Overexpression of chloroplastic Zea mays NADP-malic enzyme (ZmNADP-ME) confers tolerance to salt stress in Arabidopsis thaliana

doi:10.21203/rs.3.rs-2143178/v1

Download PDF

Research Article

Overexpression of chloroplastic Zea mays NADP-malic enzyme (ZmNADP-ME) confers tolerance to salt stress in Arabidopsis thaliana

https://doi.org/10.21203/rs.3.rs-2143178/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 10 Aug, 2023

Read the published version in Photosynthesis Research →

You are reading this latest preprint version

Plants with C4 photosynthesis efficiently assimilate CO₂ under stress conditions. To probe this idea further, the cDNA of decarboxylating C4 gene, for the NADP-malic enzyme from Zea mays (ZmNADP-ME), was overexpressed in Arabidopsis thaliana under the control of 35S promoter. The amino acids and protein contents in the transgenics were lower than in the vector control (VC). In the transgenics, the decarboxylation of malate to pyruvate resulted in reduced presence of 4-carbon acids that serve as the carbon backbone for amino acid synthesis. Consequently, amino acid and protein content were lower in the transgenics than in the VC. As a result, the photosynthetic efficiency (Fv/Fm), electron transport rate (ETR), carbon assimilation rate, overall quantum yield and starch content were reduced in the transgenics. These resulted in lower Chl content, rosette diameter, fresh weight and dry weight of the transgenics than that of the VC. Conversely, the transgenics had higher photosynthetic rate under salt stress. The overexpressers had higher Chl and protein content, Fv/Fm, ETR, and biomass than the VC grown under 150mM NaCl. NADPH generated due to the overexpression of NADP-ME in the overexpressers must have been used to synthesize proline that protected plants from reactive oxygen species, increased glutathione peroxidase activity and decreased H₂O₂ content in the transgenics. The reduced membrane lipid peroxidation and lower malondialdehyde production resulted in better preservation of thylakoid integrity and membrane architecture in the transgenics under saline environment. Our results demonstrate the vital role of C4 gene(s) in protecting plants form abiotic stress.

Abiotic stress

C3 photosynthesis

C4 photosnthesis

Malic enzyme

Oxidative stress

Salt stress

Plants with C4photosynthesis have a higher potential energy conversion efficiency compared to those with C3photosynthesis; this is because of the existence of a CO₂concentrating mechanism, in C4 plants, that largely eliminates photorespiration (Zhu et al. 2008). Further, as compared to C3, C4 plants have higher water and nitrogen use efficiencies (Sage 2004). Introducing C4photosynthesis into C3 crops such as rice, and wheat is an important strategy to improve their overall photosynthetic efficiency (Hibberd et al. 2008; Von Caemmerer et al. 2012; Kandoi et al. 2016, 2018, 2022).

Plants performing C4 photosynthesis have two known decarboxylating enzymes, i.e., NADP- malic enzyme (NADP-ME) (Hatch 1987), and phosphoenolpyruvate carboxykinase (PEPCK) (Wingler et al. 1999). In our study here, the chloroplastic NADP-ME was chosen for its overexpression in C3 plants since major C4 food crops, such as maize, and sorghum, as well as key C4 bioenergy crops, such as Miscanthus giganteus and Saccharum officinarum, are all of this subtype.

NADP-ME catalyzes the oxidative decarboxylation of malic acid to produce pyruvic acid, CO₂ and NADPH in the chloroplast as well as in the cytosol. Furthermore, NADPH acts not only as a reducing agent in other anabolic reactions, but as a key enzyme in carbon metabolism, playing an important role in photosynthesis. Pyruvic acid controls the exchange of metabolites such as carbon in the mitochondria to maintain its normal tricarboxylic acid (TCA) cycle (Gerald E and Carlos S 1992; Bräutigam et al. 2014). NADPH, which is a product of the two photoreactions in photosynthesis, is also a product of ME reaction; it is incorporated into several metabolic pathways such as the Calvin- Benson cycle, and lipid biosynthesis, which is needed for the repair of membranes, or is used in detoxification processes i.e., ascorbate-glutathione cycle and thioredoxin-dependent network (Chen et al. 2019a; Kalemba et al. 2021). In C3 plants, NADP-ME isoforms are also associated with plant defence and stress responses against, e.g., drought, low temperature, salinity, osmotic stress, heavy metals, UV and hypoxia (Emami et al. 2016; Fushimi et al. 1994; Walter Michael et al. 1994; Pinto et al. 1999; Cheng and Long 2007; Liu et al. 2007; Detarsio et al. 2008; Fu et al. 2009; Guo et al. 2009; Nguyen et al. 2009; Doubnerová and Ryšlavá 2011; Fu et al. 2011; Alvarez et al. 2013; Doubnerová Hýsková et al. 2014; Sicher et al. 2015; Sun et al. 2019; Swain et al. 2021).

The NADP-ME gene family of C3plants, e.g., Arabidopsis thaliana, includes three cytosolic ME genes (AtNADP-ME1, AtNADP-ME2, and AtNADP-ME3) and one (AtNADP-ME4) located in the plastids (Wheeler et al. 2005). AtNADP-ME1 is preferentially expressed in roots, while AtNADP-ME3 is expressed in flowers, and, AtNADP-ME2 and AtNADP-ME4 are housekeeping genes (Wheeler et al. 2005).

In C4 plants, the chloroplastic NADP-ME is involved in the CO₂ concentrating mechanism (CCM) via generating CO₂ in the vicinity of ribulose-1,5-bisphosphate carboxylase/oxygenase (rubisco). Therefore, attempts to transfer the C4cycle NADP-ME into C3 plants have had the focus of improving the rate of photosynthesis by enriching CO₂near the rubisco. Overexpression of C4 NADP-ME in C3 plants has been shown to cause various aberrations such as abnormal chloroplasts, bleaching of leaf color, growth hindrance and even senescence in the dark (Takeuchi et al. 2000; Tsuchida et al. 2001; Chi et al. 2004; Fahnenstich et al. 2007).

In the present study, we have overexpressed the maize C4 NADP-ME under the control of 35S CAMV promoter in Arabidopsis thaliana. Our results demonstrate that although transgenics had reduced photosynthesis and biomass under control conditions, they were tolerant to salt stress due, mainly, to the overproduction of proline utilizing NADPH generated by C4 NADP-ME in the chloroplast. Thus, we conclude that overexpression of NADP-ME (from C4) in C3 plants provides stress resistant crops.

