentralblatt fur Bakteriologie, Parasitenkunde, Infektionskrankheiten und Hygiene, Abt. I. 1982(2/3): 202-5.
Taherkhani A, Attar HM, Moazzam MM, Mirzaee SA, Jalali M. Prevalence of Listeria monocytogenesin the river receiving the effluent of municipal wastewater treatment plant. International Journal of Environmental Health Engineering. 2013; 2 (1): 49.
Raschle S, Stephan R, Stevens MJ, Cernela N, Zurfluh K, Muchaamba F, Nüesch-Inderbinen M. Environmental dissemination of pathogenic Listeria monocytogenesin flowing surface waters in Switzerland. Scientific Reports. 2021; 11 (1): 1-1.
Stea EC, Purdue LM, Jamieson RC, Yost CK, Truelstrup Hansen L. Comparison of the prevalences and diversities of Listeria species and Listeria monocytogenesin an urban and a rural agricultural watershed. Applied and Environmental Microbiology. 2015;81 (11): 3812-22.
Doumith M, Buchrieser C, Glaser P, Jacquet C, Martin P. Differentiation of the major Listeria monocytogenesserovars by multiplex PCR. Journal of Clinical Microbiology. 2004; 42 (8): 3819-22.
Pontello M, Guaita A, Sala G, Cipolla M, Gattuso A, Sonnessa M, Gianfranceschi MV. Listeria monocytogenesserotypes in human infections (Italy, 2000-2010). Annali dell'Istituto superiore di sanità. 2012; 48: 146-50.
Iwu CD, Okoh AI. Characterization of antibiogram fingerprints in Listeria monocytogenesrecovered from irrigation water and agricultural soil samples. PLoS One. 2020; 15 (2): e0228956.
Olaniran AO, Nzimande SB, Mkize NG. Antimicrobial resistance and virulence signatures of Listeria and Aeromonas species recovered from treated wastewater effluent and receiving surface water in Durban, South Africa. BMC Microbiology. 2015; 15 (1): 1-0.
Alvarez DE, Agaisse H. The metalloprotease Mpl supports Listeria monocytogenesdissemination through resolution of membrane protrusions into vacuoles. Infection and Immunity. 2016; 84 (6): 1806-14.
Kayode AJ, Igbinosa EO, Okoh AI. Overview of listeriosis in the Southern African Hemisphere. Journal of Food Safety. 2020; 40 (1): e12732.
Levy SB, Marshall B. Antibacterial resistance worldwide: causes, challenges and responses. Nature medicine. 2004; 10 (12): S122-9.
Lateef A. The microbiology of a pharmaceutical effluent and its public health implications. World Journal of Microbiology and Biotechnology. 2004; 20 (2): 167-71.
Charpentier E, Courvalin P. Antibiotic resistance in Listeria spp. Antimicrobial agents and chemotherapy. 1999; 43 (9): 2103-8.
Manjur MS, Siddique S, Ahmed S. Multi-drug resistant pathogenic Listeria monocytogenesin surface water and soil samples of Dhaka city. Bangladesh Journal of Microbiology. 2016; 33 (1-2): 39-42.
Keet R, Rip D. Listeria monocytogenesisolates from Western Cape, South Africa exhibit resistance to multiple antibiotics and contradicts certain global resistance patterns. AIMS microbiology. 2021; 7(1): 40.
Rodas-Suárez OR, Flores-Pedroche JF, Betancourt-Rule JM, Quiñones-Ramirez EI, Vázquez-Salinas C. Occurrence and antibiotic sensitivity of Listeria monocytogenesstrains isolated from oysters, fish, and estuarine water. Applied and Environmental Microbiology. 2006; 72 (11): 7410-2.
Maćkiw E, Korsak D, Kowalska J, Felix B, Stasiak M, Kucharek K, Postupolski J. Incidence and genetic variability of Listeria monocytogenes isolated from vegetables in Poland. International Journal of Food Microbiology. 2021; 339: 109023.

No competing interests reported.

Molecular characterization of Listeria monocytogenes strains isolated from clinical samples in Urmia patients

Status:

Version 1

Abstract

Background

Methods

Results

Conclusions

Figures

Introduction

Materials And Methods

Sample collection

Sensitivity Screening For Antibiotics

Dna Extraction

Identification Of Serogroups And Genes Unique To Species And Pathogenicity

Eric- Rep- And Rapd-pcr-based Genomic Fingerprinting

Statistical analysis

Results

Sensitivity To Antibiotics

Eric-, Rep- And Rapd-pcr Fingerprint Analysis

Discussion

Declarations

References

Additional Declarations

Status:

Version 1