Haemagglutinin displayed on the surface of Lactococcus lactis confers broad cross-clade protection against different H5N1 viruses in chickens

doi:10.21203/rs.3.rs-20867/v2

Download PDF

Research

Haemagglutinin displayed on the surface of Lactococcus lactis confers broad cross-clade protection against different H5N1 viruses in chickens

https://doi.org/10.21203/rs.3.rs-20867/v2

This work is licensed under a CC BY 4.0 License

Journal Publication

published 15 Oct, 2020

Read the published version in Microbial Cell Factories →

You are reading this older preprint version

Read the latest preprint version →

Background The highly pathogenic avian influenza (HPAI) H5N1 virus poses a potential threat to the poultry industry. The currently available avian influenza H5N1 vaccines for poultry are clade-specific. Therefore, an effective vaccine for preventing and controlling H5N1 viruses belonging to different clades needs to be developed.

Results Recombinant L. lactis/pNZ8148-Spax-HA was generated, and the influenza virus haemagglutinin (HA) protein of A/chicken/Henan/12/2004 was displayed on the surface of Lactococcus lactis (L. lactis). Spax was used as an anchor protein. Chickens vaccinated orally with unadjuvanted L. lactis/pNZ8148-Spax-HA could produce significant humoral and mucosal responses and neutralizing activities against H5N1 viruses belonging to different clades. Importantly, unadjuvanted L. lactis/pNZ8148-Spax-HA conferred cross-clade protection against lethal challenge with different H5N1 viruses in the chicken model.

Conclusion This study provides insights into the cross-clade protection conferred by unadjuvanted L. lactis/pNZ8148-Spax-HA, and the results might help the establishment of a promising platform for the development of a safe and effective H5N1 cross-clade vaccine for poultry.

Applied & Industrial Microbiology

L.lactis/pNZ8148-Spax-HA

cross protection

H5N1 cross-clade vaccine

Due to its high mortality and antigen drift rate, the highly pathogenic avian influenza (HPAI) H5N1 virus is associated with severe disease and poses a serious threat to the poultry industry [1]. HPAI H5N1 viruses have undergone significant genetic diversification, and to date, 10 viral clades, denoted clades 0 to 9, have been identified. Among these clades, clade 2 exhibits significant genetic variation and has been classified into numerous subclades [2]. Numerous H5N1 influenza vaccines from candidate clade 1 and 2 viruses have been approved for production [3]. In addition, most licensed inactivated and live-attenuated H5N1 vaccines are produced in embryonated chicken eggs infected with the seed viruses, and the manufacturing process can take up 9 months [4, 5]. Unfortunately, the highly diverse genetic nature and the rapid evolution of H5N1 viruses has resulted in titre reduction in high-quality allantoic fluid [6]. Furthermore, the currently licensed H5N1 influenza vaccines and inactivated egg-derived whole-virus H5N1 vaccines provide inadequate immunogenicity against infection with H5N1 belonging to a different clade [7], and the current vaccine manufacturing capacity would be inadequate during an emerging H5N1 pandemic [8, 9]. Because the rapid generation of a well-matched H5 vaccine would represent a challenging task at the onset of a pandemic, two important issues to resolve include the supply of sufficient H5 vaccine doses in a timely manner and evaluating their cross-clade protection efficacy against newly emerged strains of H5 influenza viruses. Therefore, the development of a cross-clade protective vaccine is an ongoing high-priority effort for preparing the domestic poultry industry against a potential HPAI H5N1 epidemic.

Several vaccine approaches have been developed against different H5N1 clades. A monovalent H5 vaccine with RG-epitope-chimeric H5N1 protects mice from lethal challenge with H5N1 viruses of different clades, including clades 1.0, 2.1, 2.2 and 2.3 [10]. Furthermore, a vesicular stomatitis virus-based influenza vaccine administered via a single immunization confers rapid protection against different H5N1 clades in a mouse model [11].

L. lactis has been used for the expression of heterologous proteins, such as viral antigens, cytokines and enzymes [12, 13]. Importantly, the L. lactis expression system is suitable as a promising vaccine platform for the development of animal influenza A viruses. Our previous studies showed that combined with mucosal adjuvant or within an enteric capsule, L. lactis expressing H5N1 HA, HA1 or NP is a safe and effective delivery vehicle against homologous H5N1 virus challenge in a mouse or chicken model [14-17]. However, whether unadjuvanted L. lactis can provide cross-clade protective immunity against different H5N1 viruses in the chicken model has not yet been investigated.