Plasmid constructs, transformation and selection of transgenic lines

Zea mays malic enzyme (Accession Number- J05130) has 1911 bp of coding region was amplified by PCR using two gene specific primers: F, 5’-GAA TTC ATG CTG TCC ACG CGC ACC G -3’; R, 5’-GAA TTC CTA CCG GTA GTT GCG GTA GAC GGG A -3’. In both cases, EcoRI restriction sites were introduced (underlined). The pGEMT-Easy recombinant plasmid containing the full length ZmNADP-ME cDNA was digested by EcoRI and further cloned into the binary vector pCAMBIA1304 under the control of CaMV 35S promoter and Ω enhancer (Pattanayak et al. 2005). The recombinant plasmid (pCAMBIA1304::ZmNADP-ME) was transformed into Agrobacterium tumefaciens strain (GV1301) and introduced into 6-week old Arabidopsis thaliana plants (cv. columbia) via agrobacterium mediated floral dip method (Clough and Bent 1998). Vector control (VC) plants containing the null vector, pCAMBIA1304 (binary vector without ZmNADP-ME cDNA), were also generated and used for comparison with the transgenics since no significant differences in growth parameters were seen between the wild type (WT) and the VC plants (Kandoi et al. 2022). Seeds of the transformed plants were screened on half-strength Murashige and Skoog (MS) agar medium containing 50 μg/ml kanamycin and were grown to T3 generation.

Plant material and growth conditions

Stratified Arabidopsis seeds were sown in agropeat: vermiculite (1:3) mixture in pots and grown under cool-white-fluorescent light (100 µmol photons m^-2 s^-1) under 14 h light/10 h dark photoperiod at 21±1ºC.

Confirmation of transgenic lines

Genomic DNA PCR: Genomic DNA was isolated by cetyl trimethyl ammonium bromide (CTAB) method (Nickrent 1994) from 4- week old plants of the T1 generation. The presence of trans-gene in the plants was confirmed by PCR using 35S forward internal primer (5'-CCC ACT ATC CTT CGC AAG AC-3’) and ZmNADP-ME reverse primer (5'- CTA CCG GTA GTT GCG GTA GAC GGG A -3’) to ensure the incorporation of the whole cassette in sense orientation.

Southern blot: Five hundred micrograms of genomic DNA from both the vector control and the transgenic plants were digested overnight with the restriction enzyme XbaI for southern blot analysis. The digested DNA was loaded and resolved on 1% agarose gel and blotted onto Nylon 66 membrane (MDI) and then transferred to it (Sambrook and Russell 2001). Kanamycin (nptII) primers was used for probe preparation by PCR and labelled with [^a32P] dCTP using a radioactive random primer labelling kit (Amersham-GE, UK). The southern blot was developed, as described by Sambrook and Russell (2001).

Quantitative reverse transcription polymerase chain reaction (qRT-PCR): Relative expression of different genes was studied by performing qRT-PCR on ABI Prism 7500 Sequence Detection System (Applied Biosystems, USA) using ZmNADP-ME (F, 5’- GATCTCTGCGCACATCGCTGC -3’ and R, 5’- GCAGCACTACCGGTAGTTGCGG -3’) and A. thaliana adenine phosphoribosyl transferase (APT1), a housekeeping gene (F, 5’-TTC TCG ACA CTG AGG CCT TT- 3’ and R, 5’-TAG CTT CTT GGG CTT CCT CA-3’) primers. The relative gene expression data were analysed using the 2^-^DD^Ct quantitation method (Livak and Schmittgen 2001). Increase in the expression of ZmNADP-ME was calculated using, as a reference, a transgenic line (MEx7) that has a low expression of ME.

Western blot analysis : Total protein was extracted from 4-week-old leaves of VC and transgenic plants for immunoblot analysis, in a protein extraction buffer (Jilani et al. 1996). Protein concentrations of the supernatants were measured, as described by Bradford (1976). Electrophoresis was carried out on a 15% (w/v) SDS-PAGE gel using a total of 25 µg of soluble plant protein per lane. Separated polypeptides were blotted on nitrocellulose membranes (Jilani et al. 1996). Proteins were probed with anti-maize ME antibody (Imgenex, India). The rabbit anti-mouse IgG (1:25,000) was used as a secondary antibody, conjugated to alkaline phosphatase. Blots were stained for alkaline phosphatase, using 5-bromo-4-chloro-3-indolyl phosphate (BCIP) and nitro blue tetrazolium (NBT) and quantified using an Alpha Imager 3400.

Malic enzyme activity: For screening of the primary transgenic rice plants, the activity was measured by protocol as follows. The leaf soluble protein extract of around 1 mg protein ml^-1 was diluted 20-fold with an assay medium containing 25 mM HEPES-KOH (pH 8.0), 0.1 mM EDTA, 2 mM MgCl₂ and 0.5 mM NADP⁺, and the enzyme reaction was started by adding final concentration of 5 mM malate (pH 7.0 with NaOH). The reaction was performed at 30ºC and the reduction of NADP⁺was monitored by absorbance at 340 nm (Tsuchida et al. 2001).

Estimation of pigment and protein

Leaf total chlorophyll was extracted in 80% acetone and estimated as described by Porra et al. (1989). The leaf soluble protein was measured according to Bradford (1976). Free amino acids were analyzed by the ninhydrin colorimetric method, using leucine as a standard (Kandoi et al. 2016).

Measurement of growth parameters

VC and ZmNADP-ME transgenic plants were grown for three weeks in Murashige and Skoog (MS) medium medium in petri-dishes. For fresh weight, plants were taken from a petri-dish, kept on tissue paper to absorb moisture, and then their weight was measured. For dry weight measurement, whole plants were kept in an oven at 80ºC for 72 h.

