LINC01137 facilitate pancreatic cancer stemness via the miR-7155-5p/KLF12/AKT axis

doi:10.21203/rs.3.rs-2065916/v1

Background

Pancreatic cancer, of which pancreatic ductal adenocarcinoma (PDAC) is one of the most prevalent type, is one of the most malignant tumors, with a 5-year survival rate of about 10%. Pancreatic cancer stem cells play pivotal roles in chemoresistance and recurrence. Long non-coding RNAs (lncRNAs) have been identified as key regulators of the biological progression of various cancers. LncRNAs were found to be associated with cancer stem cells, which are related to chemoresistance. LINC01137 has been reported as an oncogene in oral squamous cell carcinoma, and bioinformatic analysis found it associated with pancreatic cancer stem cells. This study is aim to discover the function and the underlying mechanism of LINC01137 in pancreatic cancer.

Results

LINC01137 was pancreatic cancer stem cell-associated lincRNA and associated with stem genes. LINC01137 was upregulated in pancreatic cancer tissues and cell lines. Its high expression correlated with poor prognosis. Knockdown of LINC01137 expression reduced pancreatic cancer stemness, chemoresistance, and proliferation. Mechanistically, LINC01137 mostly located in cytoplasm and exerted its biological function by binding to miR-7155-5p to activate the KLF12/PI3K/AKT pathway. KLF12 also promoted LINC01137 expression. LINC01137 and KLF12 were involved in promoting PDAC tumorigenesis.

Conclusion

Our results suggested that LINC01137 functions as an oncogene in pancreatic cancer and identified its post-transcriptional regulatory mechanisms, which may contribute to targeted therapy for pancreatic cancer.

CSC

Biomarker

Stemness

Chemoresistance

KLF12

LINC01137

Has-miR-7155-5p

PDAC is the most common type of pancreatic malignant cancer (accounting for almost 85% of cases) [1] and it remains an urgent worldwide healthcare problem. In America, it is the fourth leading cause of cancer death regardless of sex, also ranking 7th in China and 5th in males and 4th in females in the US Hispanic/Latino population, respectively [2–4]. Surgery is the only way to prolong PDAC patient survival. Owing to early diagnosis and emerging neoadjuvant therapy, an increasing number of patients can undergo surgery and show longer survival times [5, 6]. Unfortunately, cancer recurrence and chemoresistance pose severe challenges for patients after pancreatectomy. Avoiding chemoresistance and recurrence has become a difficult challenge.

Cancer stem cells (CSCs) are a cluster of cancer tissues characterized by self-renewal and self-differentiation. CSCs induce heterogeneity in cancer [7]. CSCs play a critical role in many biological processes involved in tumorigenesis [8]. Recent research has shown that CSCs contribute to recurrence and chemoresistance [9–11]. Except CSCs, non-stem cancer cells also sometimes show stem-cell-like phenotypes, described as gain of ‘stemness’ [12]. After gaining ‘stemness’, cancer cells become more resistant to chemotherapy and recur more easily. Tumor microenvironment itself promotes CSCs maintain and stemness acquisition through poorly differentiated state in cellular immune ecosystem, aberrant angiogenesis and hypoxia[13, 14]. Trans-differentiation of CSCs into mature tumor cell will revise resistance to chemotherapy and blocking de-differentiation of mature cell to CSCs will impair capacity of tumor in adaption to various condition[15, 16]. Therefore, figuring out how cancer cells gain ‘stemness’ and maintain this phenotype can provide more targets to treat PDAC.

LINC01137, a 1443 bp mRNA, is a lncRNA located in 1p34.3. in oral squamous cell carcinoma, which positively promotes cancer development [17]. Bioinformatics analysis indicated that LINC01137 is associated with ferroptosis, autophagy, and redox in lung adenocarcinoma [18–20] and indicated poor outcomes in high-grade serous ovarian cancer [21]. Its biological function in pancreatic cancer is still unknown and bioinformatics analysis has indicated that LINC01137 correlates with CSCs. Therefore, we designed experiments to determine the role of LINC01137 in PDAC and its clinical value.

LINC01137 was related with PCSCs and higher LINC01137 expression was associated with poor outcome

Data from GSE51971 dataset were used to identify different long intergenic lncRNAs in PCSC-like and non-PCSC-like cells. We defined CD44⁺CD133⁺EpCAM⁺ cells as PCSC-like cells and CD44^-CD133^-EpCAM^- cells as non-PCSC-like cells, following GSE51971 dataset construction. There were 30 upregulated long intergenic lncRNAs in PCSC-like cells (Fig. 1A). Correlation between these genes and stem cell markers showed that LINC01137 was highly associated with CD133 and CD44 in TCGA and MTAB6690 datasets (Fig. 1B). In TCGA dataset, LINC01137 expression was higher in tumor tissues than in the associated normal tissues (Fig. 1C). Meanwhile, higher LINC01137 expression was associated with a worse overall outcome and shorter disease-free survival time (Fig. 1D-E). In Ruijin Hospital cohort, LINC01137 expression was higher in tumor tissues than in paired normal tissues, and higher LINC01137 expression associated with a worse overall outcome (Fig. 1F-G). LINC01137 appeared to be a signature of cancer stemness and seemed able to predict the outcome of PDAC. Therefore, we selected LINC01137 for further study. The expression of LINC01137 was determined in five pancreatic cancer cell lines (AsPC-1, BxPC-3, CFPAC-1, Panc-1, and Patu8988) and HPNE cell line. LINC01137 expression was higher in pancreatic cancer cell lines than in HPNE cells (Fig. 1H). We chose two pancreatic cell lines for LINC01137 knockdown, whose LINC01137 expression are highest (CFPAC-1 cell line) and medium (Pan-1 cell line) (Fig. 1I), and two for LINC01137 overexpression, which express low LINC01137 (BxPC-3 cell line) and medium LINC01137 (Panc-1 cell line) (Fig. S1A).

