Association of Interleukin-18 genotypes (-607  C&gt;A  ) and (-137 G&gt;C) with the hepatitis B virus disease progression to hepatocellular carcinoma

doi:10.21203/rs.3.rs-209571/v1

Chronic infection with HBV has been reported to be associated with the development of HCC. The inflammation mounted by cytokine mediated immune system plays an important role in the pathogenesis of HBV associated HCC. IL-18 is a pro-inflammatory cytokine whose role in the development of HBV associated chronic to malignant disease state has not been much studied. The present study was conceived to determine the role of genetic polymorphisms in IL-18, serum levels of IL-18 and expression level of its signal transducers in the HBV disease progression. A total of 403 subjects were enrolled for this study including 102 healthy subjects and 301 patients with HBV infection in different diseased categories. Polymorphism was determined using PCR-RFLP. Genotypic distributions between the groups were compared using odd’s ratio and 95% CI were calculated to express the relative risk. Circulating IL-18 levels were determined by ELISA. Expression level of pSTAT1 and pNFƙB were determined by western blotting. In case of IL-18(-607C > A), the heterozygous genotype (CA) was found to be a protective factor while in case of IL-18(-137G > C) the heterozygous genotype (GC) acted as a risk factor for disease progression from HBV to HCC. Moreover, serum IL-18 levels were significantly increased during HBV disease progression to HCC as compared to controls. Also the levels of activated signal transducers (pSTAT1 and pNF-κB) of IL-18 in stimulated PBMCs were significantly increased during HBV to HCC disease progression. These findings suggest that IL-18 has the potential to act as a biomarker of HBV related disease progression to HCC.

Biochemical Research Methods

Hepatitis B Virus

HCC

IL-18

SNPs

genotype

Hepatocellular carcinoma (HCC) is a common type of primary malignancy of liver and occurs primarily in chronic liver disease and cirrhotic patients. HCC, at present is the third most common cause of deaths related to cancer globally, affecting more than 500,000 people annually [1]. The incidence of HCC shows a lot of geographic variability [2]. Sub-Saharan Africa or eastern Asia has more than 80% of liver cancer cases and China accounts for 50% of the cases [3]. There are approximately 19,000 new cases of HCC and around 17,000 deaths occur due to HCC per year in India. The risk factors that lead to the hepatocellular carcinoma development include infections with hepatitis C virus (HCV) and hepatitis B virus (HBV), aflatoxin B1 chronic exposure, oxidative stress, excessive alcohol consumption and multiple genetic alterations etc. [5]. The prevalence of two main risk factors for HCC in India is ~2.4-4.0% for active hepatitis B virus and ~1.0–1.9% for chronic hepatitis C virus [4]. It is believed that chronic inflammation of the liver mediated by immune system can lead to the development of HCC because of constant cell death that results in proliferation of cells and thus increased incidence of genetic alterations.

Cytokines are a family of proteins produced in response to an enormous range of cellular stresses that include inflammation, infection, and injury induced by carcinogen. These processes result in the initiation of signal transduction pathways that are cytokine specific. Cytokine release is of primary importance in the regulation of immune system as these play a vital role in the defense against viral infections and carcinogenesis. Cytokines help in immune cell proliferation, differentiation, and inactivation or apoptosis [6].Moreover, among the cytokines, the IFN-γ mainly regulates the response of immune system against intracellular pathogens. IFN-γ triggers macrophages via the formation of reactive oxygen intermediates (ROIs), nitric oxide (NO), and increased class I and II MHC molecule expression and other co-stimulatory molecules implicated in antigen presentation [7]. IL-18, which is relatively a newly discovered cytokine, and is a potent inducer of IFN-γ, has a vital role in HCC development [8]. In addition to IFN-gamma, IL-18, also stimulates the production of TNF-α, IL-1 and has synergistic action with IL-12. When IL-12 is not present, it induces Th2 response by inducing the synthesis of IL-4 and IL-10 [9]. Hence, this cytokine might have a role in HBV disease outcome. There are a couple of studies which have analyzed the association of IL-18 genotypes with HBV disease [10-12]. However, there is very limited knowledge in the literature specifically regarding genotype distribution of IL-18 and susceptibility to the progression of HBV associated chronic to malignant disease. Moreover, there is no report studying the association of IL-18 gene polymorphism and its circulating levels with HCC in HBV patients in Indian population. Also, there is no previous study correlating IL-18 signaling components with progression of disease from chronic hepatitis to HCC in Indian population, in spite of an increasing incidence of HBV related HCC in India. It becomes important to carry out such studies in a population based manner as it has been observed that there is high intricacy of multivariate interlink between the genomic information and the phenotype that manifests. HCC development is a multiple stage conglomerate process which relates to causative factors such as gender, age, environmental toxins, drug and alcohol abuse, elevated HBV DNA levels, and HBV genotype [13]. HBV genotype B and C are found to be widespread in Han population [14] whereas genotypes A, C and D are mostly found in Indian population with genotype D being the most predominant [15]. Hence, genetic diversity of genotypes of HBV exist that exhibits distinct geographical and ethnic distributions. Recently, a study by Sawai et al [13] using four distinct cohorts including Japanese, Korean and Hongkongese observed no association between rs17401966 and HBV-derived HCC which was earlier observed by Zhang et al [16] in southern, eastern and northern Chinese population. Hence this study concluded that such observations might be due to differences in the genetic diversity among the Japanese, Korean and Chinese populations. Their study further highlighted the need to carry out the polymorphism-based studies in different ethnic groups because of the observation that genotypic distributions can vary in different regions belonging to even the same continent. Therefore, we hypothesize that polymorphism in IL-18 gene might contribute to the increased susceptibility to the HBV disease progression by altering the protein expression of various components of cell signaling pathways.