Pulse amplitude modulation (PAM) measurements

Chlorophyll a fluorescence was measured simultaneously by PAM-2100 fluorometer (Walz, Germany), using the automated ‘‘Light Curve’’ program provided by a software from Walz. Prior to measurements, plants were placed in dark for 20 minutes (Demmig et al. 1987, 2014). First, the initial minimal fluorescence (Fo) and then the maximum fluorescence (Fm) were measured by the ‘Saturation Pulse’ method. Optimum quantum yield of Photosystem II (PSII) was calculated as Fv/Fm= (Fm−Fo)/Fm (Schreiber and Armond, 1978), where Fv is the variable chlorophyll a fluorescence. Electron transport rate (ETR) of PSII in the light was calculated according to a formula described by Schreiber et al. (1995): ETRII =Yield II (YII)×PAR×0.5×0.84, where the effective PSII quantum yield (YII) is calculated according to Genty et al. (1989) by the formula: YII =(Fm'- Ft)/Fm', where Ft represents the measured Chl a fluorescence yield at any given time (t) and Fm' is defined as the maximal Chl a fluorescence yield in a pulse of saturating light, when the sample is pre-illuminated, PAR is flux density of incident photosynthetically active radiation (μmol photons m^-2 s^-1), the 0.5 factor is used since transport of one electron requires absorption of two quanta by the two photosystems, i.e., it assumes that PSII: PSI ratio is 1:1, and the use of 0.84 assumes that 84% of the incident quanta are absorbed by the leaf. Non-photochemical quenching (NPQ) of the excited state of Chl a was calculated from the formula: NPQ= (Fm−Fm′)/Fm′ (Schreiber 2004).

Photosynthesis: Light response curve

Light response curves of photosynthesis of six-week old vector control and transgenic plants, grown under 14h L/10h D, in soil, were measured with an Infrared gas analyzer (Portable Gas Exchange Fluorescence System GFS3000, Walz), using a standard head having LED light source 3040-L with an LED array providing 90% red and10% blue light. Sample chamber CO₂ concentration was maintained at 400 μmol mol^-1, whereas the air temperature was kept at 25°C, and the relative humidity at 60%. For the light curve, different light intensities (500, 400, 300, 200, 100, 50, 10 and 0 μmol photons m^-2 s^-1) were used. For measurements of stomatal conductance (gs), transpiration rate (E) and water use efficiency (WUE), the light intensity was 400 μmol photons m^-2 s^-1.

Salt treatment (salt stress)

To measure the effect of salt stress on photosynthetic efficiency of plants, vector control, and transgenic plants were plated on the Murashige and Skoog medium (MS) medium for 2 weeks, and then transferred to the same medium with or without 150 mM NaCl for 9 days. Growth was measured during this period to evaluate salt tolerance.

Transmission electron microscopy (TEM): Arabidopsis leaves were vacuum infiltrated with 2.5% glutaraldehyde solution for 30 min and kept overnight in the same solution (Karnovsky 1965). This solution was then replaced by 0.1 M sodium-phosphate buffer (pH 7.0); after this, we followed the procedure of Jiang et al. (2011). Sections of samples were then viewed in a transmission electron microscope (JEOL 2100F) at the Advanced Instrumentation Research Facility of Jawaharlal Nehru University, New Delhi, India.

Anti-oxidative enzymes: Leaf samples (0.1–0.2 g) were homogenized in an ice-cold extraction buffer (50 mM HEPES, pH 7.5), 0.4 mM EDTA, 5 mM MgCl2, 10% glycerol, 1% Polyvinylpyrrolidone, 2 mM dithiothreitol (DTT), and 1 mM phenylmethylsulfonyl fluoride (Gegenheimer 1990). The homogenate was centrifuged (14,000Xg) at 4⁰C for 20 min, and the supernatant was used as the crude extract for the assay of enzyme activities. Total protein was determined as described by Bradford (1976).

--Proline content: Free proline was estimated from leaf samples using ninhydrin, as described by Bates et al. (1973).

--Peroxidase activity: The peroxidase activity was assayed spectrophotometrically at 436 nm, using Guaiacol, a hydrogen donor (Putter 1974).

--H₂O₂ content: H₂O₂ content was quantified in leaf extracts. The extract was diluted accordingly and then used for H₂O₂ determination with an Amplex Red Hydrogen Peroxide/Peroxidase Assay Kit (Invitrogen, USA), which was done spectrophotometrically at 560 nm.

--Lipid peroxidation: For monitoring malondialdehyde (MDA), an indicator of lipid peroxidation, we used the method of Hodges et al. (1999).

Data processing and analysis

Data were analyzed using the Microsoft Excel App. After the calculation of averages, results are presented as mean ± SE. Differences between transgenic and control plants were analyzed by Anova test.

Confirmation of ZmME transgenic plants

Genomic DNA PCR: Using an Agrobacterium tumefaciens mediated gene transfer system, we have transformed Arabidopsis thaliana, with cDNA of Zea mays malic enzyme (ZmNADP-ME) under the control of CaMV 35S promoter (Fig. 1a). Several transgenic (T1) Arabidopsis plants, that were resistant to kanamycin, were obtained from this transformation. We then isolated genomic DNA from the kanamycin resistant ZmNADP-ME over-expression (MEx) (T1) lines. The ZmNADP-ME was amplified by PCR, using the 35S internal forward primer and gene specific reverse primer (ZmNADP-ME R), from genomic DNA of several individual overexpression lines (MEx7, MEx9, MEx12 and MEx13) of T1 generation. PCR yielded a fragment of ~2Kb from transformants that contained ZmNADP-ME (Fig. 1b). The gene was not amplified in vector control containing the null vector pCAMBIA1304 without ZmNADP-ME cDNA (Fig. 1b). These individual transgenic lines were grown to harvest seeds. Seeds collected from the above plants were again grown in kanamycin plates to select T2 transgenic lines. Transgenic seeds were grown for T3 and T4 generations to obtain homozygous transgenic plants.

Southern Blot Analysis: The number of integration of the T-DNA cassette containing ZmNADP-ME cDNA into the Arabidopsis thaliana host genome was checked by Southern blot analysis. The genomic DNA was extracted from MEx12 and MEx13 as well as from the vector control plants. Genomic DNA was digested by XbaI restriction enzyme that specifically cuts the T-DNA cassette introduced into host genome. Southern blot analysis of XbaI digested genomic DNA, using nptII probe, revealed single band(s) in MEx12 and MEx13 confirming single integration of the T-DNA cassette in the Arabidopsis genome (Fig. 1c).

qRT-PCR: Expression of ZmNADP-ME genes among different transgenics of T3 generation was analyzed by qRT-PCR, using gene-specific primers. The transcript abundance of ZmNADP-ME in MEx9, MEx12, and MEx13 was 4.5, 5.2, and 6.4 fold higher, respectively, than that in MEx7 (Fig. 1d). An increase in the expression of ZmNADP-ME was calculated using, as a reference, MEx7, a transgenic line that had the lowest expression of ZmNADP-ME.

