Virulence of Listeria monocytogenes in mice is enhanced by deletion of pathogenicity island 4

doi:10.21203/rs.3.rs-2099684/v1

Background

Listeria monocytogenes is a facultative anaerobic zoonotic intracellular pathogen. Pathogenicity island 4 (LIPI-4) is a newly discovered virulence gene cluster involved in the central nervous system (CNS) infection of L. monocytogenes. To explore the role of LIPI-4 in the virulence of L. monocytogenes, a frozen chicken isolate LM928 LIPI-4 gene deletion strain (ΔLIPI-4) and complement strain (CΔLIPI-4) were constructed to infect human brain microvascular endothelial cells (HCMECs). The effect of LIPI-4 on L. monocytogenes virulence was determined through bacterial adhesion, cellular invasion, and intracellular proliferation evaluation by noting the median lethal dose (LD₅₀) in mice, the number of bacteria in the tissue, and the expression of virulence factors in vivo and in vitro by RT-qPCR.

Results

The results showed that LIPI-4 deletion decreased cellular adhesion, cellular invasion, and intracellular proliferation of L. monocytogenes to HCMECs cells. The LD₅₀ of ΔLIPI-4 infected mice was 1.0 and 0.7 orders of magnitude lower than that of LM928 and CΔLIPI-4, respectively. The tissue load of ΔLIPI-4 was significantly higher (P < 0.05) than that of LM928 and CΔLIPI-4. In BHI culture, the expression of important virulence genes was significantly down-regulated (P < 0.01) in the ΔLIPI-4 strains. However, transcription levels of actA, inlA, inlB, and inlC were significantly up-regulated (P < 0.01) while hly, prfA, plcA, and plcB were significantly down-regulated (P < 0.01) in ΔLIPI-4 infected HCMECs.

Conclusion

This data suggests that LIPI-4 acts as a virulence factor involved in L. monocytogenes infection. Its deletion may contribute to decreasing the virulence of L. monocytogenes in mice.

Listeria monocytogenes

LIPI-4

virulence

CNS infection

Zoonoses

Listeria monocytogenes is a gram-positive bacteria that primarily cause encephalitis, meningitis, septicemia, abortion, and febrile gastroenteritis in humans and a variety of animals [1–3]. It is known to infect more than 30 host species including ruminants, where it causes severe listeriosis. It exists widely in the natural environment and is commonly found in human and animal feces, soil, aquatic environments, and foods such as cheese, milk, eggs, sausages, and vegetables [3] Although the number of people infected with the bacteria per year is low, the resulting mortality rate can be as high as 20–30% [4].

Many virulence genes are involved in the process of L. monocytogenes infection. These important virulence genes are mainly concentrated in Listeria pathogenicity island 1 (LIPI-1) and Listeria pathogenicity island 2 (LIPI-2). LIPI-1 contains six genes, namely: prfA, plcA, hly, mpl, actA, and plcB. LIPI-2, also known as the Internalins, mainly contains inlA, inlB, inlC, as well as some other genes[2, 5, 5]. The hly gene encodes Listeriolysin O (LLO), PI-PLC (PlcA), and PC-PLC (PlcB), which are important factors for the bacteria to escape internalizing vacuoles and cleavage host cell membrane structures[7]. Mpl, encoded by the mpl gene, mediates the intracellular proliferation and virulence of L. monocytogenes by hydrolyzing the precursor protein of PC-PLC to the active state [8]. In the acidic environment of phagosomes, Mpl is first activated by self-cleavage, and then the activated Mpl hydrolyzed to the precursor PC-PLC protein to assist it in membrane cleavage [9]. ActA not only promotes the movement of bacteria in the cytoplasm and the spread of bacteria between cells but also enables L. monocytogenes to escape cell phagocytosis [10]. InlA is one of the earliest confirmed virulence factors related to bacterial invasion and is involved in the internalization of phagosomes during bacterial invasion [11, 12]. InlB interacts with other receptors on the L. monocytogenes cell wall, mediating L. monocytogenes adhesion and invasion of hepatocytes and non-phagocytes[13]. Previous studies have shown that the virulence of L. monocytogenes is mainly achieved through the interaction between the InlC protein and the SH3 region of the host cytoplasmic receptor Tuba. This interaction inhibits the Tuba protein, thus disturbing the Tuba/N-WASP immune complex and compromising the connection of intestinal epithelial cells and enhancing the diffusion ability of L. monocytogenes between cells[14] .

Listeria monocytogenes transports carbohydrates in two ways: through the phosphoenolpyruvate (PEP)-phosphotransferase system (PTS) and the adenosine triphosphate binding cassette transporter system (ABCtrans-porter). Considered the "nervous system" of bacteria, PTS can sense and respond to extracellular stimuli and intracellular metabolite levels as well as catalyze the transport and phosphorylation of various carbohydrates and their derivatives [15]. It can also affect the formation of biofilm and the expression of virulence genes[16–19]. According to the complete sequence analysis of model strain EGD-e, L. monocytogenes contains 86 PTS genes, encoding 29 complete PTS systems and 12 independent EIIA, EIIB, EIIC, EIIB, and EIIBC components. Stoll [20] found that the PTS system of L. monocytogenes mainly belongs to the Lac (6 complete Lac components, 8 independent components) and Fru family (8 complete Fru components). LIPI-4 is essentially a phosphoenolpyruvate (PEP) phosphotransferase system (PTS) of the Lac family, but a pangenomic analysis of 104 strains of L. monocytogenes showed that LIPI-4, does not exist in L. monocytogenes reference strain EGD-e [21].