Patients

We recruited 102 healthy subjects and 301 patients (HbsAg +ve) in total 318 males and 85 females with mean age (43.77± 16.43) that were clinically categorized as inactive hepatitis [carriers], chronic-active HBV infection, HBV associated cirrhosis and HCC, in the Liver Clinic of the Department of Hepatology, Postgraduate Institute of Medical Education and Research, Chandigarh, India. Healthy volunteers, age and gender matched were enrolled as controls with no chronic liver or kidney diseases as well as no HIV, HBV or HCV infection. All subjects enrolled in this study were of Indian ethnicity and living in northern part of India. The protocol was approved by the institutional ethics committee, Chandigarh, India and informed consent written by all the participants was taken. The sample size in our study is small, but this was the convenient sample size based on the frequency of HBV-HCC patients attending the hepatology clinic in our institute.

Genotyping for SNPs IL-18[-137] and IL-18 [-607] genes

Primers for PCR-RFLP of IL-18 (-137) and IL-18 (- 607) were synthesized by Sigma Aldrich Bangalore, India. Thermo F501L DNA polymerase II and NEB 50bp DNA ladder were used. dNTPs mix [10mM] were obtained from MBI Fermentas. Restriction endonucleases used for RFLP study i.e. [BstuI and Faul,] were obtained from New England Biolabs. Isolation of genomic DNA from whole blood was done using Qiagen mini kit for blood using manufacturer’s protocol. Nanodrop spectrophotometer was used to check the purity and quantity of DNA. The DNA having the absorbance ratio at 260/280 nm of greater than 1.8 was used for the study. Moreover, integrity of DNA was checked through 1% agarose gel electrophoresis. The genotyping analysis at position -137 and -607 of IL-18 was done by PCR with primers that were sequence specific (PCRSSP): IL-18(-137) (fwd: CACAGAGCCCAACTTTACGGCAAGAA) (rev:GACTGCTGTCGGCACTCCTTGG) with product size of 155bp, for IL-18(-607) (fwd: GCCCTCTTACCTGAACTTTTACGGCAGAGAA)(rev:AGAATTTACTTTTCAGTGGAACAGGAGTCC) with product size 171bp. The PCR conditions were initial 2mins of denaturation at temperature of 94 °C , followed by 35 cycles of denaturation at 94 °C for 20s , annealing at 59 °C for 50s, and extension at 72°C for 20s. Identification of each allele was done according to its size.

Measurement of circulating IL-18 levels

Collection of blood samples was done by venipuncture from patients and healthy controls and blood was allowed to clot at room temperature for approximately 30-minutes. Then, the serum was isolated by centrifugation at 3,000 rpm for 5 minutes. Aliquots of serum were made and refrigerated at –80°C till the use for further analysis. Levels of IL-18 in the patients (n=190) and control sera (n=30) were measured using commercially available human IL-18 ELISA Kit (RayBio, Georgia, United States) as per the instructions of manufacturer.

Analysis of expression levels of signal transducers (STAT1 and NF-κB) of IL-18 in stimulated PBMCs

A total of 25 patients were recruited five each from aforementioned categories, 10mL of venous blood was collected from each patient under aseptic conditions using heparinized vials and samples were subjected to PBMC isolation procedure. Standard FicollPaque procedure was used to isolate PBMCs from freshly collected blood. Cells were stimulated with 10μg/mL of IL-18. PBMCs were then suspended in 300μL lysis buffer, centrifuged at constant speed of 12,000xg for 30min at 4ºC. Supernatant was aspirated and pellet was discarded and proteins were then stored at -20ºC till further use for western blotting. For western blotting proteins from PBMCs were separated on SDS-PAGE gel (12%) and then transferred to a PVDF membrane. Blocking of membrane was performed with 3% BSA in phosphate buffer saline (PBS) overnight at 4ºC. Incubation of membranes was done with anti pSTAT-1 human polyclonal antibody in 1% BSA (1:200 Santa Cruz Biotechnology, Santa Cruz, CA) and with anti-pNF-ƙB (1:100 Santa Cruz Biotechnology, Santa Cruz, CA). After washing alternatively with PBS and PBS-T, the membranes were incubated with HRP labeled secondary antibody (dilution 1:10000) for both pSTAT-1 and pNF-ƙB at room temperature for 1hr. Enhanced chemiluminescence (ECL) western blotting detection reagent (biorad) was used for immune-detection. Image J software was used for determining relative band density.

Statistical Analysis

Genotype frequency was derived as the number of subjects with a specific genotype divided by the total number of subjects screened. Test for Hardy-Weinberg equilibrium was also done. Genotype association with the risk of developing HCC is represented as odds ratios (Ors) with 95 per cent confidence intervals [CIs]. OR analysis indicates the risk association of a factor (OR>1: risk factor or positive association; OR<1: protective factor or negative association; OR=1: no association]. Categorical data is shown as numbers and percentages and were analyzed by χ²test. Continuous data is shown as mean ± SD or median with quartiles and analyzed by unpaired t-test and Mann-Whitney U test. For more than two groups, data was analyzed by ANOVA or Kruskal Wallis test. The normality of the continuous data was checked by Shapiro Wilk test. P values <0.05 are considered significant. Statistical analysis was performed using SPSS software version 22.0 (IBM, Chicago, IL) and Graphpad prism version 6.0 (La Jolla, California).

To analyze the influence of polymorphisms at IL-18 gene promoter on the course of HBV disease progression, gene and allele frequency were analyzed in various categories of HBV infection.

As evident from Fig. 1a the presence of 171 bp and 101bp bands in all the lanes correspond to heterozygous genotype (CA), while wild genotype CC is depicted by 171bp band in case of IL-18(-607).The presence of 155bp band depicting wild genotype (GG) and that of 155bp and 116 bp bands show heterozygous genotype (GC) of IL-18 (-137) as depicted in Fig. 1b.