Western blot analysis: Figure 1e shows the coomassie brilliant blue R250 stained SDS-PAGE for the visualization of proteins separation. Further, Figure 1f shows that increased gene expression of malic enzyme resulted in increased protein abundance. We note the presence of a 62 kD protein band in the VC as well as in transgenic lines. As compared to the VC, ME protein abundance was higher in all the transgenic lines.

ME activity: As compared to the VC Arabidopsis, malic enzyme activity was 3–7 fold higher in the transgenic lines (Fig. 1g).

Plant morphology

Figure 2a shows a photograph of the VC and the ZmNADP-ME overexpressed plants, used in our measurements. They were grown for 4 weeks in a controlled chamber under a 14 h day (light) and 10 h night (dark) cycle at 21±1ºC, and at 100 µmol photons m^-2 s^-1cool-white-fluorescent light. Visually, plants of MEx12 and MEx13transgenic lines were smaller in size than the vector control (see Fig. 2a). Their rosette diameters were reduced by ~12%-25% (Fig. 2b).

Pigment, amino acids and total protein content

Total chlorophyll (Chl), Chl a, Chl b, and Chl a/b ratios were measured in four-week-old plants as described under “Materials and Methods”. The transgenic lines MEx12 and MEx13 had 11% -14% lower total Chl, as well as Chl a and Chl b, than in the VC (Fig. 2c, d, e); however, there was no significant change in the Chl a/b ratio (Fig. 2f). The protein content of transgenic plants decreased by 17%-24% in MEx12 and MEx13 (Fig. 2g); further, the free amino acids content of transgenic plants also decreased by 11%-15% than in the vector control (Fig. 2h).

Biomass of ZmNADP-ME overexpressing transgenic plants

After 4 weeks of growth, the fresh weight of the MEx12 and MEx13 transgenic plants decreased by 35% to 49% (Fig. 2i) and their dry weights by 30% to 44% than that of the VCs (Fig. 2j).

Chlorophyll a fluorescence measurement

To check if decreased Chl content modulates the function of photosynthetic apparatus and primary processes of photosynthesis, we used Chl a fluorescence as its noninvasive signature (Govindjee, 1995; Nellaepalli et. al 2012). For a background on the basics and use of chlorophyll a fluorescence for measuring different reactions in photosynthesis, see Govindjee et al. (1986), Papageorgiou and Govindjee (2004) and Padhi et al., 2021. Various Chl a fluorescence parameters were measured as described under Material and methods; our results are described below.

Fo: The minimum Chl a fluorescence (Fo), measured in dark-adapted leaves of MEx12 and MEx13 plants, had 10% to 12% higher Fo values than in the VC (Fig. 3a). We note that although the transgenic plants had lower Chl content, their Fo was higher, probably due to the presence of non-Q_B centers; these non-reducing centers are incapable of transferring electrons from the reduced primary plastoquinone Q_A (Q^-_A) to the secondary plastoquinone Q_B (for details see Schansker and Strasser (2005).

Fm: The maximum Chl a fluorescence (Fm) was measured during the first saturation pulse after the leaf had been dark-adapted; it decreased in MEx12 and MEx13 plants by 9%-15% than that in the VC plants (Fig. 3b).

Fv: In view of the above, the variable fluorescence (Fv) had decreased by 15%-23% in MEx12 and MEx13 plants than that in the VC plants (Fig. 3c).

Fv/Fm: This ratio is an estimate of the maximum portion of absorbed quanta used in PSII reaction centers by dark-adapted leaves (Guidi et al., 2019). In MEx12 and MEx13 plants, the Fv/Fm ratio was lower by 8%-10% than that in the VC plants (Fig. 3d).

Electron transport rate (ETR): The ETR, as measured by Schreiber et al. (1995); increased in response to increased photosynthetic active radiation (PAR/ µmol photons m^-2s^-1) (Fig. 3e). In low light intensities (20 μmol photons m^-2 s^-1), the ETR of MEx12 and MEx13 plants was lower (25%-38%) than that in the VC. Further, at saturating light intensity (420 μmol photons m^-2 s^-1), the ETR was also significantly lower (30%-40%) in the transgenic plants, as compared to that in the VC.

Non-photochemical quenching (NPQ) of the excited state of chlorophyll: The NPQ represents the fastest process of rapid and reversible thermal dissipation of absorbed light energy in the PSII antenna (Niyogi, 2000; Müller et al., 2001); at 420 μmol photons m^-2 s^-1, it was higher (40%-64%) in the transgenic plants than that in the VC plants. We emphasize that the NPQ values of the transgenics were higher in low as well as saturating light intensities than that of the VC plants (Fig. 3f).

Light response curve of net CO₂ assimilation

To check if the decreased electron transport rates, that provide lower reducing power in the form of NADPH, as well as ATP, for CO₂ reduction, indeed leads to decreased net carbon assimilation in the antisense plants, we monitored CO₂ uptake rates of intact leaves. The photosynthetic light response curves of the attached leaves of the VC and the transgenic plants were monitored by Infra-Red Gas Analyzer (see “Material and methods”). As compared to the VC plants, the transgenics had lower (~18%-28%) net CO₂ fixation; this saturated almost at 450 µmol photons m^-2 s^-1(Fig. 4a). The relative quantum yield of CO₂ fixation, measured at limiting light intensities (upto 80 μmol photons m^-2s^-1), of transgenics was lower (~8%-12%) than that in the VC plants (Fig. 4b). The rate of respiration measured in the dark was lower (41%) in the transgenics than in the VC. The light compensation point in the VC was ~20 µmol photons m^-2 s^-1, but it was lower (~15 µmol photons m^-2 s^-1) in the transgenics (Fig. 4b).

