Cell Culture
The Medical Ethics Committee of the Affiliated Stomatology Hospital of Guangzhou Medical University approved this study (KY2019008). Retained deciduous teeth were extracted from healthy children aged 6–12 years. The informed written consents from the parent of the patients was obtained. The teeth were cleaned in sterile conditions with phosphate buffered saline (PBS) containing 4% penicillin/streptomycin. Then pulp tissues were separated, cut into pieces, digested with 3 g/L collagenase I and 4 g/L dispase for 30 min, and centrifuged for 5 min. The collected cells were cultured in 60 mm petri dishes with α-MEM containing 10% of fetal bovine serum and 1% of penicillin/streptomycin. When the monolayer of adherent cells reached 80% of confluence, they were trypsinized and subcultured at 5 × 103 cells/cm2. Surface antigens (CD105, CD90, CD73, CD34, CD45) were detected by flow cytometry (FCM). CD73 and CD105 were labeled by Phcoerythrin (PE). CD90 and CD45 were labeled by Phycoerhthrin-CY5 Conjugate (PE-CY5). CD34 was labeled by Fluorescein isothiocyanate (FITC). The SHEDs of passage (P) 4 to 6 (P4-P6) were used for subsequent experiments.
Cell Viability Staining
SHEDs were seeded in 6-well plates at a density of 5 × 104 cells/well. The plates were put in a humidified incubator at 37 °C under 5% CO2 for 24 h. After were starved for 12 hours on the culture medium containing 1% FBS. SHEDs were co-cultured with the DMEM medium containing 0, 10, 50, 100, and 200 µM metformin (Sigma Aldrich, USA) was then added respectively. At day 1 and 7, the cells were stained with a live/dead cell double staining kit (BestBio, China). The living cells were visualized as green and the dead cells as red under the inverted fluorescence microscopy (Leica Instruments, Houston, USA) according to the kit instruction.
Cell Proliferation Assay
Cells were cultured in 96-well plates at a density of 2 × 103 cells/well for 24 h. Then SHEDs were co-cultured with the medium containing 0, 10, 50, 100, and 200 µM metformin was added respectively (6 repeats per concentration). At 1, 3, 5, or 7 days, the medium was discarded and the cells were washed with PBS twice. The cells were then incubated for 2 h in the incubator after added 90 µl medium and 10 µl CCK8 reagent (Dojindo, Japan) to each well and the absorbance was measured at 450 nm. The absorbance value of each time point was calculated, with the detection time as the abscissa and the absorbance value as the ordinate, and the histogram and line graph were drawn for statistical analysis. Each assay was repeated in triplicate (n = 3).
Osteogenic Gene Expression Analysis
SHEDs (1.0 × 105 cells) were seeded in each well of 6-well plates. At 4 and 7 days after induction for SHEDs by metformin, total RNA was extracted using Trizol® (Invitrogen, Carlsbad, CA), and 1,000 ng of total RNA was used for the RT reaction using the PrimeScript RT reagent kit(Takara). qRT-PCR was performed using SYBR Green PCR Master Mix (Thermo Fisher, USA) to detect the gene expression of runt-related transcription factor 2 (Runx2), type I collagen (COL-I), alkaline phosphatase (ALP), osteocalcin (OCN), bone morphogenetic protein 2 (BMP2), vascular endothelial growth factor A (VEGFA), receptor activator of nuclear factor-κB ligand (RANKL), and osteoprotegerin (OPG). The primer sequences for the genes are listed in Table 1. PCR conditions were as follows: 2 min at 50 °C, 10 min at 95 °C, then 15 sec at 95 °C for 40 cycles, and 60 °C for 1 min in 96-well plates using the ViiA™ 7 q-PCR System. The data were normalized to the internal control, GAPDH. The final expression level of the gene of interest relative to controls was reported by the 2-ΔΔCt method. All experiments were repeated in triplicate (n = 3).
Table 1
Primers used in qRT-PCR to examine gene expression.