LINC01137 promoted PDAC stemness and gemcitabine chemoresistance

Since bioinformatic analysis show the relation between LINC01137 and CSC-related markers, the extent of stemness in CFPAC-1 and Panc-1 cell lines was first examined in vitro. As expected, when LINC01137 expression decreased, sphere cells manifested lower sphere numbers and shorter sphere diameters. This phenomenon was observed in both CFPAC-1 and Panc-1 cell lines (Fig. 2A-B). Second, CD44 and CD133 expression was detected using FCM. Compared with the control group, the sh-LINC01137 group showed lower CD133⁺/CD44⁺ cell ratio under normal culture conditions (Fig. 2C-D), indicating that less cancer cells related with stemness after reducing LINC01137. LINC01137 overexpression increased CD133⁺/CD44⁺ cell ratio in Panc-1 cells (Fig. S2A). In addition, stemness-related protein (such as CD44, NANOG, and ALD1H1) expression was impaired by LINC01137 knockdown (Fig. 2E). Limiting dilution assays built a model to detect capacity of stemness and estimate CSC frequency in vivo. Only the control group grew when the number of injected cells was less than 10⁴ in the CFPAC-1 cell line, while the same phenomenon was detected in the Panc-1 cell line when less than 10⁵ cells were injected (Fig. 2H). LINC01137 knockdown led to more than 60% reduction in CSC frequency in vivo (Fig. S2B). LINC01137 knockdown reduced the expression of stemness marker genes CD44 and CD133 in vivo (Fig. 2I). Taken together, LINC01137 promoted stemness in pancreatic cancer cells. Many studies have found that CSCs contribute to chemoresistance; therefore, we examined whether LINC01137 promotes PDAC resistance to gemcitabine, which is a first-line chemotherapeutic drug in the clinic. In vitro, after LINC01137 knockdown in the CFPAC-1 and Panc-1 cell lines, the IC₅₀ of gemcitabine decreased (Fig. 2F), and more cells underwent apoptosis after being treated with gemcitabine (Fig. 2G). LINC01137 overexpression increased the IC₅₀ of gemcitabine in BxPC-3 cell line(Fig. S2C). LINC01137 was upregulated in gemcitabine-resistant cells, compared with their parent cells (Fig. S2D). Thus, LINC01137 decreased PDAC cell sensitivity to gemcitabine. Taken together, these results suggest that LINC01137 promotes PDAC stemness and chemoresistance.

LINC01137 promoted PDAC proliferation and cell cycle

Next, we investigated the effect of LINC01137 on cell proliferation. In vitro, silencing LINC01137 markedly slowed the growth of both PDAC cell lines (CFPAC-1 and Panc-1), as determined using the CCK-8 (Fig. 3A) and colony formation (Fig. 3B) assays. LINC01137 overexpression accelerated PDAC cell growth (Fig. S3A-B). Consistently, the EdU assay indicated that the knockdown group had fewer EdU-positive cells than the control group (Fig. 3C). Meanwhile, LINC01137 overexpression increased EdU-positive cells (Fig. S3C). Consistent with the in vitro findings, tumors with LINC01137 knockdown grew slowly and weighed less in vivo (Fig. 3F). Furthermore, tumors with LINC01137 knockdown had fewer PCNA-positive cells than those without LINC01137 knockdown (Fig. 3G), indicating that LINC01137 knockdown impeded cell proliferation in vivo. FCM was performed to determine whether LINC01137 regulated the cell cycle. More LINC01137-silenced cells were arrested in the G1 phase, compared with control cells (Fig. S3D). To further investigate whether LINC01137 plays a critical role in the G1/S checkpoint, PDAC cells (CFPAC-1 and Panc-1) were synchronized in the G0/1 phase via serum starvation (Fig. S3E). Re-treated with medium with FBS 12 h after starvation, more cells shifted into the S and G2 phase, compared with knockdown group (Fig. 3D). The expression levels of key cell cycle proteins were also decreased in cells with lower LINC01137 expression levels (Fig. 3E). Taken together, these results indicated that LINC01137 accelerates PDAC proliferation by prolonging the cell cycle period.

LINC01137 acting as a competing endogenous RNA (ceRNA) targeted miR-7155-5p to promote PDAC tumorigenesis

We used lncLocator to predict the subcellular localization of LINC01137. It predicted that LINC01137 mostly located in the cytoplasm (Fig. 4A). FISH and nucleocytoplasmic separation assays were performed to determine the subcellular localization of LINC01137. The results showed that most LINC01137 was present in the cytoplasm (Fig. 4B-C). This finding suggests that LINC01137 may exert its biological function by acting as a ceRNA. Three public datasets (DIANA, miRDB, and LNCSNP2) were used to predict miRNA candidates. Three miRNAs (miR-765, miR-4664-5p, and miR-7155-5p) were predicted to interact with LINC01137 in the three datasets (Fig. 4D). The expression of these miRNAs in CFPAC-1 and Panc-1-knockdown cell lines was evaluated using qRT-PCR. In both cell lines, the expression level of miR-7155-5p increased in LINC01137-silenced cells (Fig. 4E). Therefore, miR-7155-5p was selected for further experiments. In Ruijin cohort, the negative correlation between LINC01137 and miR-7155-5p was significant (Fig. 4F) and miR-7155-5p expression was lower in tumor tissues than in paired normal tissues (Fig. 4G). A dual-luciferase reporter assay was performed to verify the interaction between LINC01137 and miR-7155-5p. WT and MUT LINC01137 3’-UTRs were designed by Bioegene (Shanghai, China). As expected, there was a significant reduction in luciferase activity after co-transfection of miR-7155-5p mimics and a WT LINC01137 reporter vector, but this reduction was not observed after the co-transfection of miR-7155-5p and a MUT LINC01137 reporter vectors (Fig. 4H), suggesting an interaction between LINC01137 and miR-7155-5p. Considering the significant changes of phenotype, sh-LINC01137#2 group was used for following research. The expression of miR-7155-5p after transfection with the inhibitor was detected using qRT-PCR (Fig. 5A). After infection with the miR-7155-5p inhibitor, the CD133⁺/CD44⁺ cell ratio upgraded and stemness-related protein expression increased (Fig. 5C-D). Regarding chemoresistance, after downgrading miR-7155-5p expression, the IC₅₀ of gemcitabine increased in both CFPAC-1 and Panc-1 Sh-LINC01137#2 cell lines (Fig. S4A), while less cell apoptosis was observed with gemcitabine for 48 h (Fig. 5B). For tumor proliferation, reducing miR-7155-5p expression boosted PDAC duplication speed (Fig. 5E-F). Based on this evidence, we concluded that LINC01137 promotes PDAC malignancy through miR-7155-5p.

