Exploring the presence of bovine leukemia virus among breast cancer tumors in a rural state

doi:10.21203/rs.3.rs-2070158/v1

Download PDF

Research Article

Exploring the presence of bovine leukemia virus among breast cancer tumors in a rural state

https://doi.org/10.21203/rs.3.rs-2070158/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 30 Jul, 2023

Read the published version in Breast Cancer Research and Treatment →

You are reading this latest preprint version

Purpose: The bovine leukemia virus (BLV) is a deltaretrovirus that causes malignant lymphoma and lymphosarcomas in cattle globally and has high prevalence among large scale U.S. dairy herds. Associations between presence of BLV DNA in human mammary tissue and human breast cancer incidence have been reported. We sought to estimate the prevalence of BLV DNA in breast cancer tissue samples in a rural state with an active dairy industry.

Methods: We purified genomic DNA from 56 fresh-frozen breast cancer tissue samples (51 tumor samples, 5 samples representing adjacent normal breast tissue) banked between 2016-2019. Using nested PCR assays, multiple BLV taxsequence primers and primers for the long terminal repeat (LTR) were used to detect BLV DNA in tissue samples and known positive control samples, including the permanently infected fetal lamb kidney cell line (FLK-BLV) and blood from BLV positive cattle.

Results: The median age of patients from which samples were obtained at the time of treatment was 60 (40-93) and all were female. Ninety percent of patients had invasive ductal carcinoma. The majority were poorly differentiated (60%). On PCR assay, none of the tumor samples tested positive for BLV DNA, despite having consistent signals in positive controls.

Conclusion: We did not find BLV DNA in fresh-frozen breast cancer tumors from patients presenting to a hospital in Vermont. Our findings suggest a low prevalence of BLV in our patient population and a need to reevaluate the association between BLV and human breast cancer.

Bovine Leukemia Virus

Oncogenic viruses

Oncogenesis

Breast Cancer

Associations between breast cancer and the consumption of animal products have been reported in numerous studies [1–16], but the causal role of dietary factors remains unclear. Bovine meat and dairy contain high dietary saturated fats, [2, 4, 17–25], hormones (e.g. estrogen and progesterone) [14, 26–30], growth factors [31–38], and chemical contaminants [39–47] that could promote proliferation of human cancer cells. Another possible (and potentially synergistic) link is zoonotic infections including—but not limited to—the bovine leukemia virus (BLV) [48–59].

BLV is a deltaretrovirus, first isolated in 1969, and subsequently demonstrated to be the causal agent of enzootic bovine leucosis (EBL) characterized by B cell lymphocytosis, lymphoma, and malignant lymphosarcomas [54, 60, 61]. BLV encodes a viral trans-activating protein, tax, which is required for the experimental induction of malignancy and alteration of host cell gene expression and proliferation [62, 63]. In the U.S. approximately 38% of beef herds, 84% of dairy herds, and 100% of large-scale dairy operation herds are infected with BLV [64, 65].

Several studies report positive associations between BLV DNA in breast tissue and incident breast cancer. In a case-control study analyzing breast tissue from patients in multiple U.S. states, BLV DNA was found in the mammary epithelium of cancer patients more often than in cancer-free controls (multivariable odds ratio: 3.07 (95% CI: 1.66, 5.69) [66]. In an Australian case-control study, BLV DNA was found in 80% of women with breast cancer versus 41% of women with no history of breast cancer, resulting in an age-adjusted odds ratio of 4.72 (1.71, 13) [56]. A recent study of breast tissue collected at MD Anderson (Houston, Texas) likewise demonstrated an increased association of BLV tax DNA in the breast tissue of women diagnosed with breast cancer and reported an age/ethnicity-adjusted odds ratio of 5.9 (2.8, 12) [57]. A recent systematic review and meta-analysis of 9 studies from the U.S., Australia, Iran, Colombia, and Brazil found that identifying BLV infection conferred an increased odds of breast cancer (OR = 2.57, 95% CI: 1.45, 4.56) [59]. Despite the associations reported in these studies, there is also data to the contrary. Gillet et al. performed whole genome sequencing of 51 cancer tissue samples and adjacent mammary tissue obtained from the NCBI Database of Genotype and Phenotype (dbGaP) and did not find any pairing with BLV variants [67]. Adekanmbi et al. assessed presence of BLV in 238 blood-derived samples from breast cancer patients. Using both Fluorescence Resonance Energy Transfer PCR and whole genome sequencing in a subset of patients, no BLV proviral DNA was detected [68]. Similarly, Zhang et al. was unable to detect BLV in breast cancer tissue among 91 samples from Chinese women from provinces with reported high prevalence of bovine BLV infection [69]. Thus, the potential role of BLV in human breast cancer remains unclear and controversial.

Between 2009 and 2013, Vermont females had a slightly higher incidence of breast cancer (128.3 cases per 100,000 population) compared with U.S. females overall (122.9 cases per 100,000 population) [70]. However, the prevalence of BLV in Vermont female breast cancer has not been investigated despite the state’s large dairy cattle industry. The objective of this study was to estimate the prevalence of BLV DNA within breast cancer tumors from patients residing in Vermont through analysis of fresh-frozen tumor tissue from our local tumor biobank.

This study was approved by the University of Vermont Cancer Center Protocol Review and Monitoring Committee and the University of Vermont Institutional Review Board (Study ID: 00000564).