There are several virulence factor gene clusters in the L. monocytogenes genome, where the proteins encoded by these gene clusters play an important role in the process of infection. Listeria monocytogenes pathogenicity island 4 (LIPI-4) consists of six genes, namely, membrane permease EIIA, EIIB, and EIIC, an uncharacterized protein associated with the PTS system ( pts X), transcriptional antiterminator, and maltose-6’-P-glucosidase [22, 23]. Maury [21] analyzed the genomes of 104 representative L. monocytogenes strains from different sources and identified 15 putative virulence factor genes/clusters that are present in highly virulent isolates but absent in reference strains. In a preliminary study of LIPI-4, it was found that strain LM09-00558 which carries the LIPI-4 gene cluster was able to infect the CNS more efficiently than the reference strain EGD-e, whether in an oral humanized mouse or an intravenous model. No difference in bacterial colonization of other tissues was found. The LIPI-4 gene deletion strain had a significantly lower bacterial colonization rate in mouse brain, maternal placenta, and fetus cells than the parental strain, but no difference was observed in blood cells. Therefore, LIPI-4 is considered the first specific virulence factor closely associated with CNS and maternal-fetal infections.

As a PTS system of the Lac family, the role of LIPI-4 in the pathogenesis of L. monocytogenes is not well studied. Here, the virulence of LIPI-4 deletion mutants in vivo and in vitro was investigated. This work forms part of the foundational research into the role of LIPI-4 in the pathogenesis of L. monocytogenes.

Mutagenesis And Complementation

The 15th generation of bacteria cultured in chloramphenicol-free BHI medium at 30 ℃ (Fig. 1A) as well as the 1st, 5th, 10th, 15th, and 20th generations of ∆LIPI-4 (Fig. 1B) at 37 ℃ were screened using the D-F and D-R primer set. A 1051bp fragment of the LIPI-4 gene was amplified. Subsequent sequencing of the amplified product confirmed that the LIPI-4 deletion strain was successfully constructed and that the strain had genetic stability. Additionally, a 6010 bp fragment was amplified from C∆LIPI-4 using the C-F and C-R primer set (Fig. 1C), which was sequenced to confirm the successful construction of the complementation strain of ∆LIPI-4.

Determination Of Growth Curve

Growth trends of the wild-type, deletion strain, and complementation strain were similar, with a growth adaptation period from 0–2 h, a logarithmic phase with rapid growth from 2–8 h, and a growth stable phase from 8–14 h (Fig. 2). These growth trends were stable, and the growth difference was not statistically significant (P > 0.05). This indicates that the deletion of the LIPI-4 gene had no significant effect on the growth characteristics of LM928 in BHI.

Adhesion And Invasion Rates And Intracellular Colonization

Three LM infected HCMECs cells were used for the adhesion and invasion test. Both the invasion and adhesion rates of ΔLIPI-4 were significantly lower (P < 0.01) than those of wild strains (Fig. 3).

All three strains of L. monocytogenes showed an increased bacterial load in HCMECs cells but ΔLIPI-4 showed a significant decrease in growth rate compared to the wild strain (P < 0.01) (Fig. 4).

Half Lethal Dose (Ld)

The LD₅₀ of the deletion strain was 10^4.3 CFU/mL; the LD₅₀ of the wild-type strain was 10^5.3 CFU/mL, and the LD₅₀ of the complementation strain was 10⁵ CFU/mL. The virulence of the deletion strain was decreased by 1.0 and 0.7 orders of magnitude, respectively, compared to the wild-type and complementation strains (Table 3).

Bacterial Load In Mouse Tissues

Mice injected with either the ΔLIPI-4, wild-type, or CΔLIPI-4 strains showed symptoms of lethargy, loss of appetite, and muscle tremors. Pathological anatomy showed that there were obvious pathological changes such as swelling, hyperemia, and white pathological foci in the liver and spleen, and some pathological changes such as swelling and hydrocephalus in the brain.

On the 3rd, 4th, and 5th day after infection, the number of living bacteria in the liver, spleen, and brain of wild-type and CΔLIPI-4 challenged mice was lower than that of mice infected with LIPI-4 deletion mutant (Fig. 5), which suggests that the loss of LIPI-4 led to an increase of virulence of L. monocytogenes.

Δlipi-4 Down-regulated The Transcription Level Of Virulence Genes In Vitro

After LIPI-4 gene deletion, the transcription levels of virulence genes hly, prfA, plcA, inlA, inlB, inlC, and mpl were significantly down-regulated (P < 0.01), but there was no significant difference between transcription levels of actA and plcB (P > 0.05) (Fig. 6).