In the present study, we generated and tested the L. lactis delivery vector expressing the H5N1 HA of A/Vietnam/1203/2004 (clade 1.0) to demonstrate the feasibility of the L. lactis display platform for a well-matched H5N1 vaccine. Chickens vaccinated orally with a prime/boost regimen of unadjuvanted L. lactis displayed H5N1 vaccine candidates, which could elicit a significant humoral immune response, a significant mucosal immune response, and a neutralizing antibody response. Most importantly, the vaccinated chickens were protected from lethal challenge with different H5N1 clades.

Construction of the L. lactis vectored vaccine

The Spax (411 bp) gene was used as an anchor domain and amplified by PCR from the Staphylococcus aureus (S. aureus) genome as described previously [18]. The HA gene fragment (1650 bp) of A/Vietnam/1203/2004 (H5N1) (GenBank accession No. EU122404) without the signal and transmembrane region was amplified by PCR from pcDNA3.1-HA (kindly provided by Institute of Virology, Chinese Academy of Science, Wuhan, China) using the following primers (the GS linker sequence and Hind III are underlined): H-F, 5' GGCGGCGGCGGCGCCGATCAGATTTGCATTGGTTAC 3'; and H-R, 5' CCGAAGCTTTTAAATGCAAATTCAGCATT 3'. The Spax and HA fragments were fused into Spax-HA using the primers S-F (5' CTAGCTAGCAGTCTTCTAACCGAG 3') and H-R via a GS linker. The resulting Spax-HA containing Nhe I/Hind III was subcloned into an L. lactis expression vector, pNZ8148 (Fig. 1A), and then electroporated into competent L. lactis NZ9000. The positive clone of L. lactis/pNZ8148-Spax-HA was screened and expressed as described previously [16]. L. lactis/pNZ8148-Spax was used as a negative control for the subsequent analyses.

Western blot analysis

The HA protein expression level on the surface of recombinant L. lactis was determined by Western blot analysis as described previously [15]. Briefly, 10⁸ cells of L. lactis/pNZ8148-Spax-HA pellets were washed three times with 500 µL of sterile phosphate-buffered saline (PBS), resuspended in 50 µL of 6× loading buffer and boiled for 10 min. The treated samples were subjected to SDS-polyacrylamide gel electrophoresis and then transferred to nitrocellulose membranes (Bio-Rad, Hercules, CA, USA). After blocking with 5% non-fat milk at room temperature for 2 h, the membrane was incubated with a monoclonal mouse anti-HA antibody overnight at 4 ℃ and then with affinity-purified horseradish peroxidase (HRP)-conjugated anti-mouse IgG (Sigma-Aldrich Corporation, St. Louis, MO, USA). The membrane was subsequently reacted with the West Pico Chemiluminescent Substrate (Thermo Fisher Scientific Inc., Rockford, IL, USA) and imaged using the Molecular Imager ChemiDoc XRS system (Bio-Rad Laboratories, Inc., Hercules, CA, USA).

Immunofluorescence assay and flow cytometry analysis

The display of HA protein on the surface of L. lactis was confirmed by immunofluorescence assay (Olympus IX70, Japan) and flow cytometry (FACS) analysis (BD FACS Calibur, BD Bioscience, San Jose, CA, USA). Briefly, 10⁸ cells of L. lactis/pNZ8148-Spax-HA were washed three times with sterile PBS containing 0.5% bovine serum albumin (BSA), incubated with monoclonal mouse anti-HA antibody for 1 h at 4 ℃ and then with FITC-conjugated goat anti-mouse IgG for 30 min at 4 ℃, and resuspended in 500 µL of sterile PBS. The resulting L. lactis/pNZ8148-Spax-HA cells were subjected to immunofluorescence assay and FACS analysis, respectively.