Sample acquisition and Data Collection

Tissue samples were obtained from the University of Vermont Cancer Center Tissue Bank, under IRB approved protocols for tissue procurement and biobanking. Samples are linked to clinical and pathology data from electronic medical records. We identified patients with a diagnosis of invasive breast cancer who underwent surgical excision between 2015 and 2019 and had adequate tissue banked for analysis. We excluded patients who received neoadjuvant chemotherapy. We collected fresh-frozen breast tumor samples from 30 patients, selected at random from the set of eligible cases. All patient samples included tumor tissue, and 16 also included adequate amounts of adjacent fresh-frozen normal tissue from the operated breast. Basic demographic, clinical, and tumor data were collected for all 30 breast cancer patients including age, sex, histologic subtype, grade, receptor status, and stage.

Sample processing and evaluation

Tissue samples (approximately 25 mg per sample) were thawed on ice and then subjected to genomic DNA purification using the MagMax DNA Multi-Sample Kit (Applied Biosystems, ThermoFisher Scientific, Waltham, MA) according to manufacturer’s recommendations. Genomic DNA from seropositive and seronegative bovine whole blood samples (300 µL) were purified in the same manner. Whole blood samples were obtained from cattle from the University of Vermont teaching and research herd in accordance with Institutional Animal Care and Use Committee-approved procedures (protocol 08–099). At the time of sampling this herd had a known history of enzootic bovine leukosis (28% BLV positive by enzyme-linked immunosorbent assay (ELISA) testing annually). Individual serum samples of adult lactating cows were submitted to the Cornell University College of Veterinary Medicine Animal Health Diagnostic Center (Ithaca, NY) for ELISA testing. Whole blood samples (1 mL aliquots) were collected in parallel with serum collection and stored at either 4°C or -20°C until DNA extraction. Additional positive control genomic DNA was prepared from the persistently BLV-infected fetal lamb kidney cell line, FLK-BLV [71]. Extracted DNA concentrations were measured using a NanoDrop 2000 spectrophotometer (ThermoFisher Scientific, Waltham, MA). Quality of extracted human DNA was confirmed by amplification of human glyceraldehyde-3-phosphate dehydrogenase (GAPDH) genomic sequences [54].

Nested PCR (nPCR), as described by Buehring et al, was used to detect BLV sequences in extracted DNA samples.[54] Briefly, extracted genomic DNA template (100 ng) was combined with 0.2µM of outer amplicon forward and reverse primers (Table 1 and Fig. 1) in a reaction mixture containing 0.4 mM dNTPs, 4 mM MgCl₂, and 0.05 U/µL of Taq Polymerase (supplied as DreamTaq Hot Start Green Mastermix, ThermoFisher Scientific, Waltham, MA) in a final volume of 50 µL. Cycling parameters were consistent with those described by Buehring et al, with the addition of an initial hot start step (3 minutes at 95°C) prior to cycling to activate the DreamTaq Hot Start enzyme.[54] Upon completion of cycling of the outer amplification reaction, 2µL of outer nPCR reactions was removed and added to 48µL of PCR reaction mix containing 0.2µM of inner amplicon forward and reverse primers. Amplification of target sequences was monitored by 1% Agarose TBE electrophoresis, loading 20µL of inner amplification reactions and running at 80V for 60 minutes. Gels were imaged on a BioRad ChemiDoc XRS digital imaging system and analyzed using BioRad ImageLab software (BioRad, Hercules, CA).

To establish tax nPCR sensitivity, FLK-BLV gDNA was serially diluted (1 ng per reaction, diluted 4-fold) and subjected to nPCR (tax Amplicon A), as described above. Based on these sensitivity evaluations, 50 pg of FLK-BLV genomic DNA was used as a template for positive controls. (Supplemental Fig. 1).

Table 1

Primers and annealing conditions used for nPCR
Primer Name	Target Gene	Primer Sequence (5'-3')	Annealing Temperature (°C)	Role
GAPDH Fwd	Human GAPDH	GAGTCAACGGATTTGGTCGT	50	Used to confer extracted human DNA quality
GAPDH Rev	Human GAPDH	TTGATTTTGGAGGGATCTCG	50	Used to confer extracted human DNA quality
tax Fwd 1	BLV tax	CTTCGGGATCCATTACCTGA	55	Used as outer primer pair for tax nPCR Amplicon A, and Tax nPCR Amplicon C
tax Rev 1	BLV tax	GCTCGAAGGGGGAAAGTGAA	55
tax Fwd 2	BLV tax	ATGTCACCATCGATGCCTGG	55	Used as outer primer pair for tax nPCR Amplicon B, and inner primer pair for tax nPCR Amplicon C
tax Rev 2	BLV tax	CATCGGCGGTCCAGTTGATA	55
tax Fwd 3	BLV tax	GGCCCCACTCTCTACATGC	56	Used as inner primer pair for tax nPCR Amplicon A, and Tax nPCR Amplicon B
tax Rev 3	BLV tax	AGACATGCAGTCGAGGGAAC	56
LTR Fwd 1	BLV LTR	TAGGAGCCGCCACCGC	57	Used as outer primer pair for LTR nPCR Amplicon
LTR Rev 1	BLV LTR	GCGGTGGTCTCAGCCGA	57	Used as outer primer pair for LTR nPCR Amplicon
LTR Fwd 2	BLV LTR	AAACTGCAGCGTAAACCAGACAGAGACG	58	Used as outer primer pair for LTR nPCR Amplicon
LTR Rev 2	BLV LTR	CACCCTCCAAACCGTGCTTG	58	Used as outer primer pair for LTR nPCR Amplicon

Statistical Analysis

Initial sample size requirements were estimated based on reported proportions of BLV positive patients in Beuhring et al. [55], which estimated 30% BLV positive in the control group and 60% positive in the cancer group. Our sample size of 30 afforded 99% power to detect a prevalence proportion of 30% against a null hypothesis of 1%.