Regulation Of Virulence Gene Transcription After Infection Of Hcmec By Δlipi-4

At the cellular level, after deletion of the LIPI-4 gene, the transcription levels of virulence genes hly, prfA, plcA, and plcB were significantly down-regulated (P < 0.01), while the transcription levels of actA and inlA were significantly up-regulated (P < 0.01). The transcription levels of inlB and inlC were significantly up-regulated (P < 0.05). There was no significant difference in mpl transcription levels (P > 0.05) (Fig. 7).

Listeria monocytogenes is a very important foodborne pathogen. Genomes of different lineages and serotypes usually have multiple virulence factor gene clusters, which play an important role in their pathogenicity. Since the discovery of LIPI-4 [21], its role and mechanism in the pathogenesis of L. monocytogenes are still being explored. In this study, we constructed LM928 LIPI-4 gene deletion and complement strains from frozen chicken isolates to study the influence of LIPI-4 on bacterial virulence and pathogenicity. Previous laboratory results showed no significant difference in cell activity when at a multiplicity of infection of 10:1, 50:1 or 100:1 infected HCMECs, but the transcription levels of intracellular virulence factors were the same in the later stage, thus inoculums at a multiplicity of infection of 100:1 (bacteria / eukaryotic cell) were used to infect cerebral microvascular cells. The adhesion, invasion, and intracellular proliferation of the ΔLIPI-4 strain were significantly lower than those of wild-type strains, suggesting a negative influence on bacterial virulence. The results of this study were consistent with those of other PTS system tests. For example, Joseph [24] conducted cell infection experiments that showed that the number of L. monocytogenes EGD-e EⅡC gene deletion strains specifically transporting pentosol in Caco-2 cells was significantly lower than that of wild strains. Liu [25] constructed a fructose PTS EⅡ ABC gene deletion strain from the F2365 strain and the results showed that ΔLMOF2365-0442, which encodes EIIA, significantly reduced the invasion and intercellular transmission of F2365 HT-29. We therefore hypothesize that LIPI-4 is involved in determining the virulence of L. monocytogenes, although the detailed mechanism connecting LIPI-4 with virulence still requires further study.

In the course of this research, it was found that CΔLIPI-4 showed lower proliferation than wild-type and deletion strains in the cell test. This may be due to the fact that the promoter P_help in the vector pIMK2 used by the complementary strain is a strong promoter, which will lead to the overexpression of LIPI-4 and inhibit the expression of some proliferation-related genes, resulting in the inhibition of bacterial proliferation and a decrease in the bacterial population. On the other hand, observed results may be due to the excessive size of the plasmid - the target fragment of LIPI-4 is about 6kb and the recombinant plasmid pIMK2-LIPI-4 is about 12kb. This could cause the host bacteria to spend more energy on survival rather than proliferation. In this study, when three L. monocytogenes strains were resuscitated simultaneously, it was found that the single colony of CΔLIPI-4 was always smaller than that of the wild-type strain and ΔLIPI-4 under the same conditions. We speculate that this was due to the fact that CΔLIPI-4 consumed more carbon sources than the other strains (Supplementary Fig. 1).