Genotype distribution of IL-18 genotypes [-607C > A] and [-137 G > C]

Susceptibility to HBV disease progression might be influenced by SNPs in the cytokine genes. So, we analyzed genotypic distribution of IL-18 genotypes in different categories of subjects. Genotypic distribution for IL-18 (-607) showed that genotype CA was the most common among all groups. Genotype CC of IL-18 (-607)was present maximally (67%) in HBV-cirrhotic subjects and found to be the least in inactive carrier subjects. HBV -HCC subjects had maximum distribution of AA genotype as compared to other groups (Table 1).

Table 1.Genotype and allele distribution of among different categories of subjects of IL-18 (-607)

genotypes and its association with HBV-HCC risk

Groups	Healthy Controls (n=102)	Inactive carrier (n=81)	Hepatitis (n=74)	Cirrhosis (n=67)	HCC (n=72)

Genotypic frequency
CC	45 (44.12)	22 (27.16)	30(40.55 )	44 (67)	40 (55.56)
CA	57 (55.88)	57 (70.37)	42 (56.75)	19 (29.23)	27(44.82)
AA	NIL	2 (2.47)	2 (2.70)	2 (3.07)	5(6.94)
Allele Frequency
C Allele	147(72.05)	101(62.34)	102(68.92)	107(82.31)	107(74.31)
A Allele	57(27.95) 1(REF)	61(37.66) ---- 1( REF )	46(31.08) 1.1 (0.63- 1.94) 0.54* (0.3-0.98)	23(17.69) OR (CA) 0.34* (0.19- 0.62) 0.17* ǂ (0.09-0.31)	37(25.69) 0.64 (0.36- 1.11) 0.31***ǂ (0.17-0.56)

Data represented as number of subjects (genotypic distribution. %).Data represented as Odd’s ratio (95% confidence interval) ;.*** p<0.001 w.r.t control ;ǂ ***p<0.001 w.r.t inactive carrier; *p<0.05 w.r.t inactive carrier.

Genotypic distribution for IL-18(-137) revealed that GG genotype was the most prevalent one among all groups. IL-18(-137) GC genotype was present maximally in Chronic active hepatitis (50%) subjects and found to be the least in HBV-cirrhotic subjects. However, HBV cirrhotic subjects showed the highest distribution of CC genotype as compared to other groups [Table 2].

Table 2

Genotype and allele distribution of among different categories of subjects of *IL-18 (-137)* genotypes and its association with HBV-HCC risk
Groups	Healthy Controls (n = 72)	Inactive carrier (n = 72)	Hepatitis (n = 78)	Cirrhosis (n = 70)	HCC (n = 61)
Genotypic frequency
GG	47 (65.27 )	42 (58.33 )	35 (44.87 )	46(65.71)	34(55.74)
G C	23 (31.94 )	28 (38.88 )	39 (50 )	20(28.57)	25(40.99)
CC	2 (2.7 )	2 (2.77 )	4 (5.12 )	4 (5.71 )	2 (3.28 )
Allele Frequency
G Allele	117(81.25)	112(77.78)	109(69.87)	112(80)	93(76.23)
C Allele	27(18.75) 1( REF) 1 (REF)	32(22.22) --- 1( REF) --- 1( REF)	47(30.13) 2.3** (1.3–4.1) 1.67 (0.94–2.9) 2.76 (0.6-12.64) 2.5 (0.54–11.320)	28(20) OR(GC) 0.89 (0.48–1.68) 0.659 (0.36–1.18) OR (CC) 2.1 (0.47–9.3) 1.9 (0.42–8.33)	29(23.77) 1.5 (0.84–2.7) 1.1 (0.62–1.95) 1.42 (0.27–7.4) 1.27 (0.24–6.63)
Data represented as number of subjects (genotypic distribution.%). Data represented as Odd’s ratio (95% confidence interval) ; p < 0.01 w.r.t control**

Association of IL-18 genotypes (-607C > A) and (-137 G > C) with HBV- HCC risk

As presented in table 1, the odd’s ratio for IL-18 (-607) genotype association with HBV disease progression showed genotype CA as a protective factor for HBV-cirrhotic subjects among controls. Also, this genotype was found to be protective for hepatitis [1.8 fold], cirrhosis [5.8

fold] and HBV-HCC (3.2 fold) subjects among HBV inactive carriers. However, no significant association for AA genotype was noticed. The odd’s ratio for the association between IL-18 (-137) genotypes and the advancement in disease showed that genotype GC as a significant risk factor for the chronic active hepatitis with control as a reference. Also, CC genotype was found to be a 2.7- and 2.5- fold risk for the HBV-hepatitis development among controls and carriers

respectively albeit non-significantly as shown in Table 2.

Association between IL-18 genotypes (-607C > A) and (-137 G > C) and HBV DNA load

Further exploration for association between IL-18 genotypes and HBV-DNA load was carried out. All the cases were categorized into two sub-groups based on HBV DNA load (> 10^− 3and < 10^− 3 IU/dL). The distribution characteristics of gene polymorphisms in the two groups are summarized in Table 3 .None of the genotypes studied showed any significant association with HBV DNA load.

Table 3.Association of IL-18( -137 & -607) genotypes with HBV DNA load

HBV-DNA LOAD

/(IU/DL)

Polymorphisms >10^-3 <10^-3 χ 2 p-value OR 95%CI

IL-18(- 607)

CC 37 54 0 .510 0.510 1.202 0 .695-2.079

CA 55 59 0.117 0.177 0.647 0 .375-1.116

AA 1 9 0.030 <.05 7.327 0.912-58.901

IL -18(-137)

GG 44 69 0 .462 0.462 1.217 0 .721-2.005

CG 46 61 0 .645 0.645 0 .884 0 .524-1.493

CC 6 6 0 .534 0.534 0.692 0.216 -2.215

HBV-DNA <1×10^-3 IU/mL; HBV-DNA ≥1×10^-3 IU/mL. p-value obtained from χ 2 test. AA compared with both CC and CA;* p<0.05.