After initial samples from 20 patients yielded no positive results, we calculated the probability of receiving all negative results with conservative assumed true prevalence of 10%, and determined that testing 30 samples would yield an approximately 4% probability of observing all negative results. Under an assumed true prevalence of 30%, this probability was 2.3 x 10^− 5.

The median patient age was 60 (range: 40–93). The majority (90%) of tissue diagnoses were invasive ductal adenocarcinoma, with the remaining classified as invasive lobular carcinoma. Three (10%) were ductal carcinoma with lobular features with one sample diagnosed as both invasive lobular and ductal adenocarcinomas (Table 2). This comports with estimates from the American Cancer Society that approximately 80% of invasive breast cancers present as invasive ductal carcinoma [72].

Table 2

Patient Characteristics
Characteristics		Result
Age at diagnosis, years, median (range)			60 (40–93)
Sex, n (%)
Female			30 (100.0)
Male			0 (0.0)
Year of Diagnosis
2015			4 (13.3)
2016			3 (10.0)
2017			3 (10.0)
2018			10 (33.3)
2019			10 (33.3)
Histologic Subtype
Invasive Ductal			27 (90.0)
Invasive Lobular			3 (10.0)
Other
Differentiation
Well			1 (3.6)
Moderate			9 (32.1)
Poor			18 (64.2)
Not specified			2
Receptor Status
Estrogen Receptor Positive			27 (90.0)
Progesterone Receptor Positive			26 (86.7)
HER2 Positive			20 (66.7)
Triple Negative Receptor Status			1 (3.3)
Stage
T1			10 (30.0)
T2			17 (56.7)
T3			3 (10.0)
T4			0 (0.0)
N0			17 (56.7)
N1mi			2 (6.7)
N1			7 (23.3)
N2			2 (6.7)
N3			2 (6.7)

In our cohort, 36.7% of patients had regional disease. This is higher than the reported rate in Vermont of 20% [70] and may reflect the more aggressive histology seen in our sample. Histologically, 59.3% of tumors were classified as poorly differentiated, 33.3% as moderately differentiated, and 7.4% as well differentiated. Estrogen, progesterone, and HER2 receptor positivity was found in 90.0, 86.6 and 66.7% of tumor samples, respectively (Table 2). This compares with the reported rates in Vermont in which 78% of breast cancers express hormone receptors and 13% overexpress HER2 with 9% of tumors classified as triple negative expression. Therefore, our sample tended towards more hormone receptor positivity and HER2 overexpression compared with the reported rates [70].

Nested PCR detected no BLV DNA sequences in all samples from 30 patients—whether from tumor or adjacent tissue—despite achieving positive signals in positive control specimens (FLK) and in blood samples from BLV-ELISA positive cows (Fig. 2). Known negative controls, including blood samples from BLV-ELISA negative cows, tested negative as expected. Based on sensitivity evaluations, a positive result was achieved requiring less than 15 pg of template for detection (Supplemental Fig. 1). This limit of detection, based on the observation that the sheep genome is ~ 2.61 Gbp (2.86 pg per cell) [73] and each FLK-BLV cell contains 4 proviral copies [71], corresponds to between 2 and 10 copies of provirus target, equivalent to approximately a single infected cell or a small number of cells containing provirus in a tumor mass.

In assessing BLV strain phylogeny from Polat et al, we identified prominent strains isolated from the U.S. and performed sequence alignments of these isolates using Clustal Omega (European Molecular Biology Laboratory's European Bioinformatics Institute). [74, 75] To account for polymorphisms in critical priming regions, we applied different primer combinations in nested PCR as indicated in Table 1 and Fig. 1. This included primers to amplify both the tax sequence as well as the viral LTR sequence. Similarly, no positive cases were detected.

Our initial study planning, based on values in published studies, assumed prevalence of BLV in breast tumors of 30%. Even at an assumed 10% true prevalence, we calculated that with our sample size of 30, there would only be a 4.2% probability of having no samples positive for BLV by chance alone.

Given the lack of detection of BLV in our samples, we could not carry out analyses associating presence of BLV DNA with any of the clinical or pathologic features of the breast tumors.

Prior literature has suggested an association between BLV and breast cancer risk. The published record includes a systematic review and meta-analysis, [59] and multiple case-control studies [54–58, 66, 76]. However, similar studies have concluded that there is no association of BLV with human breast cancers [67–69]. We therefore sought to determine the presence of BLV in breast cancer tissue in Vermont, a highly agriculture state with an active dairy industry and an established presence of BLV in cows in the region.

Basing our methods on previously documented approaches [54], we initially tested tumor samples for amplification of the BLV tax gene. This gene was chosen because trans-activating region of the X-gene (tax) is thought to play a mechanistic role in oncogenesis [77]. Furthermore, the genomic region occupied by tax is highly conserved with little variation in sequence [78] and tends to remain detectable even in advanced phases of the disease when other regions of the viral genome are deleted [79]. Therefore, the viral tax DNA sequence that has been inserted into the host genome provides a stable target for assessing the presence of mammary cell infection [57].

Since our tissue samples showed no amplification of BLV genetic signatures, we sought to address any technical reasons for this lack of signal. To account for the possibility that these results could be due to difference in the particular tax gene sequence preventing identification of the tax gene with the initial primers used, we assessed BLV strain phylogeny from Polat et al, to identify prominent strains isolated within the U.S. and performed sequence alignments of these isolates using Clustal Omega (European Molecular Biology Laboratory's European Bioinformatics Institute) [74, 75]. We applied different primer combinations as outlined in Table 1 and Fig. 2 to account for polymorphisms in critical priming regions that could have accounted for our initial negative results. We furthermore tested for BLV LTR sequence, which plays an important role in controlling viral gene expression [80] and has been shown, along with the tax region, to be highly conserved [81–83].