To determine the virulence of LIPI-4 in mice, Kunming mice were injected intraperitoneally with L. monocytogenes. The LD₅₀ of the deleted strain was 1.0 and 0.7 orders of magnitude lower than that of the wild and complement strains, respectively. On the 3rd, 4th, and 5th day after infection, the number of bacteria in the liver, spleen, and brain of deleted strain ΔLIPI-4 was significantly higher than that of the parent and complementary strains. This suggests that the deletion of the LIPI-4 gene enhanced the virulence of LM928 (CC87, ST87). This result is contrary to that of Maury [21]. Possible explanations for this result include (1) Specificity of clinical isolates: the strain used in this study was from the CC87 (ST87) clone group, while the strain LM09-00558 used in Maury was from the CC4 clone group. Clone groups CC1, CC4, and CC6 are most common in clinical cases. Compared with the common laboratory reference strains EDGe and 10403s, these clinical strains are super virulent as they cause greater weight loss and neuroses[22]. Strain ST87 is one of the most common strains found in food, food-related environments, and sporadic listeriosis in China. Interestingly, Wang [25] and Zhang [27]proved that all ST87 L. monocytogenes colonies isolated in China contain the LIPI-4 gene region. (2) Different animal models: Kunming mice were used in this study, while humanized mice were used in Maury [21]. Both InlA and InlB are important virulence factors related to bacterial invasion, and there are host species differences in their respective receptors. It is known that InlA is a necessary protein for L. monocytogenes to cross the host intestinal barrier [28]. It has also been found that the specific receptor of InlA is E-cadherin, and it can bind to the E-cadherin receptor in human, guinea pig, and rabbit intestinal epithelial cells. Because of the receptor differences between different species, there are interspecific differences in the internalization process of L. monocytogenes [28, 29]. The binding of InlB to tyrosine kinase (Met) can activate a series of signal pathways to stimulate actin cytoskeleton rearrangement, thus enhancing bacterial internalization and enabling L. monocytogenes to invade hepatocytes [30]. The binding of the concave structure of InlB and LRR (leucine repeat region) to host cell Met can stimulate the vacuolar protein-dependent pathway to mediate the cell endocytosis mechanism[31]. Recent studies have shown that the interaction between InlB and Met is species-specific, where InlB can bind to Met receptors in mice, gerbils and humans, but not to Met receptors in guinea pigs and rabbits[13]. (3) The artificial infection of mice can follow different protocols and although the main route of infection of L. monocytogenes is oral, because of the absence of E-cadherin, it cannot promote the entry of L. monocytogenes into intestinal cells. This study chose intraperitoneal injection to infect mice to bypass the intestinal barrier and distribute L. monocytogenes to the whole body. Xie [32]constructed the deletion strains of EII (cel-EII) complex of THN0901 (virulent strain) and TFJ0901 (attenuated strain) cellobiose-phosphotransferase system, respectively. The results showed that the virulence and histopathological damage of Δcel-EII-TFJ0901 were significantly enhanced, and its competitiveness in vivo and in vitro was also stronger than that of TFJ0901. The expression levels of manA and ascA/C of Δcel-EII-TFJ0901 PTS, ciaR, and dltR of two-component signal transduction system (TCS) and virulence genes pavA, bca, and spb1 were significantly up-regulated. The Δcel-EII-TFJ0901 complex may have a negative effect on the virulence of TFJ0901 by regulating the expression of virulence-related genes, but the negative regulation mechanism of Δcel-EII complex has no significant effect on the virulence of THN0901. Whether LIPI-4 has different regulatory effects on the virulence of L. monocytogenes among strains with different virulence needs further study.

PrfA normally positively regulates the transcription levels of other virulence genes, but the protein activity of PrfA is regulated by the culture conditions, and the activity of the PrfA protein is reduced in L. monocytogenes in a rich medium (e.g., BHI) [33], which may explain why ΔLIPI-4 resulted in a highly significant reduction in the transcript levels of most 78% (7/9) of the important virulence genes under BHI culture conditions. At 12 h after infection of HCMEC cells, the transcriptional levels of prfA, hly, plcA, and plcB genes in ΔLIPI-4 were significantly down-regulated, while those of actA, inlA, inlB, and inlC genes were significantly up-regulated. The adhesion, invasion, and intracellular proliferation of ΔLIPI-4 to HCMECs were lower than those of wild strains, but the transcriptional levels of actA, inlA, inlB, and inlC genes were up-regulated, suggesting that the ΔLIPI-4 strain was more virulent in the mice. Firstly, this could be due to the fact that the adhesion, invasion, and intracellular proliferation of bacteria to certain host cells is not necessarily positively correlated to the virulence of the bacteria, as bacterial pathogenicity is a complex and dynamic process, and there are many influencing factors. Secondly, the deletion of LIPI-4 leads to an increase in the transcription levels of some virulence factors of L. monocytogenes as well as the increased expression of these genes in mice, which may play an important role in the pathogenicity enhancement of L. monocytogenes. This, however, needs to be verified by the detection of virulence gene transcription levels in other cells and mouse organs after L. monocytogenes infection. Thirdly, actA, inlA, inlB and inlC virulence genes may not play a role in LM928 infecting HCMEC.

In addition to PrfA, there are more than 200 regulatory factors involved in the regulation of virulence in Listeria monocytogenes [34] Among them, the response regulatory factor VirR is the second largest virulence regulatory factor after PrfA in L. monocytogenes, which is responsible for regulating 12 virulence genes including dltA [35]. MogR and DegU are involved in regulating the movement ability of bacteria[36, 37]. PerR and FurR regulate the absorption and storage of iron ions [38]. As an important anti-stress factor, SigmaB regulates its own activity when the bacteria encounters stress, to maintain the survival of bacteria under stress[39]. Whether the deletion of LIPI-4 leads to changes in the transcriptional levels of the above transcriptional regulatory factors in vivo and in vitro, which will lead to the enhancement of ΔLIPI-4 virulence, needs further study.

L. monocytogenes LIPI-4 is a newly discovered virulence gene cluster, but its role in the pathogenicity of the LIPI-4 carrier strain and its threat to public health is unknown. The findings from this study add to the growing body of knowledge on the importance of this gene cluster, and its possible role in the control of L. monocytogenes as a human and animal pathogen.

Bacterial strains, plasmids and cells

Wild-type L. monocytogenes strain LM928 (CC87, ST87) was isolated from infected frozen chicken from Xinjiang. The temperature-sensitive shuttle vector pKSV7 was obtained from Zhejiang University, China while the integration plasmid pIMK2 was kindly received from Professor Yin Yuelan of Yangzhou University, China. Immortalized human brain microvascular endothelial cells (HCMECs) were purchased from the Beina Chuanglian Institute of Biology. Six to eight-week-old Kunming mice were purchased from the Animal Experimental Center of Xinjiang Medical University.