Quantification of HA protein expressed by L. lactis/pNZ8148-Spax-HA

The expression of HA protein by L. lactis/pNZ8148-Spax-HA was determined by indirect ELISA [19]. Briefly, 10¹² colony forming units (CFUs) of L. lactis/pNZ8148-Spax-HA pellets were resuspended in 100 μL of a monoclonal mouse anti-HA antibody (0, 10, 25, 50, 75, 100, 125, 150, 175, and 200 μg/mL) in PBS containing 2% BSA, incubated at room temperature for 2 h, and incubated with goat anti-mouse IgG antibody conjugated to horseradish peroxidase (1 mg/mL) (Sigma-Aldrich Corporation, St. Louis, MO, USA) at room temperature for 1 h. The cells were then washed with sterile PBS and resuspended in 100 μL of HRP substrate 3,3’,5,5’-tetramethylbenzidine (TMB) (Sigma-Aldrich Corporation, St. Louis, MO, USA) in the dark for 25 min, and 100 μL of 2 mol/L H₂SO₄ was then added to stop the reaction. The OD_450nm value of the supernatant was measured using a microplate reader. L. lactis/pNZ8148-Spax was used as a negative control.

Animals, immunization, sample collection and virus challenge

Specific pathogen-free (SPF) white Leghorn chickens (aged 7 days) were purchased from the Veterinary Research Academy of Agricultural Sciences of Jiangxi Province (Jiangxi, China) and housed in ventilated cages (five chickens per cage). The chickens were administered pelleted feed and sterile water and maintained in an SPF environment.

The concentration of L. lactis/pNZ8148-Spax-HA was adjusted to 10¹² CFUs/mL. The chickens (n=11 per group) were vaccinated orally with 2 mL at days 0, 1, and 2 for prime immunization and days 17, 18, and 19 for boost immunization. PBS and L. lactis/pNZ8148-Spax cells were used as controls.

At days 15 and 34 after the initial vaccination, blood samples were collected from the wing vein. Sera were separated by centrifugation of the blood at 2,000 × g for 10 min and stored at -20 °C until use. The intestines were isolated from the vaccinated chickens (n=3 per group) and washed with 500 µL of sterile PBS. Faeces were also collected, resuspended in 500 µL of PBS and stored at -20 °C until use.

Two weeks after the final vaccination, all the vaccinated chickens were transferred into an animal biosafety level-3 (BSL-3) containment facility. Slight ether narcosis-anaesthetized chickens were intranasally infected with 20 µL of 5 × 50% lethal dose (5 × LD₅₀) of HPAI H5N1 virus strains belonging to clade 1.0 (A/Vietnam/1203/2004, VN1203), clade 2.3 (A/Anhui/1/2005, Anhui) or clade 8.0 (A/chicken/Henan/12/2004, Henan). Three chickens in each group were sacrificed at day 3 post challenge to check the virus titres in the lungs, and the other five chickens remaining in each group were used for survival records. The chickens were monitored every alternate day at a fixed time point to record their weight loss and survival. The humane endpoint of the challenge studies was a body weight loss exceeding 25% relative to the weight at the time of challenge inoculation. After final monitoring, all the surviving chickens were euthanized by CO₂ inhalation for 5 min.

All animal immunizations were performed at a BSL-2 facility, and the virus challenge experiments were strictly performed in BSL-3 containment facilities, complied with the Guidelines for the Use and Care of Experimental Animals and were approved by the Institute Animal Care and Use Committee of Nanchang University.

Determination of antibody responses by ELISA

The antibody responses of serum IgG and IgA in the intestinal washes and faeces were determined by ELISA using recombinant HA protein (2 µg/mL) from A/Vietnam/1203/2004 as a coating antigen as described previously [15]. The optical density (OD) at 405 nm was measured using an ELISA plate reader. The IgG or IgA titre was determined as the lowest dilution with an OD greater than the mean OD of the naïve controls plus two standard deviations.

Neutralization assay

The neutralization activity of serum against different H5N1 viruses was assessed as described previously [15]. Briefly, receptor-destroying enzyme (RDE)-treated sera were serially diluted (2-fold) and incubated with 100 TCID50 of viruses belonging to clade 1.0 (A/Vietnam/1203/2004, VN1203), clade 2.3 (A/Anhui/1/2005, Anhui) or clade 8.0 (A/chicken/Henan/12/2004, Henan) for 1 h at room temperature and plated in duplicate in a 96-well plate with MDCK cells. The neutralizing titre was assessed as the highest antibody dilution for which no cytopathic effect was observed by light microscopy.