Stomatal conductance (gs) and water use efficiency (WUE)

The CO₂ assimilation rate (An) decreased by 18% in MEx12 and MEx13 at 400 µmol photon m^-2 s^-1(Fig. 4c). It is important to note that these decreases in photosynthetic rates were associated with decreases in stomatal conductance and transpiration in the transgenic lines. For example, stomatal conductance decreased by 9%-22% in MEx12 and MEx13 than in the VC (Fig. 4d); in addition, transpiration rate decreased by 10%-21% in MEx12 and MEx13 plants (Fig. 4e). No significant changes were observed in water use efficiency of transgenic and vector control (Fig. 4f)

The NADP-ME overexpressers were tolerant to salt stress

To check the tolerance to salt stress, VC, MEx12 and MEx13 plants were grown in Murashige and Skoog (MS) medium for 14 days and, subsequently, transferred to MS medium or MS+150 mM NaCl for 9 days. The VC plants almost bleached due to salt stress; however, the transgenic plants were greener than VC under identical conditions (Fig. 5a).

Biomass, Pigment and protein contents in salt stress

The fresh weight decreased by 77%, 63% and 59% in VC, MEx12 and MEx13 (Fig. 5b) As compared to that of the VC, the Chl content was higher in the transgenics under saline environment (Fig. 5c). Under salt (150 mM NaCl) treatment, the Chl content declined by 75% in the VC plants, whereas in the overexpressers, the loss of Chl was lower (51%-62%) (Fig. 5c). In the presence of 150 mM NaCl, the protein content in the VC plants declined by 65%, but in the transgenics, the decrease was somewhat less, i.e., by 46%-54% in the transgenics (Fig. 5d).

Chlorophyll a fluorescence and photosynthetic efficiency in salt stress

Fo: Under salt stress (150 mM NaCl), the Fo of the VC decreased by 40%, but to a lesser extent (25%-30%) in the two transgenic lines (Fig. 6a).

Fv/Fm ratio: The Fv/Fm ratio in the VC decreased by 51% upon salt (150 mM NaCl) treatment. However, its decline in the overexpressers was slightly smaller (36%-40%) that demonstrates a better salt tolerance by the transgenic plants (Fig. 6b).

Electron transport rate II (ETRII): Under control conditions, the ETRII of VCs was higher (~20%) than that of the ZmNADP-ME overexpresser plants under limiting as well as under saturating light intensities (see Figs. 3e & 6c). Salt treatment (150 mM NaCl) resulted in decreased ETRII in the the VC and in the overexpresser plants under limiting as well as under saturating light intensities. However, at saturating light intensity, the ETRII under salt stress (150 mM NaCl) declined by ~ 76% in the VC, but in MEx13 and MEx12 it decreased by 50% to 67% (Fig. 6c).

Non photochemical quenching (NPQ) of the excited state of Chlorophyll: As expected, we observed an increase in NPQ in response to increased light intensity (Ruban et al., 2012). However, at saturating light intensity (344 μmol photons m^-2s^-1), the NPQ in MEx12 and MEx13 transgenic lines was almost similar to the VC under control conditions (Fig. 6d). Due to reduced light utilization under salt stress condition, the NPQ of VC was higher than that in the transgenics (Fig. 6d).

Chloroplast ultrastructure

All the plants, used in this study, showed a marked change in the phenotype under salt stress and the effect was very prominent in the leaves. The ultrastructure of the chloroplasts, by transmission electron microscopy, showed that the VC plants had salt-induced structural distortions such as de-stacking of granal organization, as well as swelling of thylakoids (Fig. 7a, lower panel). However, the de-stacking of grana and thylakoid swelling was less pronounced in the transgenics than in the VC (Fig. 7a, lower panel).

Proline content, Antioxidative enzymes, reactive oxygen species (ROS), and MDA:

Proline content:The amino acid proline that usually increases under stress condition is known to play a critical role in protecting plants from abiotic stresses (Hayat et al., 2012). Under control condition, the proline content of both the VC and the overexpresser plants was almost similar. In saline environment (150mM NaCl), the proline content increased by ~45% in the VC plants. However, under identical conditions, the proline content was nearly ~122%-163% higher in the overexpressers (Fig. 7b). Proline is an osmoprotecting molecule that is known to accumulate in response to environmental stress. Therefore, synthesis of excess proline is a key step involved in tolerance of overexpresser plants to environmental stress.

Peroxidase: Peroxidase is involved in the scavenging of reactive oxygen species (ROS) by deposing H₂O₂ into water (Asada 1999). In response to salt treatment (150mM NaCl), guaiacol peroxidase increased by 30% in the vector controls, but much more, by 81%-98%, in the transgenics MEx12 and MEx13 (Fig. 7c).

H₂O₂ content: Reactive oxygen species production is known to increase under environmental stress (Das and Roychoudhury 2014); H₂O₂ is known to be the most stable form of the ROS (Huang et al. 2019). Under control conditions, the H₂O₂ content of VC and overexpressers was almost similar (Fig. 7d). In response to salt treatment (150mM NaCl), H₂O₂ content increased to the same level (~96%) in both VC and overexpressers plants. However, the transgenics had 36%-50% higher H₂O₂ than VC in saline environment (Fig. 7d).

Lipid peroxidation: In control condition, malondialdehyde (MDA) content, an index for lipid peroxidation (Kandoi et al., 2016), was quite similar in the VC and the transgenics. Under stress condition, the MDA content was found to increase by 169% in the vector controls, but by 47%-78%, in MEx12 and MEx13 (Fig. 7e).

The Malic Enzyme and its implications

The chloroplastic NADP-malic enzyme (NADP-ME) is a major de-carboxylating enzyme of the C4 photosynthesis pathway in NADP-ME type plants (Wang et al. 2014; Chen et al. 2019b). Therefore, introduction of NADP-ME to C3 plants is considered to be an important method for improving its photosynthesis. In our work, presented here, we have produced and characterized several lines of A. thaliana overexpressing ZmNADP-ME under the control of 35S CAMV promoter (Fig.1b). The NADP-ME overexpresser lines showed a 4 to 7 fold higher gene expression, protein expression and NADP-ME activities than the vector control (Fig. 1d, f & g). This is consistent with the earlier observation of Zell et al. (2010) and Fahnenstic et al. (2007). Further, C4 ZmNADP-ME has five to ten times lower Km for malate and NADP⁺ compared to its C3 isoforms (Casati et al. 1997). Due to the overexpression of C4 ZmNADP-ME, transgenics must have had higher rates of conversion of endogenous malic acid to pyruvic acid that reduced the C4 carboxylic acid pool of plants that serve as the precursor of several amino acids, i.e. aspartate, asparagine and other amino acids. The down-regulation of amino acid synthesis must have resulted in decreased protein content of ZmNADP-ME overexpressers. Synthesis of Chls and protein are usually co-regulated; therefore, lower protein content in ZmNADP-ME overexpressers is expected to give lower Chl content in the transgenics (Xu et al., 2004). We suggest that the above mentioned down-regulation of the protein content of ZmNADP-ME overexpresser Arabidopsis must have led to reduced (~15%) Chl content observed in our work (Fig. 2c). It seems obvious that the decreased amount of amino acids in the transgenics must have contributed to the lower protein content of plants that led to decreases in metabolic processes including photosynthesis and respiration (Kandoi et al., 2022).