Primers

Primers were designed using the L. monocytogenes strain LM09-00558 genome in GenBank (accession number GCA_001565535.2) using Primer 5.0 software (Table 1). The LIPI-4 gene deletion strain was constructed with primers F1 and R1, and the primers D-F and D-R were selected. Complementary strain were constructed with LIPI-4 gene amplification primers C-F and C-R.

Table 1

Polymerase chain reaction primers used in this experiment
Primers	Sequence(5′→3′)	Product length (bp)	Target gene
F1	CGCGGATCCAAATAGCCCCCCGTTAGACTCCA( Pst Ⅰ )	451	Upstream sequence of the LIPI-4 gene
R1	GAAAGGAAATGAAAATCAGTATCAAACATCGTATGACG	451	Upstream sequence of the LIPI-4 gene
F2	GTCATACGATGTTTGATACTGATTTTCATTTCCTTTC	342	Downstream sequence of the LIPI-4 gene
R2	AAAACTGCAGAGTCACTGGCAGCAGGTATGGGA ( BamH Ⅰ )	342	Downstream sequence of the LIPI-4 gene
D-F	GCGATTATTACGGCACTTGC	7061/1051	Detecting primers
D-R	TTAGTTTATGGCGATGTCG	7061/1051	Detecting primers
C-F	AACTGCAGATGAAAGCATTAGAACGATTTCTGT ( Pst Ⅰ )	6010	LIPI-4 gene
C-R	CCGCTCGAGTTATTTTAATTCTGGCCAAAATGCT (Xho Ⅰ )	6010	LIPI-4 gene
hly-F	CTGAATTCGGCTGTTACTAA AGAGCAGTTGC	749	Identification of L. monocytogenes
hly-R	ATGGATCCTTAGCCCCAGAT GGAGATATTTCTA	749	Identification of L. monocytogenes

Table 2. RT-qPCR primers used in this experiment

Primers	Sequence（5′→3′）	Amplicon size (bp）
RT-gyrB-F	AGACGCTATTGATGCCGATGA	91
RT-gyrB-R	GTATTGCGCGTTGTCTTCGA	91
RT-hly-F	ATTGCGCAACAAACTGAAGC	110
RT-hly-R	TCGATTGGCGTCTTAGGACT	110
RT-prfA-F	GCCAACCGATGTTTCTGTATCA	115
RT-prfA-R	TGGTATCACAAAGCTCACGAGT	115
RT-inlA-F	AAAGATATAGGCACATTGGCGAG	91
RT-inlA-R	GACCCGACAGTGGTGCTAGATTA	91
RT-inlB-F	GTGAAAGAAAAGCACAACCCAAG	94
RT-inlB-R	TCGCCCCGTTTCCAATAATTAT	94
RT-inlC-F	AAAACCAAGCATCAACAATACT	113
RT-inlC-R	TGTTTTTAGATAACAACGAACTC	113
RT-plcA-F	CAACTAGAAGCAGGAATACGGTAC	116
RT-plcA-R	TGAGTAATCGTTTCTAATACACCTG	116
RT-plcB-F	TATCAAGCAACAGAAGACATGGT	109
RT-plcB-R	TGACTATTTTCGGGTAGTCCG	109
RT-actA-F	CGACATAATATTTGCAGCGAC	138
RT-actA-R	CGTGAACTTACTTCACGTGCA	138
RT-mpl-F	GGCGTTACGCATTATACGC	88
RT-mpl-R	TATTATCCGGTGTGACGTGG	88

Table 3

Determination of LD₅₀ in mice by three strains of *Listeria monocytogenes*
Strain	Dilution gradient					LD₅₀/(CFU/mL)
Strain	2×10⁷	2×10⁶	2×10⁵	2×10⁴	2×10³	LD₅₀/(CFU/mL)
LM928	5/6	5/6	3/6	0/6	0/6	10^5.3
∆LIPI-4	6/6	5/6	3/6	2/6	1/6	10^4.3
C∆LIPI-4	6/6	4/6	3/6	2/6	0/6	10⁵
LD50, 50% lethal dose; CFU, colony-forming unit.

with primers DF and DR. (C) PCR was performed on CΔLIPI-4 strains to confirm LIPI-4 expression in the complemented strain with primers CF and CR(full-length gels are presented in Supplementary Fig. 2).

Mutagenesis And Complementation

Using the LM928 genome as a template, the upstream and downstream homologous arms of the Δ LIPI-4 gene were amplified with the F1 and R1, F2, and R2 primers, respectively. The upstream and downstream arms were subsequently fused by overlap extension polymerase chain reaction (SOE-PCR) to obtain the LIPI-4 fragment, which was connected with the pKSV7 fragment and sequenced. The sequenced plasmid pKSV7-ΔLIPI-4 was electroporated into LM928 competent cells and homologous recombination was carried out in the presence of chloramphenicol at 42 ℃ (final concentration of 10 µg/mL). After continuous passage at 30 ℃, the plasmid was eliminated and the sensitivity of the mutant to chloramphenicol was tested. Finally, ΔLIPI-4 was identified by PCR amplification and sequencing.