LINC01137 regulated KLF12 through miR-7155-5p

RNA sequencing and public datasets were used to predict the downstream mRNAs for further research. Four datasets (miRDB, miRWalk, miRPathDB, and TargetScan) were used to predict the mRNAs, which miR-7155-5p may interact with, and 496 mRNAs were found. RNA sequencing data were used to screen for significant mRNAs, and 13 mRNAs were found (Fig. S4B). Among these mRNAs, KLF12 was reported associated with CSCs[22, 23]. Its expression in the CFPAC-1 and Panc-1 cell line was tested using western blotting analysis. KLF12 expression was downregulated after LINC01137 knockdown (Fig. S4C). The negative correlation between miR-7155-5p and KLF12 and positive correlation between LINC01137 and KLF12 were significant in Ruijin cohort (Fig. 6A). In Ruijin cohort, KLF12 expression was higher in tumor tissues than in paired normal tissues (Fig. 6B). A dual-luciferase reporter assay was performed to verify the interaction between miR-7155-5p and KLF12. Luciferase activity was decreased by co-transfecting miR-7155-5p mimics and a WT KLF12 3’-UTR reporter vectors, but this reduction was not observed after co-transfecting miR-7155-5p mimics and a MUT KLF12 3’-UTR reporter vectors (Fig. 6C). After infection with miR-7155-5p mimics, KLF12 expression decreased in the CFPAC-1 and Panc-1 cell lines (Fig. S4D). Taken together, these results suggested that miR-7155-5p interacts with KLF12. A KLF12 rescue experiment was performed. KLF12 overexpression effect was verified through qRT-PCR and western blotting analysis (Fig. 6D). For the stemness phenotype, the CD133⁺/CD44⁺ cell ratio was increased and stemness-related protein expression was also enhanced after upgrading KLF12 expression (Fig. 6F-G). For chemoresistance assays, fewer cells underwent apoptosis (Fig. 6E), and the IC₅₀ slightly increased after transfection with the KLF12 vector (Fig. S4E). KLF12 overexpression boosted cell proliferation capacity, as shown by the CCK-8 and colony formation assays (Fig. 6H-I). This indicated that LINC01137 may regulate KLF12 to promote PDAC tumorigenesis.

LINC01137 participated in the PI3K/Akt pathway to promote PDAC tumorigenesis through regulating KLF12

Previous studies have indicated that KLF12 participates in the PI3K/Akt pathway to regulate biological activities [24]. Our RNA sequencing results also confirmed that LINC01137 could regulate the PI3K/Akt pathway (Fig. 7A). Western blotting results indicated that, compared with the control group, the LINC01137-knockdown group had a lower PI3K/Akt-related and stemness-, cell-cycle-related protein expression grade. With miR-7155-5p downregulation and KLF12 overexpression, this decreasing trend was reversed (Fig. 7B). Furthermore, Jasper (https://jaspar.genereg.net/) was used to predict the molecules that KLF12 regulates. Interestingly, LINC01137 was found to be a potent molecule regulated by KLF12 (Fig. 7C). After KLF12 overexpression, LINC01137 expression increased simultaneously in the BxPC-3 and Panc-1 cell lines (Fig. 7D). Thus, LINC01137 and KLF12 may form a loop that facilitates PDAC tumorigenesis (Fig. 7E).

Among tumor subtype cells, PCSCs are associated with chemoresistance and contributing to reoccurrence of cancer, and focusing on them could provide more therapeutic targets [25, 26].Notch, WNT, Hedgehog and Hippo pathways are reported associating with CSCs, and therapies focused on molecules among these pathways receive positive feedback[27]. PI3K/Akt signal pathway is involved in PDAC cell proliferation[28]. Moreover, this signaling activation also promotes PCSCs stabilization, migration and invasion[29, 30]. Therapy targeting PI3K/Akt signal pathway has potential to treat PDAC. In present study, we found LINC01137 was highly related with CSCs. Previous studied show LINC01137 is predicted to be associated with ferroptosis, autophagy, and redox reactions[18–20]. In oral squamous cell carcinoma, LINC01137 promotes cancer development [17]. Our study also illustrated that LINC01137 expression was significantly increased in tumor tissues, compared with the paired normal tissues. Higher LINC01137 expression was associated with poor outcomes, as indicated by survival analysis. In vitro and in vivo functional experiments demonstrated that LINC01137 maintains tumor stemness and chemoresistance and promotes PDAC tumorigenesis. LINC01137 could be potential progress predictor and therapeutic target. Molecular mechanism underlying gene function provides reliable evidence for lncRNAs appliance in cancer therapy. In present study, we determined that LINC01137 is mostly located in the cytoplasm, acts as ceRNA directly binding miR-7155-5p and finally stables KLF12 mRNA to play its biological functions. It’s reported that KLF12 facilitates many biological processes in multiple cancers, including pancreatic cancer, and actives notch pathway [23, 31–34]. Our study also discover that LINC01137 regulates PI3K/Akt pathway through KLF12. These results provide first evidences indicating LINC01137 not only acts as oncogene in PDAC promoting cancer stemness, chemoresistance and growth but also have clinic value in predicting PDAC progress.