Chlorophyll a fluorescence

Chl a fluorescence is a non-invasive probe for measurement of photosynthesis (Krause and Weis 1991; Govindjee 1995; Baker 2008). The minimal fluorescence (Fo) is shown to increase (~10%-12%) in ZmNADP-ME overexpressers (Fig. 3a); such an increase of Fo has been related to PSII inactivation and photoinhibition (Zlatev and Yordanov 2004) and is possibly due to increased amount of Q_A^-, reduced form of the first plastoquinone electron accepter (Krause and Weis, 1991).

Further, the observed decrease (~9%-15%) in maximal (F_m) fluorescence (Fig. 3b) is, in all likelihood, due to inhibition of electron transport on the electron donor side of the PSII resulting in the accumulation of P₆₈₀⁺, a quencher of chlorophyll a fluorescence (Govindjee 1995; Neubauer and Schreiber 1987). The Fv/Fm that measures the maximum photochemical efficiency of PSII in dark adapted leaves (also an indicator of photoinhibition of photosynthesis (Björkman and Demmig 1987) decreased (8%-10%) in the transgenics demonstrating that their PSII efficiency was lower than that in the VCs (Fig. 3d). Since NADP-ME catalyzes the reduction of NADP⁺ to NADPH, this enzyme decreases the NADP level and increases the level of NADPH in the chloroplast stroma and, thus, stimulates the process of photoinhibition. Thus, all our results, taken together, suggest that there is more susceptibility to photoinhibition of photosynthesis in the transformants. This conclusion is supported by the observed bleaching of the samples and the decreased Fv/Fm ratios, observed in the overexpression of NADP-ME in rice (Tsuchida et al. 2001). In contrast, under longer-day conditions (16h L/8h D), the Fv/Fm ratios of the ME overexpressers and the wild type were similar (Fahnenstic et al. 2007).

In our experiments, the ETR values decreased in the transgenics under low as well as high light intensities, demonstrating a decrease in the energy capture and its utilization (Fig. 3e). Non-photochemical processes that dissipate excitation energy by quenching the excited state of Chl a are higher in the transgenics than in the vector control demonstrating that in the transgenics, more light energy is dissipated as heat (Fig. 3f). Furthermore, the light dependent CO₂ assimilation was lower in the transgenics than in vector control (Fig. 4a). The quantum yield of photosynthetic CO₂ assimilation, measured in limiting light intensities, decreased (8%-12%) in the transgenics over that in the vector control (Fig. 4a). As a result of lower carbon assimilation efficiency, plant growth, fresh weight and dry matter accumulation was lower in the transgenics (Fig. 2a, i, j).

Malate is known to be involved in stomatal movement through regulation of the osmotic pressure of the guard cells (Asai et al. 2000). Due to overexpression of NADP-ME, the malate is substantially decreased in the overexpresseres. Therefore, we observe a decreased stomatal conductance and transpiration rate in the transgenic lines. However, there were no significant changes in the water use efficiency because of substantial decrease in the rate of photosynthesis in the transgenics (Fig. 4f). Similarly, we note that the stomatal conductance has also been shown to decrease in tobacco (Nicotiana tabacum) due to NADP-ME overexpression (Laporte et al. 2002). The above considerations suggest that inside the chloroplast, carbon metabolism can be significantly altered by overexpression of the malic enzyme.

Under our experimental conditions, the transgenics had smaller (Fig. 2a) leaf size and lower biomass than the vector control. The ZmNADP-ME overexpresser Arabidopsis is shown to have developed a pale-green phenotype with decreased biomass and increased specific leaf area, with thin leaves having lower photosynthetic performance due to impairment in the supply of carbon skeletons (cf. Zell et al. 2010). Similarly, serious deteriorative effects on growth under autotrophic conditions have been observed in rice plants overexpressing maize NADP-ME, the latter grown under 8/16-h photoperiod (Takeuchi et al. 2000; Tsuchida et al. 2001).

Transgenics grow better in saline environment- have better photosynthesis than the vector controls

In general, the photosynthetic performance of plants is known to decline under saline conditions (for review see: Chaves et al. 2009). It is an established fact that photosynthetic capacity of plants is determined by several factors. Often the efficiency of light captured to drive photosynthesis is correlated with the amount of chlorophyll in the leaf (see e.g., Netondo et al. 2004). Both water-stress and salt-stress are known to downregulate and limit Chl biosynthesis by downregulating the expression of genes and enzymatic activities involved in the synthesis of 5-aminolevulinic acid (ALA), the substrate for chlorophyll heme and siroheme. The subsequent anabolic processes for the conversion of ALA to Chl, i.e., the gene expression, protein abundance and enzymatic activities are impaired by salt stress (Turan and Tripathy 2015). Therefore, Arabidopsis plants grown in saline environment had reduced Chl (Fig. 5c). In response to salt treatment, the reduction in Chl content was much higher in VC than the ZmNADP-ME overexpressers. As a result, the transgenics had greener leaves in saline environment. This is in agreement with our previous studies, where we demonstrated that the overexpression of other C4genes of Zea mays, i.e., phosphoenol pyruvate carboxylase (PEPC) and NADP-malate dehydrogenase (NADP-MDH), protected the pigment content and the photosynthetic efficiency of Arabidopsis from salt stress (Kandoi et al. 2016, 2018).