The recombinant plasmid pIMK2-LIPI-4 was constructed by PCR amplification of LIPI-4 using the C-F and C-R primers, electrotransferred into ΔLIPI-4 receptor cells, and incubated at 30°C in BHI solid medium containing kanamycin (final concentration 50 µg/mL). Finally, CΔLIPI-4 was identified by PCR amplification and sequencing.

Determination Of Growth Curve

LM928, ΔLIPI-4 and CΔLIPI-4 were inoculated in 20 mL of BHI medium at a ratio of 1:100 and incubated at 37°C in a bacterial shaking incubator at 160 rpm. The OD₆₀₀ nm values were measured in three parallel samples in 96-well cell culture plates at 2 h intervals. The growth curves of the three L. monocytogenes strains were then plotted with OD₆₀₀ as the “Y” axis and time as the “X” axis.

Adhesion And Invasion Rates And Intracellular Colonization

According to the method of Li [40], HCMECs cells were cultured in a 12-well plate at 37 ℃ and 5% CO₂. The number of cells was estimated at 5 × 10⁵/mL. While in the logarithmic phase, LM928, ΔLIPI-4 and CΔLIPI-4 strains were infected with 100:1 (bacteria/eukaryotic cell) to infect the HCMECs cells. Prepared bacteria were incubated with HCMECs cells for 1 h, washed twice with 1 × PBS and digested with 1mL trypsin. Finally, 1 mL of 0.2%Triton-X100 was added to each well to determine the adhesion rate of bacteria to cells. The infected cells were further incubated in DMEM complete medium containing 100 mg/mL gentamicin (0 h at this time), incubated at 37 ℃ for 1 h, washed twice with 1 × PBS and digested with 0.25% trypsin. Thereafter 1 mL 0.2%Triton-X100 was added to each well to determine bacterial invasion rate. After the infected cells were cultured at 37 ℃ for 1 h, they were added to the complete DMEM medium containing 10 mg/mL gentamicin in each well. The cells were collected at 2 h, 4 h, 6 h, 8 h, 10 h, and 12 h, respectively, to determine bacterial proliferation in the cells. Culture plates were detected by BHI Agar gradient dilution method and the colony counting method. Culture plates were incubated at 37 ℃ for 24 h and then counted. The experiment was repeated 3 times. Statistical analyses were performed using Student's t-test or One-way analysis of variance with Dunnett's post-test.

Half Lethal Dose (Ld)

Three strains of L. monocytogenes were resuscitated, cultured at 37 ℃ for 16 h and centrifuged at 8000 rpm to collect bacterial precipitates. Bacterial pellets were washed with PBS, resuspended, adjusted to a concentration of 10⁷ colony-forming unit (CFU)/mL. Samples were then diluted 5 times to a concentration of 10³ and stored for later use. Twelve Kunming mice aged 6–8 weeks were randomly divided into 16 groups with 6 mice in each group and injected intraperitoneally with 5 gradients of three strains of bacteria. Mental changes and death of mice were noted for 10 days following bacterial challenge. LD₅₀ was determined using the Karber method [41].

Bacterial Load In Mouse Tissues

The 6 and 8-week-old mice were randomly divided into 3 groups with 10 mice in each group. Each group of mice was injected with 0.5 mL of wild-type, ΔLIPI-4, or ΔLIPI-4 inoculum in the peritoneal cavity (adjusted to 10⁵ CFU/mL), and any mental changes in the mice were noted for 5 days after the challenge. Three mice from each group were taken out on the 3rd, 4th and 5th day after bacterial challenge, and the liver, spleen and brain tissue were removed under aseptic conditions. Multiple dilution plates were coated with fully ground and diluted 1 × PBS, and the number of colonies counted at 37 ℃ for 24 h.

Effect of LIPI-4 on L. monocytogenes virulence gene transcription

Bacterial liquid was cultured at 37 ℃ for 14 h in BHI liquid medium and the intracellular proliferated cells (following HCMECs infection with MOI = 100 for 12 h), were collected. Samples were ground with liquid nitrogen and total RNA was extracted with the TransZol Up Plus RNA Kit total RNA extraction kit (TransGen Biotech) according to the manufacturer's protocol. The corresponding cDNA was obtained by reverse transcription and the transcriptional levels of the hly, prfA, inlA, inlB, inlC, actA, plcA, plcB, and mpl virulence genes were detected by RT-qPCR. The primers used in RT-qPCR are shown in Table 2.

Acknowledgements

We would like to acknowledge the contribution of Mogo Edit for writing assistance.