Consistently negative results using this variety of primers for tax and LTR along with confirmatory testing of our positive and negative controls and the finding of expected results in known seronegative and seropositive bovine blood suggest that our assay was both sensitive and specific for BLV. In particular, we were able to accurately identify presence/absence of BLV in locally-sourced bovine samples, which would most likely reflect the genetic variation of BLV that could be identified in the corresponding human population in Vermont. One potential limitation is that no positive control was based on a fresh-frozen tissue source. However, DNA concentrations were confirmed for extractions from different sources (cell lines, bovine blood, and fresh frozen tissue) and DNA was purified in a manner that we would not expect to be sensitive to type of source material. Furthermore, the quality of extracted tissue DNA was successfully confirmed by amplification of the gylceraldehyded-3-phosphate dehydrogenase (GAPDH) gene sequence.

Additional confirmatory testing could be considered using other modalities aside from PCR, such as immunohistochemistry (IHC) or in situ hybridization (ISH), but neither of these methods approaches the detection limits of nPCR. IHC also requires viral antigens and would be predicated on active infection, while nPCR detects either active or latent BLV [84, 85]. While a novel technique using ISH to identify AS1 (a non-coding RNA derived from the BLV genome) has been described on formalin-fixed paraffin-embedded (FFPE) tissue samples from cattle infected with BLV, this technique has not yet been validated in human mammary tissue [85].

Another potential limitation of this study is its low sample size and the corresponding possibility that we achieved all negative results by chance. However, assuming no measurement error, there is a very low probability that all the breast cancer tissue samples would be truly negative under a variety of plausible prevalence assumptions. For example, assuming 30% BLV DNA prevalence in breast tumor tissue, the binomial probability of obtaining 30 negative specimens is ~ 0.0023%. Under an assumed prevalence of 10%—which is much lower than prevalence estimates from earlier studies—the binomial probability of obtaining 30 negative specimens is 4.2%. This could indicate a lower true prevalence in Vermont than that reported from other locales, again assuming no measurement error. Alternatively, it could suggest that early studies have overestimated the prevalence in breast tissue and therefore that our initial assumptions should have been based on a lower prevalence of BLV DNA in breast tissue.

While we might postulate that our negative results for BLV in human mammary tissue may be due to a low prevalence in cattle, analysis of USDA data show a high prevalence of BLV in northeast dairy herds, with 87% of herds infected and 40% of milk cows infected [86, 87]. These numbers suggest that Vermont likely does not have low BLV infection rates relative to other regions, though this could potentially vary based on the size of the herds. Sequence variations in the BLV LTR region and tax gene are associated with promoter activity [80], which could affect viral loads and transmissibility in BLV-infected cattle at a regional level, but it is unlikely that such these small variations could preclude zoonotic transmissions in different regions of the U.S.

Our results are concordant with other negative findings in the literature that conclude that there is no apparent association of human breast cancers with BLV infection. As noted, Zhang et al. reported an inability to detect BLV in breast cancer tissue among 91 tissue samples from Chinese women whereas 50% of cattle blood samples had detectable BLV by PCR [69]. Gillet et al. assessed whole genome sequences of 51 breast cancer tissue samples along with adjacent mammary tissue obtained from the NCBI Database of Genotype and Phenotype (dbGaP). Whole genome sequencing did not find any pairing with five different BLV variants [67]. Whole genome analysis was performed to exclude “clonal integration of natural and highly divergent BLV strains in breast tumors.” Their findings did not support an association between BLV and breast cancer [67]. A recent study on 238 samples from the Alabama Hereditary Cancer Cohort FRET PCR and whole genome sequencing to detect the presence of BLV infection in association with human breast cancer, and no BLV DNA was detected [68]. Likewise, our analysis does not support an association of BLV infection or the presence of BLV DNA or highly conserved BLV sequences with human breast cancers.

While, studies have shown animals aside from cattle to be host for BLV, including livestock such as sheep and buffalo [88], BLV has been absent from other animals, such as camels [89, 90]. Therefore, the ability of BLV to infect humans does require scrutiny. There are well-characterized biological mechanisms that preclude cross-species virus transmission, mechanisms originally identified in retroviral systems. These include a variety of restriction factors that effectively block virus replication in cells even from closely related species, such as human and non-human primates [91]. There are additional biological constraints to human BLV infection. BLV is highly cell-associated; that is, infection requires the transfer of infected B lymphocytes from one host to another. Natural infections of cattle and water buffalo require parenteral transfer of blood by biting insects, cross contamination during veterinary procedures, or vertical lymphocyte transfer during parturition or in milk. Experimental infections of alternate hosts requires parenteral transfer of sufficient numbers of infected bovine lymphocytes from lymphocytic animals or high doses of cell-free virus. The infected lymphocytes and cell-free virus particles are sensitive to heat and desiccation. Pasteurization would inactivate infectious BLV in milk for human consumption, and extensive epidemiological studies have shown no association between milk consumption and leukemia in people drinking raw milk from infected cattle [92]. In addition to innate cellular restrictions and required modes of transmission, there is the question of cell tropism. BLV tropism for B cells is well described with potential implications for other leukocyte populations [93]. However, the ability of BLV to infect epithelial cells rather than lymphocytes upon zoonotic infection and the induction of carcinoma rather than lymphoma would require divergent receptors on the surfaces of these cell types in these mammalian species as the viral glycoproteins are largely unchanged. These hypothetical factors do not preclude the possibility of BLV induction of human breast cancer. However, these mechanisms are consistent with data sets such as ours that do not find a link between BLV DNA and human breast cancer as we see with the enzootic BLV infection and its resultant malignancy in cattle.