LncRNA have significant potential to serve as diagnosis and progress predictor, and due to involve in cancer biological function and regulate pathogenic pathway, many studies light on molecular mechanism the lncRNA anticipated. For instance, FLVCR1-AS1 plays a tumor-suppressive role in PDAC by sponging miR-513c-5p or miR-514b-5p to inhibit proliferation, cell cycle, and migration [35], whereas LINC00261 inhibits c-Myc-mediated aerobic glycolysis in PDCA by sponging miR-222-3p and downgrading IGF2BP1 [36]. Further researches focus on therapy targeting lncRNA to treat cancer. Available therapies rely on lncRNAs function include transcriptional inhibition of lncRNAs, transcriptional upregulation of tumor suppressors, post-transcriptional degradation of lncRNAs and steric inhibition of lncRNA-protein[37]. One preclinic study showed promising result that antisense oligonucleotides targeting natural antisense transcripts, lncRNAs that are transcribed in the antisense direction to coding genes and negatively regulate them in cis, can induce gene reactivation in central nervous system to relieve Dravet syndrome[38]. In present research, we illuminated LINC01137 acts as oncogene in PDAC to facilitate pancreatic cancer stemness, chemoresistance and growth and found LINC01137 regulates PDAC tumorigenesis by miR-7155-5p/KLF12/Akt axis. LINC01137 was tightly relative with PCSCs, and considering relationship between PCSCs and chemoresistance and reoccurrence, LINC01137 could be potential biomarker for predicting progress of PDAC patients and drug respond of chemotherapy.

However, our study had some limitations. The stemness phenotype was a PCSC derivative, and we have not studied the role of LINC01137 in PCSCs. Furthermore, the relationship between stemness and chemoresistance under LINC01137 is still unclear and requires further discussion. The mechanism, by which KLF12 regulates the PI3K/AKT pathway and LINC01137 requires further investigation.

CSCs play a critical role in tumor tumorigenesis, reoccurrence and chemoresistance. However, the underlying mechanisms were unclear. In present study, we found LINC01137 was tightly relevant with PCSCs, upgraded in PDAC tissue and indicated poor outcome in patients. In vitro and in vivo experiments illuminated LINC01137 promotes PDAC stemness, chemoresistance and growth, and these affects were performed by regulating PI3K/Akt pathway through sponging has-miR-7155-5p to stabilize KLF12 mRNA. We found LINC01137 maintains PDAC stemness and associates poor progress. Therapy targeting LINC01137 has potential capacity for treating PDAC, and LINC01137 expression is sensitive sign for predictor tumor reoccurrence and chemoresistance status.

Human cell lines and tissues

Five pancreatic cancer cell lines (AsPC-1, BxPC-3, CFPAC-1, Panc-1, and Pau8988) and human pancreatic ductal epithelial (HPNE) cells were purchased from the Cell Repository, Chinese Academy of Sciences (Shanghai, China). In addition, 293T cells were obtained from Shanghai Institute of Hematology. Three gemcitabine-resistant pancreatic cancer cell lines (AsPC-1-GR, BxPC-3-GR, CFPAC-1-GR) were cultured by Pancreatic disease research center, Shanghai Jiao Tong University School of Medicine. Panc-1, Patu8988, HPNE, and 293T cells were cultured in DMEM. AsPC-1 and BxPC-3 cells were grown in RPMI-1640. CFPAC-1 cells were grown in Iscove's modified Dulbecco's medium. All media contained 10% inactivated FBS (Gibco, Carlsbad, CA, USA), 1 × 10⁵ U/L penicillin, and 100 mg/L streptomycin (Gibco). Cells were cultured in a humidified atmosphere containing 5% CO₂ at 37 °C. Seventy-two pairs of pancreatic cancer tissues and adjacent normal pancreatic tissues were collected at Ruijin Hospital affiliated -with the Shanghai Jiaotong University School of Medicine (Shanghai, China). All 72 cancer samples were histologically identified as adenocarcinoma. All tissue samples were snap-frozen in liquid nitrogen and stored at -80 °C until use. All enrolled patients met the following criteria: (1) pathological diagnosis of pancreatic cancer, (2) complete clinicopathological and follow-up data, and (3) no preoperative chemotherapy. Written informed consent was obtained from all patients, and the study protocol was approved by the ethics committee of Ruijin Hospital.

RNA extraction and quantitative real-time PCR (qRT-PCR)

TRIzol reagent (Invitrogen, Carlsbad, CA) was used to extract total RNA, according to the manufacturer’s instructions. Cytoplasmic and nuclear RNA was extracted using the PARIS kit (Invitrogen). RNA samples were analyzed using NanoPhotomentN120(IMPLEN, Germany) to detect the concentrations and values of A260/A280 and A260/A230. CDNA was synthesized from 1 µg RNA using the Evo M-MLV RT Kit with the gDNA Clean for qPCR II kit (Accurate Biology, Hunan, China), according to the manufacturer’s instructions. QRT-PCR assays of mRNA expression levels were performed using SYBR^® Green Premix Pro Taq HS qPCR Kit II (Accurate Biology, Hunan, China) on qTOWER³ 84G (Analytik Jena AG, Jena, Germany) according to the manufacturer’s instructions. The housekeeping genes U6 and glycerinaldehyde-3-phosphat-dehydrogenase (GAPDH) were used as reference genes. Primer sequences are listed in Table 1.

Western blot analysis

Cells were lysed in RIPA buffer (Beyotime, Shanghai, China) supplemented with a protease inhibitor cocktail (MCN Biotech, Suzhou, China), loaded and separated on a 10% SDS-PAGE gel (EpiZyme, Shanghai, China). The samples were transferred onto polyvinylidene fluoride membranes and incubated with the following primary antibodies: anti-KLF12, anti-Cyclin D3, anti-CDK4, anti-CD44, anti-Sox2, anti-NANOG, anti-ALD1H1, anti-Oct-4A, anti-p-pb, anti-p21, anti-p-AKT, anti-AKT, anti-GAPDH (Table 2). GAPDH was used as the controls.