Association between IL-18 genotypes [-607C > A] & [-137G > C] and HBeAG status

The status of HBeAg is very important in disease development from CHB to HCC. So we investigated association between genotype of IL-18 with HBeAg status. As shown in Table 4, the genotypes CC and CA of IL-18 (-607) showed significant (p < 0.001) positive association and significant (p < 0.001) negative association respectively with HBeAG status whereas AA genotype did not show any association (p = .663). Also,GG and GC genotypes of IL-18(-137) showed significant (p < 0.001) positive association and significant (p < 0.001) negative association respectively with HBeAG status and CC genotype showed no association.

Table 4

Association between *IL-18 (-607C > A) & (-137G > C)* genotypes and HBeAG status
	HBeAg
Genotypes	Neg. (n)	Pos. (n)	χ 2	p-value	OR	95% CI
IL-18(-607)
CC CA AA	13 65 3	83 51 7	0.000 0.000 0.633	< 0.000 < 0.000 0.633	7.485 0.139 1.358	3.786–14.798 0.073–0.226 0.341–5.404
IL-18(-137)
GG GC CC	65 100 9	47 7 3	0.000 0.000 0.979	< 0.000 < 0.000 0.979	7.882 0.104 1.019	3.729–16.660 0.044–0.241 0.266–3.899
OR, odd”s ratio : CI, Confidence interval ; χ 2 test for p-Value; p < 0.001 means statistically significant. Neg. (HbeAg negative) and Pos. (HbeAg Positive)*

Analysis of association between genotypes of IL-18 gene [-607C > A] and [-137 G > C] and biochemical parameters:

Analysis of associations between IL-18 (-137) genotypes and biochemical markers showed that levels of ALT (alanine transaminase), AST (aspartate transaminase) and ALP (alkaline phosphatase), TP [total protein] and ALB (albumin) had no significant difference among patients having CC, GC, GG genotypes. Significant association (p < 0.05) was, however, found among IL-18(-607) CA and CC genotypes with AST and TP levels as shown in Table 5.

Table 5

Association between genotypes of *IL-18 (-137 & -607)* and biochemical parameters
IL-18 (137- genotype)	AST	ALT	ALP	TP	Albumin
CC	27.4 (19–46)	37(11–52)	88(56–153)	-	4.9(0.1-8)
GC	43(3-1850)	43(9-1563	143(1.1–564)	7.5(0.3–22)	4.6(2.3–8.5)
GG	45(17-2440)	53.5(3-1320)	132(1-830	6.8(3.7–28)
P value	0.23^a	0.42^b	0.16^b	0.56^a	0.72^a
IL-18 (607- genotype)
CA	37(13-1850)	48.4(3-1319)	133(1.1–564)	11.2(4.6–111)	5(1.65–11.2)
CC	110(15-2440	36(10-1320)	139(1.0-352	6.9(3.0–28)	4(2.3–8.10)
P value	0.001^a***	0.37^a	0.83^a	0.01^a**	0.09^a
p-value obtained by ^a Kruskal wallis test (significance between 3 groups) ;p < 0.001, and* ^bMann- Whitney test ( significance between 2 groups ). Data represented as a median value (q1-q2).

Analysis of circulating IL-18 levels and its association with IL-18 genotypes

Inappropriate production of IL-18 contributes to the pathogenesis in various types of cancers and may affect the clinical outcome of patients [17]. So, serum IL-18 levels may have some prognostic significance. Thus, accordingly levels of IL-18 were quantified in serum samples of patients at different stages of infection of HBV and comparison with normal healthy controls was done. The mean levels of circulating IL-18 expressed as pg/ml were significantly increased in inactive carrier (58.98 ± 24.49; P < 0·05), hepatitis (61.90 ± 37.89; P < 0.01), HBV-related cirrhosis (70.51 ± 32.10; P < 0.001), and HBV-HCC patients (76.44 ± 22.22 pg/mL; P < 0·001) as compared to the normal healthy controls (43.23 ± 12.35). Also, significant difference was observed in IL-18 levels in inactive carrier (P < 0·001) and hepatitis (P < 0·05) patients when compared to HCC group. The representation of data of IL-18 as median ± interquartile range is shown in Fig. 2a.Further we investigated correlation between serum IL-18 levels with its genotypes, we observed no association between circulating cytokine levels (IL-18) and their associated genotypes as presented in Fig. 2b.

Analysis of levels of signal transducers (pSTAT1 and pNF-κB) in IL-18 stimulated PBMCs

Protein expression of pSTAT1 in isolated PBMCs stimulated by IL-18 in various categories revealed a consistent and significant increase in the expression level of pSTAT as the disease progressed from inactive carrier to HCC. Approximately 2-fold increase in the activated STAT was observed in HCC and cirrhosis categories as compared to control subjects as depicted in fig .3a. Moreover, a significant elevation in the levels of expression of pNFkB in stimulated PBMCs in hepatitis, cirrhosis and HCC as compared to healthy control was observed as shown in Fig. 3b.

