Animals and treatment
Six-month-old male APP/PS1transgenic mice and WT C57BL/6 (B6) littermates were obtained from the Nanjing University Animal Model Research Center. AAV mediated shRNA targeting ABHD6 (AAV-sh-ABHD6) and control (AAV-shcon) were purchased from Wuhan Brain Science and Technology (BrainVTA). The APP/PS1 mice were randomly divided into 2 groups with 15 mice in each group, which were not blinded to investigators. AAV-sh-ABHD6 (5×1012 transduction units [TU]) or AAV-con (5×1012 TU) was slowly injected into bilateral hippocampus of APP/PS1 mice (AAV-sh-ABHD6 group or AAV-con group) as previously described(23). The behavioral or electrophysiological tests were performed 30 days after the injection, and investigators did not know the specifics of the experimental groupings. The mice were then sacrificed for other experiments. APP/PS1 mice were randomly divided into 3 groups, 12 mice in each group.
There were 12 WT littermate control mice. ABHD6 inhibitor wwl70 (5 mg/kg/day or 10 mg/kg/day, MedChemExpress, Monmouth Junction, NJ, USA) was intraperitoneally injected into APP/PS1 mice for 30 days; pure water was injected intraperitoneally into APP/PS1 mice (APP) and WT mice (WT) for 30 days. As before, when conducting behavioral experiments, the researchers did not know the specifics of the experimental groupings. The behavioral tests or electrophysiological experiments were performed. All animal experiments were approved by the Nanjing University Animal Health Committee.
Cell culture
Primary cortical neurons were prepared from embryonic day (E) 15–17 embryos of B6 mice as previously described(24), and maintained in Neurobasal medium with B27 (Invitrogen, Carlsbad, CA, USA) and 25 nM glutamine at 37°C in a humidified 5% CO2 incubator. The cells were infected on day 4 with AAV-sh-ABHD6 (MOI = 20000), and harvested for PCR analysis at day 10. Alternatively, neuronal cells were pretreated with wwl70 (50 µM) for 2 h at day 7 and then treated with synthetic Aβ1−42 (2 µM, Millipore, Boston, MA, USA) for 24 h followed by cell viability tests. Mouse neuroblastoma N2a cells were obtained from the American Type Culture Collection (ATCC) and maintained in Dulbecco's modified Eagle's medium (DMEM, Invitrogen) containing 10% fetal bovine serum (FBS, Invitrogen, Carlsbad, CA, USA).
CCK8 assay
Cell viability was determined using the CCK8 assay (Dojindo, Japan) according to the manufacturer's instructions. At day-in-vitro (DIV)11–13 primary cortical neurons were incubated with 10 µl CCK8 at 37°C in 96-well plates for 2 h and absorbance was measured at 450 nm in a plate reader (Bio-Rad, Hercules, CA, USA) .
Cell apoptosis assay
The apoptosis rate of neurons was detected by annexin V-FITC/propidium iodide (PI) kit (Vazyme, Southern, China). Briefly, neurons of DIV 11–13 were incubated with binding buffer containing Annexin V-FITC for 5 min in the dark, and fluorescence was detected using a fluorescence microscope (Olympus, Tokyo, Japan). The apoptosis rate of early apoptotic neurons was analyzed.