Immunohistochemistry

Subcutaneous tumor tissues from nude mice were fixed in 4% paraformaldehyde, dehydrated and embedded in paraffin. The antigens were retrieved and nonspecific binding was blocked using 4% normal goat serum (Gibco). Subsequently, cell coverslips were incubated with anti-PCNA, anti-CD44, and anti-CD133 primary antibodies (Table 3), followed by incubation with HRP-conjugated goat anti-rabbit IgG antibodies (1:1000, Cell Signaling, MA, USA). Then, 3,3-diaminobenzidine chromogen substrate solution was used to visualize the results.

Cell transfection

For in vitro experiments, miR-7155-5p mimics, negative control (NC) mimics, miR-7155-5p inhibitor and NC inhibitor were synthesized by Tsingke (Beijing, China). Two shRNA-GFP vectors with two shRNA sequences targeting the 3’-UTR of LINC01137 and a NC shRNA-GFP vector were synthesized by Bioegene (Shanghai, China). Full-length LINC01137 and KLF12 cDNA was synthesized and inserted into a lentiviral vector or plasmid (Bioegene, Shanghai, China). BxPC-3, CFPAC-1 and PANC-1 cells transduced with the lentivirus were treated with 2 μg/mL puromycin for 48 h to establish stable cell lines. All transfections were performed using Lipofectamine 3000 (Invitrogen). The cells were collected 48h post-transfection. The miRNA mimics and inhibitor, shRNA, and NC sequences are listed in Table 4.

Sphere formation assay

Pancreatic CSC (PCSC) spheres were generated by culturing primary pancreatic cancer cells (2000-4,000 cells/ml) in ultra-low attachment plates (Corning) in FBS-free DMEM/F12 (Invitrogen) supplemented with B27 1:50 (Invitrogen), 20 ng/mL bFGF (PAN-Biotech), and 50 U/mL penicillin/streptomycin (Thermo Fisher Scientific). Seven days later, the spheres were harvested, trypsinized into single cells and re-cultured for subsequent assays. Seven days later, the spheres were measured, counted and photographed under a Zeiss Axio Vert A1 microscope (Zeiss, Oberkochen, Germany).

Cell proliferation assay

A CCK-8 kit was purchased from Meilunbio (Dalian, China). The cells were plated in 96-well plates and treated for 24 h. Then, the CCK-8 reagent was added to the cells for another 4 h. Absorbance was measured using a microplate reader at 450 nm. A BeyoClick™ EdU Cell Proliferation Kit with Alexa Fluor 555 was purchased from Beyotime (Shanghai, China). The cells were plated in 12-well plates, cultured for 24 h, and then fixed using 4% paraformaldehyde and stained with DAPI after incubation with 50 mM EdU solution for 2 h. EdU-labeled cells were photographed under a Zeiss Axio Vert A1 microscope (Zeiss, Oberkochen, Germany).

Colony formation assay

The cells (1000-2000 cells/well) were seeded into 6-well plates and incubated with complete medium at 37 °C for 2–3 weeks. Then, the cells were fixed with 4% paraformaldehyde and stained with 2% crystal violet. Images were obtained under a Zeiss Axio Vert A1 microscope (Zeiss, Oberkochen, Germany) and the number of colonies was counted.

Flow cytometry (FCM)

Apoptosis rates were determined using FCM after staining with Annexin-V-APC and 7AAD. The Annexin-V-APC and 7AAD Apoptosis Detection Kit was purchased from BioLegend (San Diego, CA). The cells were plated in 6-well plates and treated as described in the Results section. Then, the cells were harvested, washed twice, resuspended in binding buffer, and stained with Annexin-V-APC and 7AAD solution for 15 min at room temperature. Finally, the samples were subjected to FCM.

Cell cycle analysis were determined using FCM after staining with PI. The cell cycle analysis kit was provided by Sigma(St. Louis, MO). After seeding in 6-well plates for 48 h, the cells were washed three times with cold PBS. Then, the supernatant was discarded via centrifugation, and the cells were resuspended at 1 × 10⁶cells/ml in 75% ethanol. After fixation at 4 ℃ for 8 h, cold ethanol was discarded via centrifugation, and the cells were washed with PBS twice. After removal of the supernatant, the cells were stained with 300 μl propidium iodide (Sigma, St. Louis, MO) for 30 min at 37 ℃ in a dark environment. CytoFLEX 5 (Beckman Coulter, Fullerton, CA) was used to record red fluorescence at an excitation wavelength of 488 nm to analyze the cell cycle.

FCM was used to detected abundance of cell-membrane surface marker. CD44 and CD133 antibodies were purchased from BioLegend (San Diego, CA) and used according to the manufacturer’s protocol. CytoFLEX 5 (Beckman Coulter, Fullerton, CA) was applied to record APC-Cy7 and PE panel signals to analyze CD44 and CD133 status.

RNA fluorescence in situ hybridization (FISH)

Cy3-labeled LINC01137 probes were purchased from RiboBio (Guangzhou, China). BxPC-3, CFPAC-1 and Panc-1 cells were fixed with 4% formaldehyde and permeabilized with 0.5% TritonX-100. The cells were then hybridized with Cy3-labeled probes. The nuclei were stained with DAPI. Images were acquired using a Zeiss LSM900 (Zeiss, Oberkochen, Germany).

Luciferase reporter assays

Wild-type (WT) and mutant (MUT) 3-UTRs of LINC01137 and KLF12 reporter plasmids were constructed by BioGene (Shanghai, China). Then, 293T cells were co-transfected with luciferase constructs and miR-7155-5p mimics, according to the manufacturer’s protocol. After transfection for 48 h, luciferase activity was measured using a dual-luciferase reporter assay kit (Vazyme). Each experiment was conducted in triplicates.

In vivo tumorigenicity model

Animal experiments were conducted with the approval of the Animal Ethics Committee of Ruijin Hospital, affiliated with the Shanghai Jiao Tong University School of Medicine (Shanghai, China). The pancreatic cancer cells were digested and suspended in cold PBS at a density of 10⁸ cells/ml. Approximately 100 μl of the cell suspension containing 10⁷ cells was injected subcutaneously into 4–5-week-old male BALB/c nude mice on the right side of the armpit. After almost a month, the tumors were harvested and analyzed.