Statistical analysis

The statistical significance of the differences was assessed by Student’s t test and one-way ANOVA with multiple comparisons. Significant differences in the survival curves were determined by log-rank analysis. A p value less than 0.05 was considered to indicate statistical significance.

Characterization of HA protein expressed on the surface of L. lactis

L. lactis/pNZ8148-Spax-HA was generated by fusing the HA gene of A/Vietnam/1203/2004 (clade 1.0) lacking a signal peptide and a transmembrane domain with Spax via a GS linker (Fig. 1a). This Spax was previously shown to be serve as effective anchor protein for display [18]. The expression of the HA protein was detected by Western blot analysis. As expected, a specific Spax-HA band was observed at the expected size (approximately 120 kDa) (Fig. 1b).

We then performed immunofluorescence assays and a flow cytometry analysis to determine the efficiency of the display of HA protein on the surface of L. lactis. L. lactis/pNZ8148-Spax-HA was incubated with mouse anti-HA monoclonal antibody for direct labelling. Compared with the L. lactis/pNZ8148-Spax control, positive fluorescence signals were observed with L. lactis/pNZ8148-Spax-HA (Fig. 1c and d). Collectively, these results demonstrated that HA protein was located on the surface of L. lactis.

Quantification of HA protein on the surface of L. lactis

Furthermore, as shown in Fig. 1e, 10¹² CFUs of L. lactis/pNZ8148-Spax-HA showed optical densities at 125 μg, which suggested that the expression of HA protein on the L. lactis surface reached its saturation limit at 125 μg/mL.

Antibody responses induced by L. lactis/pNZ8148-Spax-HA

The HA-specific antibody responses were determined by ELISA. At day 15, the sera IgG titres from chickens vaccinated orally with L. lactis/pNZ8148-Spax-HA showed a slightly significant difference compared with that found in the control chickens vaccinated with PBS and the L. lactis/pNZ8148-Spax control. However, a highly significant increase was detected in the L. lactis/pNZ8148-Spax-HA group at day 34, whereas after the boost immunization, no significant changes were found in the groups vaccinated with PBS or L. lactis/pNZ8148-Spax (Fig. 2a). Similarly, a significant level of mucosal IgA antibody was detected in the intestine washes and faeces of chickens vaccinated orally with L. lactis/pNZ8148-Spax-HA (Fig. 2b and c). These results revealed that a prime-boost regimen of L. lactis/pNZ8148-Spax-HA could induce significant humoral and mucosal immune responses in vaccinated chickens.

Neutralization assay

Due to frequent mutation of the H5N1 virus, it is important to determine whether vaccine candidates elicit neutralization antibodies against different H5N1 clades. we thus performed neutralization tests to examine the ability of L. lactis/pNZ8148-Spax-HA to generate cross-neutralizing antibody responses against different H5N1 viruses. As shown in Fig. 2d, cross-neutralizing antibodies were elicited in the L. lactis/pNZ8148-Spax-HA group, and this finding was similar with the HA-specific IgG response. In contrast, no significant cross-neutralizing antibodies were detected in the L. lactis/pNZ8148-Spax control group. These data were consistent with the ELISA results: chickens vaccinated orally with L. lactis/pNZ8148-Spax-HA using the prime/boost regimen could produce a higher HA-specific IgG antibody and elicit neutralization activities, which might contribute to the prevention of H5N1 clade 1.0 (A/Vietnam/1203/2004, VN1203), clade 2.3 (A/Anhui/1/2005, Anhui) and clade 8.0 (A/chicken/Henan/12/2004, Henan) infection.

Cross-protection against H5N1 virus infection

To further support the cross-protective potential of the L. lactis/pNZ8148-Spax-HA vaccine, vaccinated chickens (n=8) were challenged with 20 µL of 5 × LD₅₀ of a H5N1 virus belonging to clade 1.0 (A/Vietnam/1203/2004, VN1203), clade 2.3 (A/Anhui/1/05, Anhui) or clade 8.0 (A/chicken/Henan/12/2004, Henan) and monitored for 14 days. The control groups that received PBS or L. lactis/pNZ8148-Spax showed clinical signs of severe disease, a significant body weight loss, and a higher lung virus titre after virus infection and died within 8 days after the lethal challenge (Fig. 3). In contrast, the chickens vaccinated orally with L. lactis/pNZ8148-Spax-HA survived throughout the study period and had recovered within 14 days after challenge, and no significant weight loss or apparent illness symptoms were noted after virus challenge (Fig. 3). A lower virus titre in the lung was observed in the L. lactis/pNZ8148-Spax-HA group (Fig. 3). Taken together, the results from the virus challenge experiments provided reliable evidence showing that the L. lactis/pNZ8148-Spax-HA vaccine candidate conferred cross-clade protection against divergent H5N1 clades in the chicken model.