Our study does not support a high prevalence of BLV in breast tumor tissue, decreasing support for a potential association of BLV with breast cancer. Given contradictory studies of what would be a preventable cause of breast cancer, a cross-institutional study applying a variety of techniques to allow for sufficient confirmatory testing would be ideal to settle discrepant findings on the prevalence of BLV DNA in mammary tissue and its association with breast cancer.

FUNDING

This work was supported by the Northern New England Clinical Oncology Society (NNECOS) student project grant.

ACKNOWLEDGEMENTS

We would like to acknowledge Mark Evans and Christine Adamson from the Cancer Center Biobank and University of Vermont Department of Pathology for their assistance with identification and acquisition of breast cancer samples.

CONFLICT OF INTEREST

The authors disclose no conflicts of interest, financial or otherwise, that may influence or impart bias upon the results of this work.

AUTHOR CONTRIBUTIONS

Stas Amato and Jessica Cintolo-Gonzalez contributed to study conception. All authors contributed to study design. Material preparation and data collection was performed by Jon Ramsey and Jon Barlow. Data analysis was performed by Jon Ramsey, Jon Barlow, and Thomas Ahern. Stas Amato and Jessica Cintolo-Gonzalez wrote the first draft of the manuscript and all authors commented on and contributed to previous versions of the manuscript. All authors read and approved of the final manuscript.