Western blot
Total protein of hippocampal tissues or primary neurons was extracted using RIPA lysis buffer (Beyotime, Nanjing, China), and 30 µg protein per group was electrophoresed on a 10% sodium dodecyl sulfate polyacrylamide gel (SDS-PAGE) and transferred to polyvinylidene fluoride (PVDF) membrane. These membranes were blocked with 5% nonfat milk for 1 h and incubated overnight at 4°C with the following primary antibodies: anti-bax (1:1000, Cell Signaling Technology), Bcl-2 (1:1000, Cell Signaling Technology), GAPDH (1:5000, Bioworld), β-actin (1:5000, Bioworld), PSD-95 (1:1000, abcam), ABHD6 (1:500, proteintech) ), synapsin-1 (1:1000, abcam), synaptophysin (1:1000, abcam), APP (1:500, sigma), BACE (1:1000, Cell Signaling Technology), PSEN1 (1:1000, Cell Signaling) Technology), PSEN2 (1:1000, Cell Signaling Technology). After TBS-T wash for 3 times, the membranes were incubated with the corresponding secondary antibodies for 2 h at room temperature. Proteins were visualized with an ECL kit (Millipore, Boston, MA, USA). The intensities of the bands were quantified with ImageJ (https://ImageJ.NIH.gov/ij/, National Institutes of Health, Bethesda, USA), and β-actin/GAPDH was used as the loading control.
Calcein acetoxymethylester/propidium iodide AM/PI staining assay
Calcein-acetoxymethyl ester/propidium iodide AM/PI double-staining kit (DOJINDO, Iapan) was used to detect the neuron vitality. Neurons were cultured with calcein -AM and PI buffer at 37°C for 15 min. The living cells with yellow-green fluorescence and dead cells with red fluorescence were observed under fluorescence microscope, and the ratio of living cells to total cells was counted.
Immunostaining
Neurons were fixed with 4% paraformaldehyde for 20 min and blocked with 2% bovine serum protein for 2 h. Then the cells were incubated with anti-cleaved-caspase3 (1:500, Cell Signaling Technology) and anti-MAP-2 (1:500, abcam) antibodies at 4°C overnight. After washing with PBS-T for 30 min, the cells were incubated with Alexa Fluor Plus 488, goat anti-mouse IgG (H + L) secondary antibody orAlexa Fluor Plus 594, goat anti-mouse IgG (H + L) secondary antibody (1:500, bioworlde) for 1 h at room temperature. The nucleus was stained with DAPI reagent (1:1000, bioworld). Images were taken by fluorescence microscope, and the ratio of cleaved-caspase3 (red) to MAP-2 (green) positive neurons was calculated.
Mouse brain was fixed with 4% paraformaldehyde, and cut into 20 µm slices after gradient dehydration. Brain slices were incubated with primary antibodies including anti-beta amyloid (1:500, abcam), Iba1 (1:500, abcam), GFAP (1:500, Cell Signaling Technology) or NeuN (1:500, abcam) at 4°C overnight, and then incubated with the indicated secondary antibodies in the dark at room temperature.
Quantitative real-time PCR
Total RNA was extracted using TRIzol reagent (Accurate Biology, Hunan, China), and reverse transcribed with PrimeScript RT Master Mix (Vazyme Biotech Co.,ltd). Real-time PCR was performed in Step One Plus PCR system (Applied Biosystems) system with SYBR Green Kit (Applied Biosystems). Primers used are as follows:
ABHD6: forward (5’-3’), CATTCCAATCCTGGCATTTGTTG
reverse(5’-3’), ATGGTGTGCGTAGCGAACTT
IL-1β: forward(5’-3’), CCATCCTCTGTGACTCATGGG
reverse(5’-3’), TCAGCTCATATGGGTCCGAC
IL-6: forward(5’-3’),
GACAAAGCCAGAGTCCTTCAGAGAG
reverse(5’-3’), CTAGGTTTGCCGAGTAGATCTC
TNF-α: forward(5’-3’), CCACCACGCTCTTCTGTCTA
reverse(5’-3’), GATCTGAGTGTGAGGGTCTGG
GAPDH: forward(5’-3’), AGGTCGGTGTGAACGGATTTG
reverse(5’-3’), TGTAGACCATGTAGTTGAGGTCA
Electrophysiology
Fresh hippocampal slices (300 µm) were prepared and transferred to 34°C incubation tank (containing cutting solution) for 15min, and then incubated in the incubation tank containing artificial cerebral spinal fluid (ACSF) at room temperature for 1h. The fresh slices were transferred to the MEA2100 recording tank (32°C) where ACSF (2 ml/min) filled with mixed gas (95%O2/5%CO2) passed, and the CA1 region was moved to the array microelectrode. The stimulation sites were selected according to the postsynaptic response, and the corresponding recording electrode points were selected to record the LTP in the CA1 brain region. The input-output relationship of synapses was evaluated by measuring the slope of fEPSPs. Half of the maximum evoked response in LTP experiment was used as stimulation intensity. High frequency stimulation (HFS; 100Hz, three trains, 1 s duration, 10 s interval) can induce LTP. The initial fEPSP slope was normalized by the average slope value during the control period. Acquisition and analysis of data were performed by LTP-Director software and LTP-Analyzer software .