Due to the frequent occurrence of antigenic changes in HPAI H5N1 viruses, there is a risk for an epidemic or potential pandemic of these viruses in poultry. A well-matched H5N1 vaccine is likely an effective measure for fighting a potential H5N1 panzootic. In this study, we generated a well-characterized L. lactis/pNZ8148-Spax-HA vaccine candidate based on the L. lactis display platform, which was previously found to exhibit several advantages over other vaccine approaches, such as the easy realization of genetic modifications, an efficient and cost-effective manufacturing process, a mucosal delivery route and a proven safety and immunogenicity profile [20].

To define a more optimized vaccine approach, we investigated the immunogenicity of unadjuvanted L. lactis/pNZ8148-Spax-HA administered orally in the chicken model. It is generally accepted that trimeric HA exhibits strong immunogenicity, and previous studies have revealed the promising finding that chickens injected with adjuvanted subunit vaccines consisting of trimeric H5N1 HA exhibit high levels of cross-neutralizing antibodies against H5N1 clades 1 and 2 [21, 22]. However, we demonstrated the unadjuvanted L. lactis/pNZ8148-Spax-HA in which the HA gene lacks the signal and trimerization sequence provided convincing cross-clade protection following prime/boost oral vaccination. Furthermore, the L. lactis H5N1 vaccine candidate has advantages compared with the currently used influenza virus vaccines, including easy generation of the vectors and the ability to produce vaccines in cell lines that have already been approved for the manufacturing of human vaccines [23]. In addition, L. lactis vaccines are more effective and safer compared with viral vector-based approaches and do not require adjuvants [24]. Thus, the L. lactis display platform would have a beneficial effect on the manufacturing of influenza vaccines.

An anchor protein plays an important role in L. lactis display-based vaccines. Our previous studies showed that pgsA and Spax could be used as anchor proteins for antigen display [16, 18]. L. lactis/pNZ8110-pgsA-HA1 adjuvanted with CTB provides immune protection against homologous H5N1 virus in a mouse model [16]. Additionally, unadjuvanted L. lactis/pNZ8110-pgsA-NA and unadjuvanted L. lactis/pNZ8008-Spax-HA2 could protect mice from homologous and heterologous virus infection [18, 24]. The comparisons of the display efficiency of L. lactis-displayed influenza vaccines obtained with various anchor proteins revealed that Spax was superior to pgsA. Thus, in our present study, Spax was selected for the design of L. lactis-displayed H5N1 HA, and unadjuvanted L. lactis/pNZ8148-Spax-HA conferred cross-clade protection against different H5N1 viruses in the chicken model. Based on these findings, the L. lactis display platform using Spax will contribute to improving the feasibility of developing influenza H5N1 vaccines for poultry that confer protection against different H5N1 clades.

The rapid evolution of new sublineages of influenza A/H5N1 virus poses a great threat to poultry health [25]. A major obstacle in vaccine development against influenza H5N1 virus infection is the rapid evolution of the genetic diversity of these viruses [26]. As a result and given the limitations of the currently approved vaccines for H5N1 viruses in terms of their production timelines and their ability to induce cross-clade protective immune responses, newer vaccine approaches for panzootic preparedness against these viruses are needed [27]. The development of a simple vaccine that provides broad protection against influenza H5N1 is of high priority for preparing the poultry industry against a future influenza panzootic. This study clearly demonstrated that unadjuvanted L. lactis/pNZ8148-Spax-HA could serve as an alternative approach that is currently showing promise for the development of a H5N1 cross-clade vaccine for the mass vaccination of poultry. Overall, the L. lactis display platform might constitute a new strategy for the development of a universal flu vaccine for poultry and humans.