Rose DP (1986) Dietary factors and breast cancer. Cancer Surv 5:671–687
Lê MG, Moulton LH, Hill C et al (1986) Consumption of Dairy Produce and Alcohol in a Case-Control Study of Breast Cancer. JNCI J Natl Cancer Inst 77:633–636. doi:10.1093/jnci/77.3.633
Richardson S, Gerber M, Cenée S (1991) The role of fat, animal protein and some vitamin consumption in breast cancer: a case control study in southern France. Int J Cancer 48:1–9. doi:10.1002/ijc.2910480102
Stefani ED, Ronco A, Mendilaharsu M et al (1997) Meat intake, heterocyclic amines, and risk of breast cancer: a case-control study in Uruguay. Cancer Epidemiol Prev Biomark 6:573–581
Cho E, Chen WY, Hunter DJ et al (2006) Red Meat Intake and Risk of Breast Cancer Among Premenopausal Women. Arch Intern Med 166:2253–2259. doi:10.1001/archinte.166.20.2253
Taylor EF, Burley VJ, Greenwood DC et al (2007) Meat consumption and risk of breast cancer in the UK Women’s Cohort Study. Br J Cancer 96:1139–1146. doi:10.1038/sj.bjc.6603689
Taylor VH, Misra M, Mukherjee SD (2009) Is red meat intake a risk factor for breast cancer among premenopausal women? Breast Cancer Res Treat 117:1–8. doi:10.1007/s10549-009-0441-y
Fu Z, Deming SL, Fair AM et al (2011) Well-done meat intake and meat-derived mutagen exposures in relation to breast cancer risk: the Nashville Breast Health Study. Breast Cancer Res Treat 129:919–928. doi:10.1007/s10549-011-1538-7
Farvid MS, Cho E, Chen WY et al (2015) Adolescent meat intake and breast cancer risk. Int J Cancer 136:1909–1920. doi:10.1002/ijc.29218
Guo J, Wei W, Zhan L (2015) Red and processed meat intake and risk of breast cancer: a meta-analysis of prospective studies. Breast Cancer Res Treat 151:191–198. doi:10.1007/s10549-015-3380-9
Farvid MS, Sidahmed E, Spence ND et al (2021) Consumption of red meat and processed meat and cancer incidence: a systematic review and meta-analysis of prospective studies. Eur J Epidemiol Published Online First: 29 August. doi:10.1007/s10654-021-00741-9
Kakkoura M, Du H, Key T et al (2021) Dairy Consumption and Risk of Cancer: An 11 Year Prospective Cohort Study of the China Kadoorie Biobank. Curr Dev Nutr 5:1046. doi:10.1093/cdn/nzab053_039
Kaluza J, Komatsu S, Lauriola M et al (2021) Long-term consumption of non-fermented and fermented dairy products and risk of breast cancer by estrogen receptor status – Population-based prospective cohort study. Clin Nutr 40:1966–1973. doi:10.1016/j.clnu.2020.09.013
Ji J, Sundquist J, Sundquist K (2015) Lactose intolerance and risk of lung, breast and ovarian cancers: aetiological clues from a population-based study in Sweden. Br J Cancer 112:149–152. doi:10.1038/bjc.2014.544
Outwater JL, Nicholson A, Barnard N (1997) Dairy products and breast cancer: the IGF-I, estrogen, and bGH hypothesis. Med Hypotheses 48:453–461. doi:10.1016/S0306-9877(97)90110-9
Sasaki S, Horacsek M, Kesteloot H (1993) An Ecological Study of the Relationship between Dietary Fat Intake and Breast Cancer Mortality. Prev Med 22:187–202. doi:10.1006/pmed.1993.1016
Ishimoto H, Nakamura H, Miyoshi T (1994) Epidemiological study on relationship between breast cancer mortality and dietary factors. Tokushima J Exp Med 41:103–114
Cho E-Y (2003) Fat intake and breast cancer: a review. Int J Hum Ecol 4:101–106
Cho E, Spiegelman D, Hunter DJ et al (2003) Premenopausal Fat Intake and Risk of Breast Cancer. JNCI J Natl Cancer Inst 95:1079–1085. doi:10.1093/jnci/95.14.1079
Reddy GK, Tripathy D (2005) Dietary Fat Reduction Improves Relapse-Free Survival in Postmenopausal Women Previously Treated for Early-Stage Breast Cancer: Results from a Phase III Women’s Intervention Nutrition Study. Clin Breast Cancer 6:112–114. doi:10.1016/S1526-8209(11)70708-X
Turner LB (2011) A meta-analysis of fat intake, reproduction, and breast cancer risk: An evolutionary perspective. Am J Hum Biol 23:601–608. doi:10.1002/ajhb.21176
Khodarahmi M, Azadbakht L (2014) The Association Between Different Kinds of Fat Intake and Breast Cancer Risk in Women. Int J Prev Med 5:6–15
Brennan SF, Woodside JV, Lunny PM et al (2017) Dietary fat and breast cancer mortality: A systematic review and meta-analysis. Crit Rev Food Sci Nutr 57:1999–2008. doi:10.1080/10408398.2012.724481
Chlebowski RT, Aragaki AK, Anderson GL et al (2017) Low-Fat Dietary Pattern and Breast Cancer Mortality in the Women’s Health Initiative Randomized Controlled Trial. J Clin Oncol 35:2919–2926. doi:10.1200/JCO.2016.72.0326
Kroenke CH, Kwan ML, Sweeney C et al (2013) High- and Low-Fat Dairy Intake, Recurrence, and Mortality After Breast Cancer Diagnosis. JNCI J Natl Cancer Inst 105:616–623. doi:10.1093/jnci/djt027
Nachman KE, Smith TJS (2015) Hormone Use in Food Animal Production: Assessing Potential Dietary Exposures and Breast Cancer Risk. Curr Environ Health Rep 2:1–14. doi:10.1007/s40572-014-0042-8
Farlow DW, Xu X, Veenstra TD (2009) Quantitative measurement of endogenous estrogen metabolites, risk-factors for development of breast cancer, in commercial milk products by LC–MS/MS. J Chromatogr B 877:1327–1334. doi:10.1016/j.jchromb.2009.01.032
Ganmaa D, Sato A (2005) The possible role of female sex hormones in milk from pregnant cows in the development of breast, ovarian and corpus uteri cancers. Med Hypotheses 65:1028–1037. doi:10.1016/j.mehy.2005.06.026
Yager JD, Davidson NE (2006) Estrogen Carcinogenesis in Breast Cancer. N Engl J Med 354:270–282. doi:10.1056/NEJMra050776
Collier RJ, Miller MA, Hildebrandt JR et al Factors Affecting Insulin-Like Growth Factor-I Concentration in Bovine Milk. J Dairy Sci 199 1;7 4:2905–11. do i:10.3168/jds.S0022-0302(91)78473-7
Gauthier SF, Pouliot Y, Maubois J-L Growth factors from bovine milk and colostrum: composition, extraction and biological activities. Le Lait 200 6;8 6:99–125. do i:10.1051/lai t:2005048