In vivo limiting dilution assays

Pancreatic cancer cells were digested and suspended in cold PBS at a density of 10⁴–10⁷ cells/ml at four concentrations. Approximately 100 μl of cell suspension, containing 10³–10⁶ cells, was injected subcutaneously into 4–5-week-old male BALB/c nude mice on the right side of the armpit. After almost a month, the tumors were harvested and analyzed. CSC frequency assay was followed by previous research[39].

Bioinformatic analysis

The gene expression profiles and related clinical data of patients were retrieved and downloaded from The Cancer Genome Atlas (TCGA) database. Dataset GSE51971 was retrieved and downloaded from Gene Expression Omnibus (GEO) database. Dataset MTAB6690 was downloaded from ArrayExpress database. The Box plot and prognosis analysis about data from TCGA were plotted by GEPIA (http://gepia.cancer-pku.cn/index.html). The heatmap was plotted by http://www.bioinformatics.com.cn, a free online platform for data analysis and visualization. The potential subcellular localization of LINC01137 was predicted on lncLocator[40]. The microRNAs that are interacting with LINC01137 were predicted using DIANA[41], miRDB[42], and LNCSNP2 (http://bioinfo.life.hust.edu.cn/lncRNASNP#!/) datasets. The mRNAs that bind to miR-7155-5p were predicted through miRDB[42], miRWalk[43], miRPathDB[44], and TargetScan (http://www.targetscan.org/vert_71/) datasets.

Statistical analysis

Statistical analyses were performed using SPSS 20.0 and GraphPad Prism 8.0. Experiments were repeated independently at least three times and the results are presented as the means ± standard deviation (SD). One-way analysis of variance, Student’s t-test and chi-squared test were used to analyze the differences between different groups. Survival curves were analyzed using the Kaplan–Meier method, and log-rank tests were used to evaluate differences between the groups. Statistical significance was set at p < 0.05.

Supplementary Materials

Figure S1 Overexpression of LINC01137 in PDAC cell lines. Figure S2 LINC01137 promoted PDAC stemness and gemcitabine chemoresistance. Figure S3 LINC01137 promoted PDAC proliferation and cell cycle. Figure S4 LINC01137 regulated KLF12 through miR-7155-5p.

Ethics Statement and Consent to Participate

Studies using human tissues were reviewed and approved by the Committees for Ethical Review of Research involving Human Subjects of Ruijin Hospital affiliated with Shanghai Jiaotong University School of Medicine. The study was performed in accordance with the Declaration of Helsinki.

Consent for Publication

The study was undertaken with the patient’s consent.

Availability of data and material

The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.

Competing interests

The authors declare no potential conflicts of interest.

Funding

This work was supported by grants from the National Natural Science Foundation of China (82173226).

Author Contribution

Kexian Li and Zengyu Feng carried out in vivo and in vitro experiments, and manuscript preparation. Kexian Li and Kai Qin carried out statistical analysis, Yang Ma and Shiwei Zhao carried out qRT-PCR analysis, Peng Chen and Jiewei Lin carried out bioinformatics analysis, Yongsheng Jiang, Lijie Han, Yizhi Cao and Jiaxin Luo carried out IHC, Minmin Shi andHao Chen carried out clinical information about patients of PDAC sample, Jiancheng Wang, Lingxi Jiang and Chenghong Peng designed, supervised and interpreted the study.

Acknowledgements

The authors thank Xiaomei Tang, Jia Liu and Xiongyan Wu for experimental assistance.