The findings obtained in this study suggest that the unadjuvanted L. lactis display platform can be used to an alternative H5N1 cross-clade vaccine candidate and can overcome the bottleneck of the current manufacturing process because it constitutes a flexible and high-output system for the safe, effective and low-cost production of an H5N1 vaccine for poultry during an influenza H5N1 panzootic.

Acknowledgements

The authors gratefully acknowledge Dr. Yuhong Xu for the technical assistance provided.

Authors’ contributions

All the authors approved the manuscript for submission. HL, QC, TG and XP contributed to the study design and data interpretation. All the authors contributed to the data analysis and the interpretation of the results. HL wrote the manuscript and produced all the figures.

Funding

This work was supported by the Sichuan Science and Technology Program (No. 2019YFN0134) and a grant from the Fundamental Research Funds for the Central Universities (No. 2682018CX73) to H. Lei.

Availability of data and materials

The datasets generated and analysed in the current study are available from the corresponding author upon reasonable request.

Ethics approval and consent to participate

All animal studies complied with the Guidelines for the Use and Care of Experimental Animals and were approved by the Animal Committee of the Institute of Nanchang University.

Competing interests

All authors claim no conflicts of interest.

Fielding R, Bich TH, Quang LN, Lam WW, Leung GM, Tien TQ, et al. Live poultry exposures, Hong Kong and Hanoi, 2006. Emerg Infect Dis. 2007; 13: 1065-67.
Zhong L, Zhao Q, Zhao K, Wang X, Zhao G, et al. The antigenic drift molecular basis of the H5N1 influenza viruses in a novel branch of clade 2.3.4. Vet Microbiol. 2014; 171: 23-30.
Sun X, Belser JA, Pulit-Penaloza JA, Creager HM, Guo Z, Jefferson SN, et al. Stockpiled pre-pandemic H5N1 influenza virus vaccines with AS03 adjuvant provide cross-protection from H5N2 clade 2.3.4.4 virus challenge in ferrets. Virology. 2017; 508:164-69.
Rajao DS, Perez DR. Universal vaccines and vaccine platforms to protect against influenza viruses in humans and agriculture. Front. Microbiol. 2018; 9:123.
Tosh PK, Poland GA. Emerging vaccines for influenza. Expert Opin. Emerg. Drugs. 2008; 13:21–40.
Nicholson KG, Colegate AE, Podda A, Stephenson I, Wood J, Ypma E,Zambon MC: Safety and antigenicity of non-adjuvanted and MF59-adjuvanted influenza A/Duck/Singapore/97 (H5N3) vaccine: a randomised trial of two potential vaccines against H5N1 influenza. Lancet. 2001; 357: 1937-43.
Treanor JJ, Schiff GM, Hayden FG, Brady RC, Hay CM, Meyer AL,et al. Safety and immunogenicity of a baculovirus-expressed hemagglutinin influenza vaccine: a randomized controlled trial. JAMA. 2007; 297: 1577-82.
Clegg CH, Rininger JA, Baldwin SL. Clinical vaccine development for H5N1 influenza. Expert Rev Vaccines. 2013; 12:767–77.
Stohr K. Perspective: Ill prepared for a pandemic. Nature. 2014; 507:S20–1.
He F, Prabakaran M, Rajesh Kumar S, Tan Y, Kwang J. Monovalent H5 vaccine based on epitope-chimeric HA provides broad cross-clade protection against variant H5N1 viruses in mice. Antiviral Res. 2014; 105: 143-51.
Furuyama W, Reynolds P, Haddock E, Meade-White K, Quynh Le M, Kawaoka Y, et al.A single dose of a vesicular stomatitis virus-based influenza vaccine confers rapid protection against H5 viruses from different clades. NPJ Vaccines. 2020; 5:4.
Bahey-El-Din M: Lactococcus lactis-based vaccines from laboratory bench to human use: an overview. Vaccine. 2012; 30: 685-90.
Wells JM, Mercenier A: Mucosal delivery of therapeutic and prophylactic molecules using lactic acid bacteria. Nat Rev Microbiol. 2008; 6: 349-62.
Lei H, Peng X, Shu H, Zhao D: Intranasal immunization with live recombinant Lactococcus lactis combined with heat-labile toxin B subunit protects chickens from highly pathogenic avian influenza H5N1 virus. J Med Virol. 2015; 87: 39-44.
Lei H, Xu Y, Chen J, Wei X, Lam DM: Immunoprotection against influenza H5N1 virus by oral administration of enteric-coated recombinant Lactococcus lactis mini-capsules. Virology 2010, 407: 319-24.
Lei H, Sheng Z, Ding Q, Chen J, Wei X, Lam DM,Xu Y: Evaluation of oral immunization with recombinant avian influenza virus HA1 displayed on the Lactococcus lactis surface and combined with the mucosal adjuvant cholera toxin subunit B. Clin Vaccine. Immunol 2011, 18: 1046-51.
Lei H, Peng X, Jiao H, Zhao D, Ouyang J. Broadly protective immunity against divergent influenza viruses by oral co-administration of Lactococcus lactis expressing nucleoprotein adjuvanted with cholera toxin B subunit in mice. Microb Cell Fact. 2015; 14:111.
Lei H, Peng X, Zhao D, Jiao H, Ouyang J. Cross-protection of Lactococcus lactis-displayed HA2 subunit against homologous and heterologous influenza A viruses in mice. Arch Virol. 2015; 160(12):3011-9.
Nakamura Y, Shibasaki S, Ueda M, Tanaka A, Fukuda H, Kondo A. Development of novel whole-cell immunoadsorbents by yeast surface display of the IgG-binding domain. Appl Microbiol Biotechnol. 2001; 57:500–505
Azizpour M, Hosseini SD, Jafari P, Akbary N. Lactococcus lactis : A New Strategy for Vaccination. Avicenna J Med Biotechnol. 2017; 9:163-8.
Lin SC, Huang MH, Tsou PC, Huang LM, Chong P, Wu SC. Recombinant trimeric HA protein immunogenicity of H5N1 avian influenza viruses and their combined use with inactivated or adenovirus vaccines. PLoS One. 2011; 6:e20052.
Cornelissen LA, de Vries RP, de Boer-Luijtze EA, Rigter A, Rottier PJ, de Haan CA. A single immunization with soluble recombinant trimeric hemagglutinin protects chickens against highly pathogenic avian influenza virus H5N1. PLoS One. 2010; 5:e10645.