Genes | Primer Sequence |
Forward 5’-3’ | Reverse 5’-3’ |
ALP | GGACCATTCCCACGTCTTCAC | CCTTGTAGCCAGGCCCATTG |
OCN | TGCCTGGAGAGGAGCAGAACT | GGCGCTACCTGTATCAATGGC |
COL-I | CAGTGGTAGGTGATGTTCTGGGAG | CAAGAGGCATGTCTGGTTCGG |
RUNX2 | CCCGTGGCCTTCAAGGT | CGTTACCCGCCATGACAGTA |
GAPDH | GGACCTGACCTGCCGTCTAG | GTAGCCCAGGATGCCCTTGA |
VEGF-A | AGGAGGAGGGCAGAATCATCA | CTCGATTGGATGGCAGTAGCT |
OPG | CACTACTACACAGACAGCTGG | ACTCTATCTCAAGGTAGCGCC |
RANKL | CGTTGGATCACAGCACATCAG | GTACCAAGAGGACAGACTCAC |
BMP2 | AACACTGTGCGCAGCTTCC | CTCCGGGTTGTTTTCCCAC |
Western Blotting
Total protein from SHEDs was extracted with RIPA buffer. The lysate was centrifuged at 12,000 rpm for 15 min to collect the supernatant. A bicinchoninic acid (BCA)-based protein analysis kit (BestBio, China) was used to quantify the protein concentration of lysate at 562 nm. Then 30 µg protein was isolated in 10% SDS-PAGE gel and transferred into polyvinylidene fluoride (PVDF) membrane. The membrane was blocked with 5% nonfat milk powder for 1 h at 37 °C. The membrane was then incubated at 4 °C overnight with primary antibodies, which included rabbit anti-human AMPKα, rabbit anti-human p-AMPK (Thr172), and rabbit anti-human GAPDH (Cell Signaling Technology, USA). HRP-conjugated Affinipure Goat Anti-Rabbit IgG was incubated at room temperature for 1 h. Protein bands were detected by using an Enhanced Chemical Luminescence kit (Millipore, USA). The ImageJ software was used to semi-quantify band intensity.
Alkaline Phosphatase (alp) Activity And Staining
The cells (1.0 × l04 cells) were inoculated in each well of 48-well plates, and 250 µl complete medium was added to each well. After 24 h, different concentrations of metformin were added to the medium. On day 4, the original medium was removed, and the cells were washed with PBS twice. The cell lysis buffer containing 0.1% Triton x-100 was added to each well. The cells were lysed on ice for 30 min and transferred into 1.8 ml tubes, which were centrifuged (12,000 rpm) at 4 °C for 15 min. The supernatant is absorbed for subsequent operation. The protein concentration was determined by the BCA method, as described above. The activity of alkaline phosphatase was determined by alkaline phosphatase assay kit (Nanjing Jiancheng, China), according to the manufacturer’s instruction. The experiment was replicated three times (n = 3).
For ALP staining, the cells were washed twice with PBS. The cells were then fixed with 150 µl of alcohol (95%) for 15 min. The staining buffer was prepared by mixing 3 ml of alkaline phosphatase color buffer, 10 µl of 5-bromo-4-chloro-3-indolyl phosphate (BCIP) solution, and 20 µl of nitrotetrazolium blue chloride (NBT) solution in a 5 ml tube according to the instructions of an alkaline phosphatase staining kit (Beyotime, China). The BCIP/NBT staining solution (150 µl) was added to each well. After incubation in the dark at room temperature for 30 min for color development, the BCIP/NBT staining solution was removed. The cells were then washed with deionized water twice to terminate a color development reaction. The staining was examined under a stereomicroscope (Leica Instruments, Houston, USA)
Mineralization Assays
SHEDs were seeded into 48-well plates with a density of 2 × 104 cells/well. After 24 h, the cell culture medium was replaced with osteogenic medium (50 g/ml ascorbic acid, 10 mM sodium glycerolphosphorate, 10 nM dexamethasone) containing different concentrations of metformin. The medium was changed every 2 days. On days 14 and 21, the medium was discarded. The cells were fixed with 150 µl of ethanol (95%) for 30 min. Each well was then washed with double distilled water for 3 times. The cells were incubated with 5% of alizarin red (Sigma Aldrich, USA) dye solution for 5–10 min, and washed with double distilled water repeatedly until the washing water became colorless. The plate was placed under a stereomicroscope (Leica Instruments, Houston, USA) for observation and photo taking. After taking photos, each well of cells was incubated with 150 µl 10% of the CPC solution for 1 h to extract the dye. The eluted liquid was transferred to the 96-well plate. The absorbance was measured by the micro plate spectrophotometer (Thermo Fisher, USA) at a wavelength of 562 nm.
Statistical analysis
Data were obtained from at least three separate experiments under identical conditions and expressed as the mean ± standard deviation (SD). Statistical analysis was performed by analysis of variance (ANOVA) and then Dunnett’s test with the Graph Pad Prism software (Version 7, La Jolla, CA, USA). P < 0.05 was considered statistically significant.