India, the second highest populated country has nearly 50 million people afflicted with chronic HBV infection [prevalence ~ 4%]. The disease is mostly acquired horizontally, but the role of vertical transmission should not be underestimated [18]. In clinical subjects, infection with HBV leads to a variety of clinical conditions ranging from asymptomatic status to cirrhotic liver, and further progression towards HCC [19]. Inflammation is the initial step in development of HCC, and chronic hepatitis may promote hepato-oncogenic potential via inducing cirrhosis, although there are certain studies which depict that inflammation-mediated HCC can develop even in the absence of cirrhosis [20]. Cytokines are the key molecules in immune-modulation and are reported to play a pivotal part in HCC progression [21]. It has been stated that genotypes of cytokines serve a critical role in genetic regulation of immune responses against HBV and also determine an individual’s risk of developing HCC. Several studies have confirmed that SNPs associated with cytokine genes appear to be related with risk of HCC development [22–24]. Earlier studies from our lab have reported single-nucleotide polymorphisms in cytokine affect the production of cytokines greatly, thus modulate the immune balance outcome [25]. Also, a positive association of IL-10 (-819/-592) CC/TA genotype with HBV related disease progression and risk of HCC development was observed [26]. A role of IL-6 (− 572/−597] in the pathogenesis HBV disease was also found in Indian population [27]. In other study, the levels of IL-1B, a pro-inflammatory cytokine was determined to be significantly increased with the progression of disease to HCC thus indicating IL-1 has a fundamental role in the hepatitis B virus mediated disease chronicity in the Indian inhabitants [28].

IL-18 is a potent inducer of IFN-γ and believed to have a vital role in HCC development. It is secreted from macrophages and liver Kupffer cells [29]. The main function related to this cytokine is stimulation of IFN-γ secretion from CD4⁺ T_h1 cells, T-cells, B-cells as well as natural killer cells, particularly in association with IL-12 [30, 31]. IL-18 induces NK cells as well as T_h1 cells to express Fas ligand and stimulate perforin mediated cytotoxicity [32, 33]. Furthermore, IL-18 stimulates T_h1 cells to divide thus leading to IFN-γ, granulocyte macrophage colony stimulation factor, IL-2 and IL-2R α chain production, whereas no such action of IL-18 was observed on T_h2 cells [34, 35]. Moreover, IL-18 also induces the production of TNF- α, IL-1 and has a synergistic action with IL-12. When IL-12 is absent however, it induces Th2 response by inducing the synthesis of IL-4 and IL-10. Considering its immune modulatory functions, we hypothesized that this cytokine might have a role in the disease progression of HBV.

The present study evaluated how the IL-18 (-607/-137) genotypes, the circulating blood levels of IL-18 and also levels of signal transducers of IL-18 signaling pathway are associated with the progression of hepatitis B infection from the inactive carrier state to the malignancy. Genotypic distribution for IL-18(-137) showed genotype GG was the most common among all the groups and this study was found to be consistent with the study by Yelcin et al in which they observed genotype GG was the highest in CCL[Chronic lymphocytic leukemia] as well as healthy subjects [36]. Genotypic distribution for IL-18(-607) genotypes showed CA genotype was most prevalent among all the groups. Earlier study by Farjadfar et al [37] also showed that genotype CA as the most frequently distributed in both controls and lung cancer patients. Texeria et al[38] have observed different results in which they found higher frequency of the IL-18 -607(AA) genotype among HCC patients compared to healthy individuals in Brazilian population while Zhang et al [39] found same in Chinese Han population. This difference might be due to the genetic diversity of IL-18 genotypes in different regions and stresses upon the fact that genetic polymorphism studies should be encouraged to be carried out in different regions among different ethnic groups. When the association of the genotypes with HBV progression and subsequent HCC risk was studied, the IL-18 (-607) CA genotype was found to be a significant protective factor in Hepatitis B virus disease progression. This observation differed from the study conducted by Hasan et.al [40] who found no significant difference for CA genotype of IL-18(-607) in HBV infection. A study by Chang et al showed an association of the CA and CC genotypes of IL-18(− 607) with a significant decrease in the risk of renal cell carcinoma [RCC] compared with the AA genotype [41]. CC genotype of IL-18(-137) was a risk though the results were not significant. A study conducted by Zhao et al found similar results, CC genotype of IL-18 -137G/C had a 2.9 fold risk of breast cancer as compared to the CC genotype, and the CC genotype also showed an increased risk of breast cancer compared with the GG + GC genotype[42].This study was also somewhat similar to the study conducted by Lau et al [43] that patients carrying the IL-18 -137G/C polymorphism genotype have a high risk of HCC in Chinese Han population. The authors in this study had HCC patients only unlike our study where we have enrolled patients with different stages of disease pathology during the progression to HCC.

Upon analyzing the levels of circulating IL-18 in various categories, we found increased serum levels of IL-18 in all disease categories as compared to controls signifying a progressive increase during the progression of the disease. Parallel to this, a study conducted by Haghshenas et al. [44] also revealed increased serum levels of this cytokine in gastro-intestinal cancer patients when matched up with the controls. No significant association could be observed between circulating cytokine levels and their associated genotypes in our study. Contrary to this, Hassan et al. [45] have found the IL-18 levels and its associated genotypes were significantly associated in Iraqi population. This discrepancy may be due to the small sample size of our study.

HBeAg is a protein of hepatitis B virus which signifies virus is undergoing active replication and infected person with Hepatitis B can possibly spread the virus on to other person. HBeAg positivity has been found to be linked with higher risk of HCC [46, 47]. We carried out analyses in which we stratified subjects according to HBeAg positive and HBeAg negative groups and association between IL-18 genotypes and HBeAg status was observed. The (-607)-CC genotype showed a positive association (7-fold) with HBeAg positivity while CA genotype was negatively associated. Similarly, in case of IL-18(-137) genotypes, GG was found to be a highly negative factor [9.6 -fold] for HBeAg status while GC showed around 8- fold positive association. These observations corroborated our finding that the IL-18 (-607) CA genotype was a significant protective factor for HBV disease development. This is a novel finding and needs to be evaluated further. We also analyzed association between IL-18 (-137 & -607)genotypes with HBV-DNA load in all the patients and no significant association was observed. This is in parallel with the study conducted by Hua Jiang et al. [48] who observed that IL-18 (-137) genotype has no association with HBV DNA load. Analysis of association between IL-18(-137 & -607) genotypes and various biochemical parameters related to liver function tests were also carried out and we observed IL-18(-607) genotypes CA and CC showed significant association with AST and TP levels. Contrary to this study conducted by Lau et al found no significant association between IL-18 genotypes (-137) & (-607) with any of the biochemical parameters.