Guimont C, Marchall E, Girardet JM et al (2009) Biologically active factors in bovine milk and dairy byproducts: Influence on cell culture. Crit Rev Food Sci Nutr Published Online First: 29 September. doi:10.1080/10408399709527780
Purup S, Vestergaard M, Pedersen LO et al. Biological activity of bovine milk on proliferation of human intestinal cells.J Dairy Res200 7;7 4:58–65. do i:10.1017/S0022029906002093
Akbache A, Lamiot É, Moroni O et al (2009) Use of membrane processing to concentrate TGF-β2 and IGF-I from bovine milk and whey. J Membr Sci 326:435–440. doi:10.1016/j.memsci.2008.10.026
Donovan SM, Odle J Growth Factors in Milk as Mediators of Infant Development. Annu Rev Nutr 199 4;1 4:147–67. do i:10.1146/annurev.nu.14.070194.001051
Rogers I, Emmett P, Gunnell D et al (2006) Milk as a food for growth? The insulin-like growth factors link. Public Health Nutr 9:359–368. doi:10.1079/PHN2006853
Schams D (1994) Growth factors in milk. Endocr Regul 28:3–8
McCarthy WP, O’Callaghan TF, Danahar M et al (2018) Chlorate and Other Oxychlorine Contaminants Within the Dairy Supply Chain. Compr Rev Food Sci Food Saf 17:1561–1575. doi:10.1111/1541-4337.12393
Bacanlı M, Başaran N (2019) Importance of antibiotic residues in animal food. Food Chem Toxicol Int J Publ Br Ind Biol Res Assoc 125:462–466. doi:10.1016/j.fct.2019.01.033
Charnley G, Doull J (2005) Human exposure to dioxins from food, 1999–2002. Food Chem Toxicol 43:671–679. doi:10.1016/j.fct.2005.01.006
Holland RD, Gehring T, Taylor J et al Formation of a mutagenic heterocyclic aromatic amine from creatinine in urine of meat eaters and vegetarians. Chem Res Toxicol 200 5;1 8:579–90. do i:10.1021/tx049675w
Steck SE, Gaudet MM, Eng SM et al (2007) Cooked meat and risk of breast cance–-lifetime versus recent dietary intake. Epidemiol Camb Mass 18:373–382. doi:10.1097/01.ede.0000259968.11151.06
Rohrmann S, Lukas Jung S-U, Linseisen J et al (2009) Dietary intake of meat and meat-derived heterocyclic aromatic amines and their correlation with DNA adducts in female breast tissue. Mutagenesis 24:127–132. doi:10.1093/mutage/gen058
Lauber SN, Ali S, Gooderham NJ (2004) The cooked food derived carcinogen 2-amino-1-methyl-6-phenylimidazo[4,5-b] pyridine is a potent oestrogen: a mechanistic basis for its tissue-specific carcinogenicity. Carcinogenesis 25:2509–2517. doi:10.1093/carcin/bgh268
Lauber SN, Gooderham NJ (2011) The cooked meat-derived mammary carcinogen 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine promotes invasive behaviour of breast cancer cells. Toxicology 279:139–145. doi:10.1016/j.tox.2010.10.004
Sinha R, Gustafson DR, Kulldorff M et al. 2-Amino-1-methyl-6-phenylimidazo[4,5-b]pyridine, a carcinogen in high-temperature-cooked meat, and breast cancer risk.J Natl Cancer Inst200 0;9 2:1352–4. do i: 10.1093/jnci/92.16.1352
Zhang W, Li L, Deng X et al What is for dinner? Viral metagenomics of US store bought beef, pork, and chicken. Virology 201 4;468–47 0:303–10. do i:10.1016/j.virol.2014.08.025
Zhang X, Zhang Z, Zheng B et al (2013) An update on viral association of human cancers. Arch Virol 158:1433–1443. doi:10.1007/s00705-013-1623-9
Peretti A, FitzGerald PC, Bliskovsky V et al (2015) Hamburger polyomaviruses. J Gen Virol 96:833–839. doi:10.1099/vir.0.000033
zur Hausen H (2001) Proliferation-inducing viruses in non-permissive systems as possible causes of human cancers. Lancet Lond Engl 357:381–384. doi:10.1016/S0140-6736(00)03652-7
Zur Hausen H The search for infectious causes of human cancers: where and why. Virology 200 9;39 2:1–10. do i:10.1016/j.virol.2009.06.001
zur Hausen H, de Villiers E-M (2015) Dairy cattle serum and milk factors contributing to the risk of colon and breast cancers. Int J Cancer 137:959–967. doi:10.1002/ijc.29466
Buehring GC, Shen HM, Jensen HM et al (2014) Bovine leukemia virus DNA in human breast tissue. Emerg Infect Dis 20:772–782. doi:10.3201/eid2005.131298
Buehring GC, Shen HM, Jensen HM et al (2015) Exposure to Bovine Leukemia Virus Is Associated with Breast Cancer: A Case-Control Study. PLoS ONE 10:e0134304. doi:10.1371/journal.pone.0134304
Buehring GC, Shen H, Schwartz DA et al (2017) Bovine leukemia virus linked to breast cancer in Australian women and identified before breast cancer development. PLoS ONE 12:e0179367. doi:10.1371/journal.pone.0179367
Baltzell KA, Shen HM, Krishnamurthy S et al (2018) Bovine leukemia virus linked to breast cancer but not coinfection with human papillomavirus: Case-control study of women in Texas. Cancer 124:1342–1349. doi:10.1002/cncr.31169
Khalilian M, Hosseini SM, Madadgar O (2019) Bovine leukemia virus detected in the breast tissue and blood of Iranian women. Microb Pathog 135:103566. doi:10.1016/j.micpath.2019.103566
Khatami A, Pormohammad A, Farzi R et al (2020) Bovine Leukemia virus (BLV) and risk of breast cancer: a systematic review and meta-analysis of case-control studies. Infect Agent Cancer 15:48. doi:10.1186/s13027-020-00314-7
Burny A, Cleuter Y, Kettmann R, Mannerick M, Marbaix G, Portetelle D, Van den Willems BA, Thomas L (1987) Bovine leukaemia: facts and hypotheses derived from the study of an infectious cancer. Cancer Surv 6:139–159
Olson C, Miller J (1987) Enzootic bovine leukosis and bovine leukemia virus. Martinus Nijhoff Publishing, Boston, p 3
Philpott SM, Buehring GC (1999) Defective DNA repair in cells with human T-cell leukemia/bovine leukemia viruses: role of tax gene. J Natl Cancer Inst 91:933–942. doi:10.1093/jnci/91.11.933
Gillet R et al (2007) vol 4, vhttps://retrovirology.biomedcentral.com/articles/10.1186/1742-4690-4-18
U.S. Department of Agriculture (USDA) Animal and Plant Health Inspection Service (APHIS). Bovine Leukosis Virus (BLV) in U.S. Beef Cattle (1999) https://www.aphis.usda.gov/animal_health/nahms/beefcowcalf/downloads/beef97/Beef97_is_BLV.pdf (accessed 4 Oct 2021)
U.S. Department of Agriculture (USDA) Animal and Plant Health Inspection Service (APHIS). Bovine Leukosis Virus (BLV) on U.S. Dairy Operations, 2007 (2008) https://www.aphis.usda.gov/animal_health/nahms/dairy/downloads/dairy07/Dairy07_is_BLV.pdf (accessed 4 Oct 2021)