Funding

This work supported by National Natural Science Foundation of China (China, 31860712 ,32160833 and 32160834); the Open Project Program of Xinjiang Provincial State Key Laboratory of Sheep Genetic Improvement and Healthy Production (No: MYSKLKF201905);the Open Project Program of Key Laboratory of Control and Prevention of Animal Disease, Xinjiang Production & Construction Corps(No:2020BTDJ05)

Availability of data and materials

The generated nucleotide sequence of the Listeria monocytogenes LM928 can be accessed in GenBank under accession CP046478.1 (https://www.ncbi.nlm.nih.gov/search/all/?term=CP046478.1). The datasets generated and/or analyzed during the current study are available from the corresponding author on reasonable request.

Ethics approval and consent to participate

All animal experiments were approved by Biology Ethics Committee of Shihezi University (Approval Number:A2021-26). All methods were carried out in accordance with relevant guidelines and regulations. This study was performed and reported in accordance with ARRIVE guidelines (https://arriveguidelines.org/).

Competing interests

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Consent for publication

Not applicable.

Author Contributions

LCX and KLJ participated in all the experiments and data analysis, and LCX drafted the manuscript. The gene deletion strain was constructed by LYY. GSJ, KCL, SWD, LSF , RHJ and ZDD took part in animal experiments. MX and WJ designed the study and revised the manuscript. All the authors contributed to this article and approved the submitted version.