Vincent A, Herman J, Schulick R, Hruban RH, Goggins M. Pancreatic cancer. Lancet. 2011; 378(9791):607-20.
Chen W, Zheng R, Baade PD, Zhang S, Zeng H, Bray F, et al. Cancer statistics in China, 2015. CA Cancer J Clin. 2016; 66(2):115-32.
Miller KD, Ortiz AP, Pinheiro PS, Bandi P, Minihan A, Fuchs HE, et al. Cancer statistics for the US Hispanic/Latino population, 2021. CA Cancer J Clin. 2021; 71(6):466-87.
Siegel RL, Miller KD, Fuchs HE, Jemal A. Cancer Statistics, 2021. CA Cancer J Clin. 2021; 71(1):7-33.
Cloyd JM, Katz MH, Prakash L, Varadhachary GR, Wolff RA, Shroff RT, et al. Preoperative Therapy and Pancreatoduodenectomy for Pancreatic Ductal Adenocarcinoma: a 25-Year Single-Institution Experience. J Gastrointest Surg. 2017; 21(1):164-74.
Murphy JE, Wo JY, Ryan DP, Jiang W, Yeap BY, Drapek LC, et al. Total Neoadjuvant Therapy With FOLFIRINOX Followed by Individualized Chemoradiotherapy for Borderline Resectable Pancreatic Adenocarcinoma: A Phase 2 Clinical Trial. JAMA Oncol. 2018; 4(7):963-9.
Reya T, Morrison SJ, Clarke MF, Weissman IL. Stem cells, cancer, and cancer stem cells. Nature. 2001; 414(6859):105-11.
Batlle E, Clevers H. Cancer stem cells revisited. Nat Med. 2017; 23(10):1124-34.
Chen J, Li Y, Yu T-S, McKay RM, Burns DK, Kernie SG, et al. A restricted cell population propagates glioblastoma growth after chemotherapy. Nature. 2012; 488(7412):522-6.
Martins-Neves SR, Paiva-Oliveira DI, Wijers-Koster PM, Abrunhosa AJ, Fontes-Ribeiro C, Bovée JVMG, et al. Chemotherapy induces stemness in osteosarcoma cells through activation of Wnt/β-catenin signaling. Cancer Lett. 2016; 370(2):286-95.
Yang L, Shi P, Zhao G, Xu J, Peng W, Zhang J, et al. Targeting cancer stem cell pathways for cancer therapy. Signal Transduct Target Ther. 2020; 5(1):8.
Jopling C, Boue S, Belmonte JCI. Dedifferentiation, transdifferentiation and reprogramming: three routes to regeneration. Nature Reviews Molecular Cell Biology. 2011; 12(2):79-89.
Mortezaee K. Hypoxia induces core-to-edge transition of progressive tumoral cells: A critical review on differential yet corroborative roles for HIF-1α and HIF-2α. Life Sci. 2020; 242(117145.
Mortezaee K, Majidpoor J. (Im)maturity in Tumor Ecosystem. Front Oncol. 2021; 11(813897.
Najafi M, Mortezaee K, Ahadi R. Cancer stem cell (a)symmetry & plasticity: Tumorigenesis and therapy relevance. Life Sci. 2019; 231(116520.
Ishay-Ronen D, Christofori G. Targeting Cancer Cell Metastasis by Converting Cancer Cells into Fat. Cancer Res. 2019; 79(21):5471-5.
Du Y, Yang H, Li Y, Guo W, Zhang Y, Shen H, et al. Long non‐coding RNA LINC01137 contributes to oral squamous cell carcinoma development and is negatively regulated by miR-22-3p. Cellular Oncology. 2021; 44(3):595-609.
Yao J, Chen X, Liu X, Li R, Zhou X, Qu Y. Characterization of a ferroptosis and iron-metabolism related lncRNA signature in lung adenocarcinoma. Cancer Cell Int. 2021; 21(1):340.
Liu B, Yang S. A Five Autophagy-Related Long Non-Coding RNA Prognostic Model for Patients with Lung Adenocarcinoma. Int J Gen Med. 2021; 14(7145-58.
Ren J, Wang A, Liu J, Yuan Q. Identification and validation of a novel redox-related lncRNA prognostic signature in lung adenocarcinoma. Bioengineered. 2021; 12(1):4331-48.
Nakamura K, Reid BM, Chen A, Chen Z, Goode EL, Permuth JB, et al. Functional analysis of the 1p34.3 risk locus implicates GNL2 in high-grade serous ovarian cancer. Am J Hum Genet. 2022; 109(1):116-35.
Bialkowska AB, Yang VW, Mallipattu SK. Krüppel-like factors in mammalian stem cells and development. Development. 2017; 144(5):737-54.
He Z, Guo X, Tian S, Zhu C, Chen S, Yu C, et al. MicroRNA-137 reduces stemness features of pancreatic cancer cells by targeting KLF12. J Exp Clin Cancer Res. 2019; 38(1):126.
He Z, Guo X, Tian S, Zhu C, Chen S, Yu C, et al. MicroRNA-137 reduces stemness features of pancreatic cancer cells by targeting KLF12. Journal of Experimental & Clinical Cancer Research. 2019; 38(1):126.
Cazet AS, Hui MN, Elsworth BL, Wu SZ, Roden D, Chan CL, et al. Targeting stromal remodeling and cancer stem cell plasticity overcomes chemoresistance in triple negative breast cancer. Nat Commun. 2018; 9(1):2897.
Wang T, Fahrmann JF, Lee H, Li YJ, Tripathi SC, Yue C, et al. JAK/STAT3-Regulated Fatty Acid β-Oxidation Is Critical for Breast Cancer Stem Cell Self-Renewal and Chemoresistance. Cell Metab. 2018; 27(1):136-50.e5.
Clara JA, Monge C, Yang Y, Takebe N. Targeting signalling pathways and the immune microenvironment of cancer stem cells - a clinical update. Nat Rev Clin Oncol. 2020; 17(4):204-32.
Xu X, Yu Y, Zong K, Lv P, Gu Y. Up-regulation of IGF2BP2 by multiple mechanisms in pancreatic cancer promotes cancer proliferation by activating the PI3K/Akt signaling pathway. J Exp Clin Cancer Res. 2019; 38(1):497.
Fitzgerald TL, Lertpiriyapong K, Cocco L, Martelli AM, Libra M, Candido S, et al. Roles of EGFR and KRAS and their downstream signaling pathways in pancreatic cancer and pancreatic cancer stem cells. Adv Biol Regul. 2015; 59(65-81.
Renz BW, Tanaka T, Sunagawa M, Takahashi R, Jiang Z, Macchini M, et al. Cholinergic Signaling via Muscarinic Receptors Directly and Indirectly Suppresses Pancreatic Tumorigenesis and Cancer Stemness. Cancer Discov. 2018; 8(11):1458-73.
Hou YS, Li X. Circ_0005273 induces the aggravation of pancreatic cancer by targeting KLF12. Eur Rev Med Pharmacol Sci. 2020; 24(22):11578-86.
Xun J, Wang C, Yao J, Gao B, Zhang L. Long Non-Coding RNA HOTAIR Modulates KLF12 to Regulate Gastric Cancer Progression via PI3K/ATK Signaling Pathway by Sponging miR-618. Onco Targets Ther. 2019; 12(10323-34.
Chen H, Wu C, Luo L, Wang Y, Peng F. circ_0000467 promotes the proliferation, metastasis, and angiogenesis in colorectal cancer cells through regulating KLF12 expression by sponging miR-4766-5p. Open Med (Wars). 2021; 16(1):1415-27.
Xu C, Shao Y, Liu J, Yao X, Quan F, Zhao Q, et al. Long non-coding RNA AGAP2-AS1 promotes proliferation and metastasis in papillary thyroid cancer by miR-628-5p/KLF12 axis. J Bioenerg Biomembr. 2021; 53(2):235-45.
Lin J, Zhai S, Zou S, Xu Z, Zhang J, Jiang L, et al. Positive feedback between lncRNA FLVCR1-AS1 and KLF10 may inhibit pancreatic cancer progression via the PTEN/AKT pathway. J Exp Clin Cancer Res. 2021; 40(1):316.
Zhai S, Xu Z, Xie J, Zhang J, Wang X, Peng C, et al. Epigenetic silencing of LncRNA LINC00261 promotes c-myc-mediated aerobic glycolysis by regulating miR-222-3p/HIPK2/ERK axis and sequestering IGF2BP1. Oncogene. 2021; 40(2):277-91.
Arun G, Diermeier SD, Spector DL. Therapeutic Targeting of Long Non-Coding RNAs in Cancer. Trends Mol Med. 2018; 24(3):257-77.
Hsiao J, Yuan TY, Tsai MS, Lu CY, Lin YC, Lee ML, et al. Upregulation of Haploinsufficient Gene Expression in the Brain by Targeting a Long Non-coding RNA Improves Seizure Phenotype in a Model of Dravet Syndrome. EBioMedicine. 2016; 9(257-77.
Hu Y, Smyth GK. ELDA: extreme limiting dilution analysis for comparing depleted and enriched populations in stem cell and other assays. J Immunol Methods. 2009; 347(1-2):70-8.
Lin Y, Pan X, Shen HB. lncLocator 2.0: a cell-line-specific subcellular localization predictor for long non-coding RNAs with interpretable deep learning. Bioinformatics. 2021.
Paraskevopoulou MD, Vlachos IS, Karagkouni D, Georgakilas G, Kanellos I, Vergoulis T, et al. DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts. Nucleic Acids Res. 2016; 44(D1):D231-8.
Chen Y, Wang X. miRDB: an online database for prediction of functional microRNA targets. Nucleic Acids Res. 2020; 48(D1):D127-d31.
Sticht C, De La Torre C, Parveen A, Gretz N. miRWalk: An online resource for prediction of microRNA binding sites. PLoS ONE. 2018; 13(10):e0206239.
Kehl T, Kern F, Backes C, Fehlmann T, Stöckel D, Meese E, et al. miRPathDB 2.0: a novel release of the miRNA Pathway Dictionary Database. Nucleic Acids Res. 2020; 48(D1):D142-d7.