Buehring GC, Shen HM, Jensen HM et al (2015) Exposure to Bovine Leukemia Virus Is Associated with Breast Cancer: A Case-Control Study. PLoS ONE 10:e0134304. doi:10.1371/journal.pone.0134304
Gillet NA, Willems L et al (2016) Whole genome sequencing of 51 breast cancers reveals that tumors are devoid of bovine leukemia virus DNA. Retrovirology 13:75
Adekanmbi F, McNeely I, Omeler S et al(2021) Absence of bovine leukemia virus in the buffy coats of breast cancer cases from Alabama, USA.Microb Pathog.Dec;161.
Zhang R, Jiang J, Sun W et al (2016) Lack of association between bovine leukemia virus and breast cancer in Chinese patients. Breast Cancer Research 18:101
Vermont Department of Health. Breast Cancer – Data Brief Vermont Cancer Registry (2017) https://www.healthvermont.gov/sites/default/files/documents/pdf/stat_DataBrief_BreastCancer_0.pdf (accessed 10 March 2022)
VanDerMaaten MJ, Miller JM (1976) Replication of bovine leukemia virus in monolayer cell cultures. Bibl Haematol 43:360–362
“Invasive Breast Cancer (IDC/ILC). https://www.cancer.org/cancer/breast-cancer/about/types-of-breast-cancer/invasive-breast-cancer.html., accessed 1/21/2022.
Jiang Y, Xie M, Chen W et al (2014) The sheep genome illuminates biology of the rumen and lipid metabolism. Science 344(6188):1168–1173
Polat M, Takeshima S, Hosomichi K et al (2016) A new genotype of bovine leukemia virus in South America identified by NGS-based whole genome sequencing and molecular evolutionary genetic analysis. Retrovirology 13:4. doi:10.1186/s12977-016-0239-z
Madeira F, Park YM, Lee J et al (2019) The EMBL-EBI search and sequence analysis tools APIs in 2019. Nucleic Acids Res 47:W636–W641. doi:10.1093/nar/gkz268
Buehring GC, Shen HM, Jensen HM et al (2015) Exposure to Bovine Leukemia Virus Is Associated with Breast Cancer: A Case-Control Study. PLoS ONE 10:e0134304. doi:10.1371/journal.pone.0134304
Philpottt SM, Buehring GC (1999) Defective DNA repair in cells with human T-cell leukemia/bovine leukemia viruses: role of tax gene. J Natl Cancer Inst 91(11):933–942
McGirr KM, Buehuring GD (2006) Tax & rex: overlapping genes of the Deltaretrovirus group. Virus genes 32:229–239
Gillet N, Florins A, Boxus M et al (2007) Mechanisms of leukemogenesis induced by bovine leukemia virus: prospects for novel anti-retroviral therapies in human. Retrovirology 4:18
Pluta A, Willems L, Douville RN et al. Effects of Naturally Occurring Mutations in Bovine Leukemia Virus 5’ LTR and Tax Gene on Viral Transcriptional Activity.Pathogens. 20220;9(10):836
Bheuring et al. Emerging Infectious disease 2014
Mamoun R, Morrison M, Rebeyrotte N et al(1990) J Virol. :64;4180–4188.) and likewise demonstrates lack of genetic variation even during active pathogenesis in vivo. (Willems Luc, Kerkofs P, Burny A, et al. Lack of LTR and ENV Genetic Variation during Bovine Leukemia Virus-Induced Leukemogenesis. Virology. 1995:206;769–772
Kamiira S, Sugahara K, Tsuruda K et al(2005) Proviral status of HTLV-1 integrated into the genomic DNA of adult T-cell leukemia cells.Clin Lab Haemotol.
van den Broeke A, Cleuter Y, Chen D, Portetelle D, Mammerickx M, Zagury D, Fouchard M, Coulombel L, Kettmann R, Burny A (1988) Even transcriptionally competent proviruses are silent in bovine leukemia virus-induced sheep tumor cells. Proc Natl Acad Sci USA 85:9263–9267
Andoh K, Kumura K, Nishimori A et al (2020) Development of an in situ hybridization assay using an AS2 probe for detection of bovine leukemia virus in BLV-induced lymphoma tissues. Arch Virol 165:2869–2876
“High Prevalence of BLV in US Dairy Herds.” Dairy96_is_BLV.pdf (usda.gov), accessed 1-21-2022
Bauermann FV, Ridpath JF, Dargatz DA (2017) Bovine leukemia virus seroprevalence among cattle presented for slaughter in the United States. J Veterinary Diagn Invest 29(5):704–706
Olaya-Galan N, Corredor-Figueroa AP, Velandia-Alvarez S et al (2021 Nov) Evidence of bovine leukemia virus circulating in sheep and buffaloes in Colombia: insights into multispecies infection. Arch Virol 11:1–11
Selim A, Marawan M, Ale A0F et al (2020 May) Seroprevalence of bovine leukemia virus in cattle, buffalo, and camel in Egypt. Trop Anim Health Prod 52(3):1207–1210
Nekoei S, Hafshejani TT, Doosti A et al (2015) Molecular detection of bovine leukemia virus in peripheral blood of Iranian cattle, camel, and sheep. Pol J Vet Sci 18(4):703–707
Boso G, Kzak CA(2020) Retroviral Restriction Factors and Their Viral Targets: Restriction Strategies and Evolutionary Adaptations. Microorganisms 8(12), 1965. (https://doi.org/10.3390/microorganisms8121965)
Annual Review of Animal Biosciences (2014) Vol. 2:189–208(Volume publication date https://doi.org/10.1146/annurev-animal-022513-114117
Schwartz I, Bensaid A, Polack B et al(1994) Jul In vivo leukocyte tropism of bovine leukemia virus in sheep and cattle.J Virol.; 68(7);1994.
93. Schwartz I, Bensaid A, Polack B et al. In vivo leukocyte tropism of bovine leukemia virus in sheep and cattle. J Virol. 1994 Jul; 68(7);1994.

Download PDF

Journal Publication

published 30 Jul, 2023

Read the published version in Breast Cancer Research and Treatment →

Editorial decision: Major Revisions Needed
01 Feb, 2023
Reviewers agreed at journal
05 Dec, 2022
Reviewers invited by journal
01 Dec, 2022
Editor assigned by journal
29 Sep, 2022
First submitted to journal
29 Sep, 2022

You are reading this latest preprint version

Exploring the presence of bovine leukemia virus among breast cancer tumors in a rural state

Status:

Journal Publication

Version 1

Abstract

Figures

Background

Methods

Sample acquisition and Data Collection

Sample processing and evaluation

Statistical Analysis

Results

Discussion

Conclusion

Declarations

References

Status:

Journal Publication

Version 1