Most of the cytokine and chemokine production are mainly regulated at the transcriptional level via the expression of particular groups of transcription factors that are being controlled by NF-kB, IRFs and MAPKs [49, 50]. Free IL-18 gets bound to its specific cell surface receptor which is heterodimeric in nature belonging to superfamily of IL-1 receptor/Toll like receptor. It consists of two subunits namely IL-18Ra and IL-18Rb [51], comprising of three Ig-like domains extracellularly and one intracellular TIR (Toll/IL-1R domain) of IL-18 and IL-18Ra interaction alleviate its binding with IL-18Rb and with the MyD88 [myeloid differentiation factor] which is a adaptor protein through TIR domain [52, 53]. Thus signal transduction pathway is initiated by the employment of the IL-1 receptor activating kinase (IRAK). Auto-phosphorylation and dissociation of IRAK occurs from the receptor complex and it subsequently binds to TNFR-associated factor-6 (TRAF6) thus gradually leading to translocation of the nuclear factor kB (NF-kB) to nucleus. Interaction of the IL-18R complex can also cause STAT3, the mitogen-activated protein kinase (MAPK) p38, ERK and JNK activation [54]. The components of STAT family play a key role in production of the cytokines. As we have observed the elevated levels of circulating IL-18, it was imperative to check the status of its downstream signal transducers, we analyzed the expression of activated NF-KB and STAT1 in PBMCs in various disease categories. We found significant augmentation in the expression levels of pSTAT1 and pNFƙB in the HBV-HCC disease progression. There is no report available regarding the IL-18 induced activation of pSTAT1 and pNFƙB in HCC. However, our observation is in consistent with the study done by Zakiet al in which they have observed that IL-18 levels activate the expression levels of STAT1 in colorectal tumor [55]. Hirotadaet al. observed that signaling mediated by IL-18/IL-18R activate NF-κB via IRAK/TRAF6 pathway in murine lymphoblastEL-4 cells [56].

The major limitation of the study was the small sample size, which demands further investigation on a larger group of population to find the association of said genotypes to stratify HBV- patients on low and high risk categories. Also biomarker potential of IL-18 can be validated further in larger cohort studies among different populations.

Our study demonstrated IL-18(-607) CA genotype to be a protective factor for the progression of HBV-HCC disease. Levels of circulating IL-18 were found to be elevated with the progression of HBV-disease to HCC and hence should be evaluated for potential biomarker for HBV disease chronicity to malignancy. We demonstrated that IL-18 has a key role in the HBV-HCC disease pathogenesis through activation of signal transducers; STAT1 and NF-κB.

HCC, hepatocellular carcinoma; HBV, hepatitis B virus; HCV, hepatitis C virus; ROIs, reactive oxygen intermediates; NO, Nitric oxide, PBMCs, peripheral blood mononuclear cells; pSTAT 1, phosphorylated signal transducer and activator of transcription; NF-κB, phosphorylated signal transducer and activator of transcription; PCR-RFLP, Polymerase chain reaction- restriction fragment length polymorphism; IFN-γ, interferon gamma; SNPs, Single nucleotide polymorphisms; HBeAG, hepatitis B e-antigen; CHB, chronic hepatitis B.

Acknowledgements

We express our immense gratitude to the participants and their families. The contribution of Mr Chander Mohan and Mr Gurpreet Singh, laboratory technologists is duly acknowledged. We acknowledge the financial support (grant number: SR/S0/HS-0043/2012) from Department of Science and Technology (DST), New Delhi

Authors’ contribution

Dr Jyotdeep Kaur and Dr Roli Saxena planned the study. Dr Yogesh Kumar Chawla enrolled and diagnosed the patients. Sample collection was done by Taqveema Ali and Roli Saxena. Taqveema Ali, Roli Saxena, Isha Rani, Renuka Sharma, Deepti More, Rajendra Ola, Stuti Agarwal performed experiments and collected data. Dr. Jyotdeep Kaur and Taqveema Ali analyzed and interpreted data. Dr Jyotdeep Kaur and Taqveema Ali drafted manuscript and all the authors approved the draft of the submitted manuscript.

Conflicts of Interest: Authors declare no conflict of interest

Data availability statement: The authors confirm that the data supporting the findings of this study are available within the article.