Table 1 Primer sequence.

Primer	Sequence(5' to 3')
LINC01137-F	GTGATGCCACTCCCTAACCC
LINC01137-R	CCTTTGGCTTAGGGCATCCT
GAPDH-F	GGAGCGAGATCCCTCCAAAAT
GAPDH-R	GGCTGTTGTCATACTTCTCATGG
U6 RT Primer	CGCTTCACGAATTTGCGTGTCAT
U6-F	GCTTCGGCAGCACATATACTAAAAT
U6-R	CGCTTCACGAATTTGCGTGTCAT
hsa-miR-7155-5p-Rtprimer	GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGATGGC
hsa-miR-7155-5p-F	CGCGTCTGGGGTCTTGG
hsa-miR-7155-5p-R	AGTGCAGGGTCCGAGGTATT
hsa-miR-4664-5p-RTprimer	GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAACTTG
hsa-miR-4664-5p-F	TGGGGTGCCCACTCCG
hsa-miR-4664-5p-R	AGTGCAGGGTCCGAGGTATT
hsa-miR-765-RTprimer	GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCATCAC
hsa-miR-765-F	CGCGTGGAGGAGAAGGAAG
hsa-miR-765-R	AGTGCAGGGTCCGAGGTATT
KLF12-F	ATGTGATTTTGAGGGATGCAAC
KLF12-R	CAAATGATCTGACCGGGAAAAG

Table 2 Primary antibodies for western blotting.

Antibody	Company	Cat. No.	Species	Dilution
GAPDH	Proteintech	60004-1-Ig	Mouse	1:1000
p-AKT	Cell Signaling Technology	4060	Rabbit	1:2000
CD44	Proteintech	60224-1-Ig	Mouse	1:2000
Sox2	Cell Signaling Technology	3579	Rabbit	1:1000
Oct-4A	Cell Signaling Technology	2840	Rabbit	1:1000
p-Rb	Cell Signaling Technology	8516	Rabbit	1:1000
p21	Cell Signaling Technology	2947	Rabbit	1:1000
KLF12	Proteintech	13156-1-AP	Rabbit	1:1000
ALDH1A1	Cell Signaling Technology	54135	Rabbit	1:1000
NANOG	Cell Signaling Technology	4903	Rabbit	1:2000
Cyclin D3	Cell Signaling Technology	2936	Mouse	1:2000
CDK4	Cell Signaling Technology	12790	Rabbit	1:1000
AKT	Cell Signaling Technology	4685	Rabbit	1:1000

Table 3 Primary antibodies for IHC

Antibody	Company	Cat. No.	Species	Dilution
CD133	Proteintech	18470-1-AP	Rabbit	1:500
CD44	Proteintech	60224-1-Ig	Mouse	1:500
PCNA	Servicebio	GB11010	Rabbit	1:500

Table 4 MiRNA mimics and inhibitor, shRNA, and NC sequences.

Name	Nucleotide sequence (5' to 3')
hsa-miR-7155-5p inhibitor	GAUGGCCCAAGACCCCAGA
inhibitor NC	UCUACUCUUUCUAGGAGGUUGUGA
hsa-miR-7155-5p-mimics sense	UCUGGGGUCUUGGGCCAUC
hsa-miR-7155-5p-mimics antisense	UGGCCCAAGACCCCAGAUU
mimics NC sense	UCACAACCUCCUAGAAAGAGUAGA
mimics NC antisense	UCUACUCUUUCUAGGAGGUUGUGA
sh-LINC01137#1 sense	GGGTGAGAACCTACTTCTTCA
sh-LINC01137#1 antisense	TGAAGAAGTAGGTTCTCACCC
sh-LINC01137#2 sense	GCATCATGCATGTAACTTTCA
sh-LINC01137#2 antisense	TGAAAGTTACATGCATGATGC
sh-Control sense	TTCTCCGAACGTGTCACGT
sh-Control antisense	ACGTGACACGTTCGGAGAA

supplementalfigure.pdf

LINC01137 facilitate pancreatic cancer stemness via the miR-7155-5p/KLF12/AKT axis

Status:

Version 1

Abstract

Background

Results

Conclusion

Figures

Introduction

Results

Discussion

Conclusion

Materials And Methods

Declarations

References

Tables

Supplementary Files

Status:

Version 1