Golgi Staining
Golgi staining was performed using Fast Golgi staining kit (FD Neurotechnologies, Columbia, USA) following the manufacturer's instructions. The fresh brain tissues were quickly soaked in the mixture of solution A and B in darkness at room temperature for 2 weeks, and transferred to solution C for at least 72 h in dark at room temperature. The tissues were then iodinated in the mixture of solution D, E and double distilled water, and dehydrated in 50%, 75%, 95% and anhydrous ethanol. The data were analyzed by ImageJ software.
Open field trial
Open field trial was carried out in a box of 40cm*40cm*15cm, and it would be cleaned using 75% alcohol before each test. The mouse was allowed to explore freely for 10min, and the total exercise distance and residence time in central lattice and corner lattice were measured.
New object recognition trial
In habituation stage, the mice were numbered and put into a new object identification box (no objects) for 3 days. In training session, the mice were placed with two identical objects in the box recognition for 10 min. In testing session, one of the objects was replaced by a new one with different shape and color, and the mice explored freely for 5 min. The new object recognition time in the testing session was calculated and analyzed(If the ratio of the time spent exploring each identical object in the training session to the total time is outside the range of 40–60%, the experiment in the testing stage is not counted.).
Y maze
Y maze test was performed to evaluate the spatial working memory using a Y-shaped maze of three equal length arms. The mice were placed in the centre of the maze and allowed to freely explore the arms for 8 min. The ratio of alternation times to total arm entry times was recorded and analyzed.
Morris water maze
Morris water maze test was performed as described previously(25). Briefly, the mice were trained to find the hidden platform in 60 s for 5 days in the acquisition trial, and the latency was recorded. If the mouse did not find the platform within 60 s, it would be gently guided onto the platform for 30s, and the latency was set to be 60 s. In the probe trial, the platform was removed on the 6 th day, and mice were allowed to swim for 60 s. Average swimming speed, latency of the target quadrant and platform, platform crossing times and target quadrant activity time of mice were recorded and analyzed(During the whole experiment, if the mice died, the data of the dead mice would not be counted.).
Fear condition trial
Fear condition tests were conducted using a conditioning chamber (XR-XC404, Shanghai Softmaze Information Technology Co. Ltd) as described previously(25). During the training trial, the mice were placed in the box for 3 min followed by sound stimulation for 30 s and electric shock in the last 2 s of sound stimulation, and rested in the box for another 1 min. During the testing trial, mice were put in the same chamber for 5 min at 24 h after training, and the percentage of freezing was calculated to detect the context-dependent fear. Then the mice were put into a completely different chamber for 2 min, and a 3 min sound stimulation was delivered. The percentage of freezing of mice was calculated to detect tone-dependent fear(During the whole experiment, if the mice died, the data of the dead mice would not be counted.).
Statistical analysis
The results were expressed as mean ± SEM and analyzed by GraphPad Prism (GraphPad Prism 8.0 software. USA). Experiments were routinely performed with three biological repeats unless specified. Differences between two groups were analyzed using student's t-test, and differences between multiple groups were analyzed using one-way or two-way ANOVA. P < 0.05 was considered statistically significant.