Salt-stress-induced inhibition of growth of plants is often due to their reduced photosynthetic performance (Akram and Ashraf 2011; Nascimento et al. 2011). In response to salt stress, the Fo was shown to decline in both VC and transgenics. However, the percent reduction of Fo in the transgenics was lower (11%-15%) than in the VC plants. The lowered Fo could be attributed to lowered Chl content under salt stress condition. The transgenics had higher Chl content in saline condition and as a result had higher Fo. The Fv/Fm ratio that denotes maximum photosynthesis quantum yield, in dark-adapted condition, declined due to impairment of PSII reaction in vector control. However, in stress condition, the Fv/Fm was substantially higher (23%-32%) in the transgenics suggesting that their PSII photochemical reactions were substantially protected from salt-stress.

The PSII-dependent photosynthetic ETR increased with increasing light intensity, and then saturated, and, in general salt-stress is known to decrease these rates (Kandoi et al., 2016). In our experiments, we found that the estimated ETR was higher in the transgenic lines than VC plants in saline conditions. This could be due to a reduced salt-induced PSII damage of the reaction centers in the transgenics (Fig. 6c). The NPQ of the excited state of Chl molecules, which measures the dissipation of absorbed light energy as heat, was lower in 150 mM salt-stressed transgenics than in the VC (Fig. 6d). These results suggest that the absorbed light energy was better utilized in photochemical reactions in the transgenics than in the vector controls, under salt stress conditions. Due to the overexpression of ME, transgenics had higher NADPH that serves, in addition to being used in the Calvin-Benson cycle, as the source of reducing equivalents for the xanthophyll cycle (Goss and Hanke 2014). Thus, the redox states of NADP(H) are crucial for regulating both ROS production and scavenging in chloroplasts. Salt stress causes osmotic stress and is accompanied by the formation of excessive ROS, thereby increasing the oxidative stress of the plant. Proline is a compatible solute that protects plants from different abiotic stresses (Delauney and Verma 1993; Madan et al. 1995) and stabilizes the overall redox status of the cell (Hare et al. 1999; Szabados and Savouré 2010). The proline content of plants increased in saline conditions both in the VC plants and in the transgenics. However, the proline content in the transgenics was higher than in the VCs in 150 mM NaCl treatment due to its reduced degradation and increased synthesis. The NADPH is known to be used in proline biosynthesis pathway for the conversion of glutamate to pyrroline-5-carboxylate, resulting in an increased proline accumulation.

On the other hand, glutathione peroxidase is a key component of the glutathione-ascorbate cycle which reduces the accumulation of H₂O₂ by oxidizing reduced glutathione (GSH) to its disulfide form (GSSG) (Mittova et al., 2003). In the ZmNADP-ME overexpressers, glutathione peroxidase activity is known to increase due to greater availability of NADPH that regenerates reduced form of glutathione (GSH). The increased activity of glutathione peroxidase substantially decreases H₂O₂ content in the transgenics (Fig. 7c, d). Consequently, malondialdehyde (MDA) production, an indicator of membrane lipid peroxidation decreased in transgenics (Fig. 7e). Our results suggest that higher activity of ROS scavenging enzymes, like peroxidase (Fig. 7c), in the transgenics may lead to efficient detoxification of active oxygen species (Fig. 7d), and reduction in malondialdehyde content (Fig. 7e) under saline environment. It is already known that NADP-ME is an important player in plant-based defence in Arabidopsis (Chen et al. 2019b). Malate levels usually decrease and activities of NAD-ME and NADP-ME increase when plants are exposed to NaCl treatment (Speer and Kaiser 1991; Aragao et al. 1997).Thus, malic enzyme not only balances the concentration of malic acid in the cells, but also reduces the production of ROS, thereby reducing the oxidative damage caused by ROS.

From our observations on the chloroplast structure (Fig. 7a; lower panels), we suggest that better photosynthetic function of the overexpressers, under salt stress conditions, may have been due to better stacking of thylakoids in grana, and preserved membrane architecture (Fig. 7a) due to increased proline content, increased glutathione peroxidase activity, reduced H₂O₂content and membrane lipid peroxidation. Further, under identical conditions, organization and architecture of thylakoid membranes were grossly affected in the vector control plants, which must have limited their photosynthesis potential (Fig. 7a).

Previously, we have shown that other C4 genes, PEP carboxylase (PEPC) and NADP-MDH overexpressed in Arabidopsis resulted in generation of increased proline content, lower H₂O₂and membrane lipid peroxidation product MDA that protected plants from salt stress (Kandoi et al 2016, 2018). Similarly, our present study with ZmNADP-ME overexpression demonstrates that increased proline content and lowered ROS generation --that protect plants from salinity stress-- lead to increased photosynthetic efficiency of plants in stress condition. Therefore, C4 genes could be utilized to generate abiotic stress -tolerant crop plants.

CaMV - Cauliflower mosaic virus; Chl - Chlorophyll; ETRII - Electron transport rate of PSII; Fm - Maximum Chl a fluorescence; Fo - Minimum Chl a fluorescence; Fv - Variable Chl a fluorescence (Fm-Fo); MDA –malondialdehyde; MDH - Malate dehydrogenase; ME – Malic enzyme; MS medium - Murashige and Skoog medium; NPQ - Non-photochemical quenching of Chl a fluorescence; nptII - Neomycin phosphotransferase (kanamycin resistance gene); OAA – Oxaloacetic acid; PEP - Phosphoenolpyruvate; PSII—Photosystem II; ROS - Reactive oxygen species; Rubisco - Ribulose-1,5-bisphosphate carboxylase/oxygenase; VC - Vector control; WUE - Water use efficiency; фPSII - Effective quantum yield of PSII.

Statements and Declaration

In this study, we have not used any animal species. This work was supported by the Science & Engineering Research Board (EMR/2016/004976) from the Govt of India to BCT, and by the D. S. Kothari Post-Doctoral Fellowship (BL/19-20/0157) to DK from the University Grants Commission, India.

Competing Interests

Authors declare no conflict of interest.

Acknowledgments

We are thankful to Govindjee (of the University of Illinois at Urbana-Champaign) for his comments and valuable suggestions to improve the manuscript.