Afifi AF, Basha OM, Saleem WM (2016) Evaluation of serum nitric oxidase as a diagnostic and prognostic marker in patients with hepatocellular carcinoma. Indian J of Applied Research 6:249–255
Bullrich F, Fujji H, Calin G, Mabuchi H et al (2001) Characterization of the 13q14 tumor suppressor locus in cell: Identification of alt1, An alternative splice variant of the leu2gene. Cancer res 61:6640–6648
Kitagawa N, Ojima H, Shirakihara T et al (2013) Downregulation of the microRNA biogenesis components and association with poor prognosis in hepatocellular carcinoma. Cancer Sci 104:543–551
Garzon R, Calin GA, Croce CM (2009) Micro-RNAs in cancer. Annu rev med 60:167–179
Ding X, Mizokami M, YaI G et al (2001) Hepatitis B virus genotype distribution among chronic hepatitis B virus carriers in Shangai. China Intervirolgy 44:43–47
Koziel MJ (1999) Cytokines in viral hepatitis. Semin Liver Dis 19:157–169
Kakimi K, Lane TE, ChisariFv, Guidotti LG (2001) Cutting edge: inhibition of hepatitis B virus replication by activated NK T cells does not require inflammatory cell recruitment to the liver. J Immunol 167:6701–6705
Markowitz GJ, Yang P, Fu J et al (2016) Inflammation-Dependent IL18 Signaling Restricts Hepatocellular Carcinoma Growth by Enhancing the Accumulation and Activity of Tumor-Infiltrating Lymphocytes. Cancer Res 76:2394–2405
Fukao T, Matsuda S, Koyasu S (2000) Synergistic Effects of IL-4 and IL-18 on IL-12-Dependent IFN-γ Production by Dendritic Cells. J Immunol 164:64–71
Nattiya H, Manonom C, Tangkijvanich P, Poovorawan Y (2007) Association of interleukin-18 gene polymorphism [-607A/A genotype] with susceptibility to chronic hepatitis B virus infection. Tissue antigens 70:160–173
Xia P, Zhou M, Dong DS et al (2014) Association of polymorphisms in interleukin-18 and interleukin-28B genes with outcomes of hepatitis B virus infections: a meta-analysis. Tumor Biol 35:1129
Ferreira SC, Chachá SF, Souza FF, Teixeira AC, Santana RC (2015) IL-18, TNF, and IFN‐γ alleles and genotypes are associated with susceptibility to chronic hepatitis B infection and severity of liver injury. J Med Virol 87:1689–1696
Sawai H, Nishida N, Sawai HM et al, No association for Chinese HBV elated hepatocellular carcinoma susceptibility SNP in other East Asian populations, BMC Med Genet. 2012; 47
Wang Z, Huang Y, Wen S, Zhou B, Hou J (2007) Hepatitis B virus genotypes and sub genotypes in China. Hepatol Res 37:36–41
Kumar A, Kumar SI, Pandey R, Naik S, Aggarwal R (2005) Hepatitis B virus genotype A is more often associated with severe liver disease in northern India than is genotype D. Indian J Gastroenterol 24:19–22
Zhang H, Zhai Y, Hu Z, Wu C, Qian J, Jia W, Ma F, Huang W, Yu L, Yue W et al (2010) Genome-wide association study identifies 1p36.22 as a new susceptibility locus for hepatocellular carcinoma in chronic hepatitis B virus carriers. NatGenet 42:755–758
Lebel-Binay S, Berger A, Zinzindohoué F et al (2000) Interleukin-18: biological properties andclinical implications. Eur Cytokine Netw 11:15–26
Puri P (2014) Tackling the hepatitis B disease burden in India. J Clin Exp Hepatol 4:312–319
Hollinger FB, Liang TJ, Knipe DM, Howley PM, Griffin DE, LambRA, Martin MA, Roizman B et al, editors. Hepatitis B: The virus and Disease; 2001;49: 2971–3036
Tacke F, Luedde T, Trautwein C (2009) Inflammatory pathways in liver homeostasis and liver injury. Clin Rev Allergy Immunol 36:4–12
Zekri AN, El Deeb S, Bahnassy AA et al (2018) World J Gatroenterol 11:1228–1238
Nieters A, Yuan JM, Sun CL et al (2005) Effect of cytokine genotypes on the hepatitis B virus-hepatocellular carcinoma association. Cancer 103:740–748
Insights into cytokine gene polymorphisms (2016) World J Gastroenterol 22:6800–6816
Bidwell J, Keen L, Gallagher G et al (1999) Cytokine gene polymorphism in human disease: on-line databases. Genes Immun 1:3–19
Saxena R, Kaur J (2015) Th1/Th2 cytokines and their genotypes as predictors of hepatitis B virus related hepatocellular carcinoma. World J Hepatol 7:1572–1580
Saxena R, Chawla Y, Kaur J (2014) Association of Interleukin-10 with HBV mediated disease progression in Indian population. Indian J Med Res 139:737–745
Saxena R, Chawla Y, Kaur J (2014) IL-6[-572/-597] polymorphism and expression in HBV disease chronicity in Indian population. Am J Hum Biol 26:549–555
Saxena R, Chawla Y, Kaur J (2013) IL-1 polymorphism and expression in HBV mediated disease outcome in India. J Interferone Cytokine Research 33:80–89
Okamura H, Tsutsui H, Kashiwamura S et al (1998) Interleukin-18: a novel cytokine that augments both innate and acquired immunity. Adv Immunol 70:281–312
Micallef MJ, Ohtsuki T, Kohno K et al (1996) Interferon-γ-inducing factor enhances T helper 1 cytokine production by stimulated human T cells: synergism with interleukin-12Eur. J Immunol 26:1647–1651
Yoshimoto T, Okamura H, Tagawa YI et al. Interleukin 18 together with interleukin12 inhibits IgE production by induction of interferon-gamma production from activated B cells. Proc. Natl Acad. Sci,1997; 94: 3948–3953
Tsutsui H, Nakanishi K, Matsui K et al (1996) IFN-γ-inducing factor up-regulates Fas ligand-mediated cytotoxic activity of murine natural killer cell clones. J Immunol 157:3967–3973