Disson O, Lecuit M. Targeting of the central nervous system by Listeria monocytogenes. Virulence, 2012, 3(2) : 213-21.
Radoshevich L, Cossart P. Listeria monocytogenes: towards a complete picture of its physiology and pathogenesis. Nat. Rev. Microbiol, 2018, 16(1) : 32-46.
Chen MT, et al. Isolation, Potential Virulence, and Population Diversity of Listeria monocytogenes From Meat and Meat Products in China. Front Microbiol, 2019, 10 : 946
Charline M, et al. The global burden of listeriosis: a systematic review and meta-analysis. Lancet Infect Dis, 2014, 14(11) : 1073-1082.
Hadjilouka A, Paramithiotis S, Drosinos EH. Genetic Analysis of the Listeria Pathogenicity Island 1 of Listeria monocytogenes 1/2a and 4b Isolates. Curr Microbiol, 2018, 75(7) : 857-865.
Anwar TM et al. Genetic diversity, virulence factors, and antimicrobial resistance of Listeria monocytogenes from food, livestock, and clinical samples between 2002 and 2019 in China. Int J Food Microbiol, 2022, 366(prepublish) : 109572-.
Köster S, et al. Crystal structure of listeriolysin O reveals molecular details of oligomerization and pore formation.Nat Commun, 2014, 5(1) : 3690.
Poyart C et al. The zinc metalloprotease of Listeria monocytogenes is required for maturation of phosphatidylcholine phospholipase C: direct evidence obtained by gene complementation. Infect Immun 1993, 61(4) : 1576-80.
Forster Brian M and Marquis Hélène. Protein transport across the cell wall of monoderm Gram-positive bacteria.Mol Microbiol, 2012, 84(3) : 405-13.
Ireton K. Entry of the bacterial pathogen Listeria monocytogenes into mammalian cells. Cell Microbiol, 2007, 9(6) : 1365-75.
Dramsi S et al. Entry of Listeria monocytogenes into hepatocytes requires expression of inIB, a surface protein of the internalin multigene family. Mol Microbiol 1995, 16(2) : 251-61.
Vázquez-Boland JA et al. Listeria pathogenesis and molecular virulence determinants.Clin Microbiol Rev, 2001, 14(3) : 584-640.
Pascale C, Alejandro TA. Listeria monocytogenes , a unique model in infection biology: an overview. Microbes Infect, 2008, 10(9) : 1041-1050.
Leung N,et al. Impact of the Listeria monocytogenes protein InlC on infection in mice. Infect Immun, 2013, 81(4) : 1334-40.
Aboulwafa M, Saier MH. Lipid dependencies, biogenesis and cytoplasmic micellar forms of integral membrane sugar transport proteins of the bacterial phosphotransferase system. Microbiology (Reading, Engl.), 2013, 159(Pt 11) : 2213-2224.
Abranches J, Chen YM, Burne RA. Characterization of Streptococcus mutans strains deficient in EIIAB Man of the sugar phosphotransferase system. Appl Environ Microbiol, 2003, 69(8) : 4760-9.
McAllister LJ ,et al. Contribution of a genomic accessory region encoding a putative cellobiose phosphotransferase system to virulence of Streptococcus pneumoniae. PloS one, 2012, 7(2) : e32385.
Wu XY, et al. Identification and functional analysis of the L-ascorbate-specific enzyme II complex of the phosphotransferase system in Streptococcus mutans. BMC Microbiol, 2016, 16(1) : 51.
Xie YD, et al. Characterization and virulence of Streptococcus agalactiae deficient in EIIA of the cellobiose-specific phosphotransferase system. Aquacult Rep, 2021, 20.
Stoll R, Goebel W. The major PEP-phosphotransferase systems (PTSs) for glucose, mannose and cellobiose of Listeria monocytogenes, and their significance for extra- and intracellular growth. Microbiology (Reading, Engl ), 2010, 156(Pt 4) : 1069-1083.
Maury MM , et al. Uncovering Listeria monocytogenes hypervirulence by harnessing its biodiversity.Nat. Genet, 2016, 48(3) : 308-313.
Disson O, Moura A, Lecuit M. Making Sense of the Biodiversity and Virulence of Listeria monocytogenes. Trends Microbiol,, 2021, 29(9) : 811-822.
Liu YY , Kang LC, Ma X ,et al..Detection and sequence analysis of LIPI-4 gene on food-borne Listeria monocytogenes. Chinese Journal of Veterinary,2019 (12),2380-2385.
Joseph B, et al. Identification of Listeria monocytogenes genes contributing to intracellular replication by expression profiling and mutant screening. J Bacteriol, 2006, 188(2) : 556-68.
Liu YH, et al. LMOf2365_0442 Encoding for a Fructose Specific PTS Permease IIA May Be Required for Virulence in L. monocytogenes Strain F2365. Front Microbiol, 2017, 8 : 1611.
Wang Y, et al. Genomic dissection of the most prevalent Listeria monocytogenes clone, sequence type ST87, in China. BMC genomics, 2019, 20(1) : 1014.
Zhang YY,et al. Prevalence, Genotypic Characteristics and Antibiotic Resistance of Listeria monocytogenes From Retail Foods in Bulk in Zhejiang Province, China.Front Microbiol, 2019, 10 : 1710.
Pizarro C,Kühbacher A, Cossart P. Entry of Listeria monocytogenes in mammalian epithelial cells: an updated view. Csh Perspect Med 2012, 2(11) : a010009.
Lecuit M, et al. A single amino acid in E-cadherin responsible for host specificity towards the human pathogen Listeria monocytogenes. EMBO J, 1999, 18(14) : 3956-63.
Esteban V, Pascale C. Listeria InlB Takes a Different Route to Met. Cell, 2007, 130(2) : 218-219.
Khelef Nadia et al. Species specificity of the Listeria monocytogenes InlB protein. Cell Microbiol, 2006, 8(3) : 457-70.
Xie YD, et al. The influence of enzyme EII of the cellobiose-phosphotransferase system on the virulence of Streptococcus agalactiae in Nile tilapia (Oreochromis niloticus). Aquaculture, 2021, 535.
Stoll R, et al. Modulation of PrfA activity in Listeria monocytogenes upon growth in different culture media.Microbiology (Reading, Engl ), 2008, 154(Pt 12) : 3856-3876.
Glaser P, et al. Comparative Genomics of Listeria Species. Science, 2001, 294(5543) : 849-852.
Grubaugh D, et al. The VirAB ABC Transporter Is Required for VirR Regulation of Listeria monocytogenes Virulence and Resistance to Nisin. Infect Immun, 2017, 86(3) : e00901-17-e00901-17.
Gründling A, et al. Listeria monocytogenes regulates flagellar motility gene expression through MogR, a transcriptional repressor required for virulence. P Natl Acad Sci USA, 2004, 101(33) : 12318-23.
Knudsen GM, Olsen JE, Dons L. Characterization of DegU, a response regulator in Listeria monocytogenes, involved in regulation of motility and contributes to virulence. Fems Microbiol Lett, 2004, 240(2) : 171-179.
Rea R, Hill C, Gahan C. Listeria monocytogenes PerR mutants display a small-colony phenotype, increased sensitivity to hydrogen peroxide, and significantly reduced murine virulence. Appl Environ Microb , 2005, 71(12) : 8314-22.
Cheng CY,Yang YC, Dong ZM, et al. Listeria monocytogenes varies among strains to maintain intracellular pH homeostasis under stresses by different acids as analyzed by a high-throughput microplate-based fluorometry. Front Microbiol, 2015, 6 : 15- 15.
Li HH, Qiao YJ , Du DD, Wang J, Ma, X. Deletion of the oligopeptide transporter Lmo2193 decreases the virulence of Listeria monocytogenes. J Vet Sci, 2020, 21(6), e88.
Wu YH , Li J, Qiao MF, et al.Characteristic profiles of biofilm, enterotoxins and virulence of Staphylococcus aureus isolates from dairy cows in Xinjiang Province, China. J Vet Sci,2019;20(6):e74.

No competing interests reported.

SupplementaryMaterial.docx

Virulence of Listeria monocytogenes in mice is enhanced by deletion of pathogenicity island 4

Status:

Version 1

Abstract

Background

Results

Conclusion

Figures

Introduction

Results

Mutagenesis And Complementation

Determination Of Growth Curve

Adhesion And Invasion Rates And Intracellular Colonization

Half Lethal Dose (Ld)

Δlipi-4 Down-regulated The Transcription Level Of Virulence Genes In Vitro

Regulation Of Virulence Gene Transcription After Infection Of Hcmec By Δlipi-4

Discussion

Materials And Methods

Bacterial strains, plasmids and cells

Primers

Determination Of Growth Curve

Adhesion And Invasion Rates And Intracellular Colonization

Half Lethal Dose (Ld)

Bacterial Load In Mouse Tissues

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1