Hegde NR. Cell culture-based influenza vaccines: A necessary and indispensable investment for the future. Hum Vaccin Immunother. 2015;11:1223-34.
Villatoro-Hernandez J, Montes-de-Oca-Luna R, Kuipers OP. Targeting diseases with genetically engineered Lactococcus lactis and its course towards medical translation. Expert Opin Biol Ther. 2011; 11:261-7.
Watanabe Y, Ibrahim MS, Ellakany HF, Kawashita N, Mizuike R Hiramatsu H,et al. Acquisition of humantype receptor binding specificity by new H5N1 influenza virus sublineages during their emergence in birds in Egypt. PLoS Pathog. 2011; 7: e1002068.
Linster M, van Boheemen S, de Graaf M, Schrauwen EJ, Lexmond P, Mänz B, et al. Identification, characterization, and natural selection of mutations driving airborne transmission of A/H5N1 virus. Cell. 2014; 157: 329-39.
Prieto-Lara E, Llanos-Mendez A. Safety and immunogenicity of prepandemic H5N1 influenza vaccines: a systematic review of the literature. Vaccine 2010; 28: 4328–34.

Download PDF

Journal Publication

published 15 Oct, 2020

Read the published version in Microbial Cell Factories →

Editorial decision: Major Revision
12 Sep, 2020
Review #2 received at journal
11 Sep, 2020
Reviewer #2 agreed at journal
22 Aug, 2020
Review #1 received at journal
29 Jul, 2020
Reviewer #1 agreed at journal
24 Jul, 2020
Editor assigned by journal
22 Jul, 2020
Reviewers invited by journal
22 Jul, 2020
Submission checks completed at journal
21 Jul, 2020
Editor invited by journal
21 Jul, 2020

You are reading this older preprint version

Read the latest preprint version →

Haemagglutinin displayed on the surface of Lactococcus lactis confers broad cross-clade protection against different H5N1 viruses in chickens

Status:

Journal Publication

Version 2

Abstract

Figures

Background

Methods

Results

Discussion

Conclusions

Declarations

References

Status:

Journal Publication

Version 2