Tsutsui H, Matsui K, Kawada N et al (1997) IL-18 accounts for both TNF-α- and Fasligand-mediated hepatotoxic pathways in endotoxin-induced liver injury in mice. J Immunol 159:3961–3967
Micallef MJ, Ohtsuki T, Kohno K, Anabe F, Ushio S, Namba M, Tanimoto T, Torigoe K, Fujii M, Ikeda M, Fukuda S, Kurimoto M (1996) Interferon-γ-inducing factor enhances T helper 1 cytokine production by stimulated human T cells: synergism with interleukin-12 for interferon-γ production. Eur J Immunol 26:1647–1651
Ahn HJ, Maruo S, Tomura M,et al (1997) A mechanism underlying synergy between IL-12and IFN-γ-inducing factor in enhanced production of IFN-γ. JImmunol 15:2125–2131
Yalcin S, Mutlu P, Cetin T et al (2015) The – 137G/C Polymorphism in Interleukin-18 Gene Promoter Contributes to Chronic Lymphocytic and Chronic Myelogenous Leukemia Riskin Turkish Patients. Turk J Hematol 32:311–316
Farjadfar A, Mojtahedi Z, Ghaderi A, et (2008) al.Interleukin-18 promoter polymorphism isassociated with lung cancer: A case-control study. Acta Oncol 48:971–976
Teixeira AC, Martinelli AC, Donadi EA (2013) Role of Alleles and Genotypes of Polymorphisms of IL-18 [-607 C/A; and – 137 C/G], IFN-γ [+ 874 A/T] and TNF-α [-238 A/G and – 308 A/G] and HLA-G Genes in the Susceptibility of Hepatocellular Carcinoma. Hum Immunol 74:1024–1029
Zhang QX, Yao YQ, Li SL, Long Q (2016) Association between interleukin-18 gene polymorphisms and hepatocellular carcinoma caused by hepatitis B virus. Chinese J hepatology 24:352–357
Hasan FT, Hassan,Nai HM (2017) Association of Gene Polymorphisms and Serum Levelsof IL-18 with the Susceptibility to Infection with Hepatitis B Virus. J Infect Dis Med 3:1420
ShenT WS, Yeh C, Yu WL, Lin C, Wu HY (2019) H C. Contribution of Inflammatory Cytokine Interleukin-18 genotypes to the Renal Cell Carcinoma.Int. J Mol Sci 20:1563
Zhao Y, Wang S, Zhang Z, Qin C, Yang X, Xie Q (2017) Association of IL-18 genetic polymorphisms and haplotypes with breast cancer risk in a Chinese population. Biomed Res 28:8433–8437
Lau HK, Hsieh MI, Yang SF, Wang HL, Kuo WH, Lee HL, Yeh CB (2016) Association between Interleukin-18 Polymorphisms and Hepatocellular Carcinoma Occurrence and Clinical Progression. Int J Med Sci 13:556–561
Haghshenas MR, Hosseini SV, Mahmoudi M et al (2009) IL-18 serum level and IL-18promoter gene polymorphism in Iranian patients with gastrointestinal cancers. J Gastroenterol Hepatol 24:1119–1122
You S-L, Yang H-I, Chen C-J (2004) Seropositivity of hepatitis B e antigen and hepatocellular carcinoma. Ann Med 36:215–224
Yang HI, Lu SN, Liaw YF, You SL, Sun CA, Wang LY, Hsiao CK, Chen PJ, Chen DS, Chen CJ (2002) Hepatitis B e antigen and the risk of hepatocellular carcinoma. N Engl J Med 347:168–174
Dai ZJ, Liu XH, Wang M, Guo Y, Zhu W, Li X, Lin S, Tian T, Liu K, Zheng YI, Xu P, Jin TJ, Li X (2017) IL-18 polymorphisms contribute to hepatitis B virus-related cirrhosis and hepatocellular carcinoma susceptibility in Chinese population: a case-control study. Oncotarget 46:81350–81360
Bao J, LuY, Deng Y, Rong C, Liu Y, Huang X, Song L, Li S, Qin X, Association between IL-18 polymorphisms, serum levels, and HBV-related hepatocellular carcinoma in a Chinese population: a retrospective case–control study, Cancer Cell Int,2015;72
Dai K, Sayama, Yamasaki K, Tohyama M, Shirakata Y, Hanakawa Y, Tokumaru S, Yahata Y, Yang L, Yoshimura A, Hashimoto K (2006) SOCS1-negative feedback of STAT1 activation is a key pathway in the dsRNA induced innate immune response of human keratinocytes. J Invest Dermatol 126:1574–1581
Mogensen TH, Paludan SR (2001) ,.Molecular pathways in virus-induced cytokine production. Microbiol Mol Biol Rev 65:131–150
Born TL, Thomassen E, Bird TA, Sims JE (1998) Cloning of a novel receptor subunit, AcPL, required for interleukin-18 signaling. J Biol Chem 273:29445–29450
Takeda K, Akira S (2005) Toll-like receptors in innate immunity. Int Immunol 17:1–14
Matsumoto M, Funami K, Seya T (2004) Toll like receptor 3: a link between toll-like receptor, interferon and viruses. Microbiol Immunol 48:147–154
Albani S, Cervia D, Sugama S, Conti B (2010) Interleukin 18 in CNS. Journal of Neuro-inflammation 9:2094–2099
Zaki MH, Vogel P, Malapel MP, Lamkanfi M, Kanneganti TD (2010) IL-18 Production Downstream of the Nlrp3 Inflammasome Confers Protection against Colorectal Tumor Formation. J Immunol 185:4912–4920
Kojima H, Takeuchi M, Kurimoto M, Nishida Y, Arai N, Ikeda M, Ikegami Y, Kurimoto M.Interleukin-18 Activates the IRAK-TRAF6 Pathway in Mouse EL-4 Cells, Biochemical and Biophysical Research Communications,1998;244: 183–186

Association of Interleukin-18 genotypes (-607 C>A ) and (-137 G>C) with the hepatitis B virus disease progression to hepatocellular carcinoma

Status:

Version 1

Abstract

Figures

Introduction

Materials And Methods

Results

Genotype distribution of IL-18 genotypes [-607C > A] and [-137 G > C]

Association of IL-18 genotypes (-607C > A) and (-137 G > C) with HBV- HCC risk

Discussion

Conclusions

Abbreviations

Declarations

References

Status:

Version 1