Akram NA, Ashraf M (2011) Improvement in growth, chlorophyll pigments and photosynthetic performance in salt-stressed plants of sunflower (Helianthus animus L.) by foliar application of 5-aminolevulinic acid. Agrochimica 55:94–104
Alvarez CE, Saigo M, Margarit E, et al (2013) Kinetics and functional diversity among the five members of the NADP-malic enzyme family from Zea mays, a C4 species. Photosynth Res 115:65–80. https://doi.org/10.1007/s11120-013-9839-9
Aragao MEFD, Jolivet Y, Lima MGS, Dizengremel DFDM (1997) NaCl-induced changes of NAD(P) malic enzyme activities in Eucalyptus citriodora leaves. Trees - Struct Funct 12:66–72. https://doi.org/10.1007/s004680050123
Asada K (1999) The water-water cycle in chloroplasts: Scavenging of Active Oxygens and Dissipation of Excess Photons. Annu Rev Plant Physiol Plant Mol Biol 50:601–639. https://doi.org/10.1146/annurev.arplant.50.1.601
Asai N, Nakajima N, Tamaoki M, et al (2000) Role of Malate Synthesis Mediated by Phosphoenolpyruvate Carboxylase in Guard Cells in the Regulation of Stomatal Movement. Plant and Cell Physiology 41: 10–15
Baker NR (2008) Chlorophyll fluorescence: a probe of photosynthesis in vivo. Annu Rev Plant Biol 59:89–113. https://doi.org/10.1146/annurev.arplant.59.032607.092759
Bates LS, Waldren RP, Teare ID (1973) Rapid determination of free proline for water-stress studies. Plant Soil 39(1):205–207
Björkman O, Demmig B (1987) Photon yield of O2 evolution and chlorophyll fluorescence characteristics at 77 K among vascular plants of diverse origins. Planta 170:489–504. https://doi.org/10.1007/BF00402983
Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72:248–254
Bräutigam A, Schliesky S, Külahoglu C, et al (2014) Towards an integrative model of C4 photosynthetic subtypes: insights from comparative transcriptome analysis of NAD-ME, NADP-ME, and PEP-CK C4 species. J Exp Bot 65:3579. https://doi.org/10.1093/JXB/ERU100
Casati P, Spampinato CP, Andreo CS (1997) Characteristics and Physiological Function of NADP-Malic Enzyme from Wheat. Plant Cell Physiol 38:928–934. https://doi.org/10.1093/Oxfordjournals.pcp.A029253
Chaves MM, Flexas J, Pinheiro C (2009) Photosynthesis under drought and salt stress: Regulation mechanisms from whole plant to cell. Ann. Bot. 103:551–560
Chen FF, Chien CY, Cho CC, et al (2019a) C‐terminal redox domain of Arabidopsis APR1 is a non‐canonical thioredoxin domain with glutaredoxin function. Antioxidants 8:. https://doi.org/10.3390/ANTIOX8100461
Chen Q, Wang B, Ding H, et al (2019b) Review: The role of NADP-malic enzyme in plants under stress. Plant Sci 281:206–212. https://doi.org/10.1016/j.plantsci.2019.01.010
Cheng Y, Long M (2007) A cytosolic NADP-malic enzyme gene from rice (Oryza sativa L.) confers salt tolerance in transgenic Arabidopsis. Biotechnol Lett 29:1129–1134. https://doi.org/10.1007/s10529-007-9347-0
Chi W, Zhou JS, Zhang F, Wu NH (2004) Photosynthetic features of transgenic rice expressing sorghum C-4 type NADP-ME. Acta Bot Sin 46(7)
Clough SJ, Bent AF (1998) Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J 16(6):735–743
Das K, Roychoudhury A (2014) Reactive oxygen species (ROS) and response of antioxidants as ROS-scavengers during environmental stress in plants. Front Environ Sci 2:1–13. https://doi.org/10.3389/fenvs.2014.00053
Delauney AJ, Verma DPS (1993) Proline biosynthesis and osmoregulation in plants. Plant J 4:215–223. https://doi.org/10.1046/j.1365-313X.1993.04020215.x
Demmig B, Garab G, Adams W, Govindjee W III, Govindjee (eds) (2014) Non photochemical quenching and energy dissipation in plants, algae and cyanobacteria. Advances in photosynthesis and respiration, vol 40. Springer, Dordrecht
Demmig B, Winter K, Kruger A, Czygan FC (1987) Photoinhibition and zeaxanthin formation in intact leaves : a possible role of the xanthophyll cycle in the dissipation of excess light energy. Plant Physiol 84:218–224
Detarsio E, Maurino VG, Alvarez CE, et al (2008) Maize cytosolic NADP-malic enzyme (ZmCytNADP-ME): a phylogenetically distant isoform specifically expressed in embryo and emerging roots. Plant Mol Biol 68:355. https://doi.org/10.1007/s11103-008-9375-8
Doubnerová Hýsková V, Miedzińska L, Dobrá J, et al (2014) Phosphoenolpyruvate carboxylase, NADP-malic enzyme, and pyruvate, phosphate dikinase are involved in the acclimation of Nicotiana tabacum L. to drought stress. J Plant Physiol 171:19–25. https://doi.org/https://doi.org/10.1016/j.jplph.2013.10.017
Doubnerová V, Ryšlavá H (2011) What can enzymes of C4 photosynthesis do for C3 plants under stress? Plant Sci 180:575–583. https://doi.org/10.1016/j.plantsci.2010.12.005
Emami P, Razi H, Dastfal M (2016) Effect of Salt Stress on NADP-Malic Enzyme Activity, Proline and Ionic Contents of Durum Wheat Genotypes. Biological Forum – An International Journal 8(2): 112-119.
Fahnenstich H, Saigo M, Niessen M, et al (2007) Alteration of organic acid metabolism in Arabidopsis overexpressing the maize C4 NADP-malic enzyme causes accelerated senescence during extended darkness. Plant Physiol 145:640–652. https://doi.org/10.1104/pp.107.104455
Fu ZY, Zhang Z Bin, Hu XJ, et al (2009) Cloning, identification, expression analysis and phylogenetic relevance of two NADP-dependent malic enzyme genes from hexaploid wheat. Comptes Rendus - Biol. 332(7):591-602. https://doi.org/10.1016/j.crvi.2009.03.002
Fu ZY, Zhang ZB, Liu ZH, et al (2011) The effects of abiotic stresses on the NADP-dependent malic enzyme in the leaves of the hexaploid wheat. Biol Plant 55:196–200. https://doi.org/10.1007/s10535-011-0030-x
Fushimi T, Umeda M, Shimazaki T, et al (1994) Nucleotide sequence of a rice cDNA similar to a maize NADP-dependent malic enzyme. Plant Mol Biol 24:965–967. https://doi.org/10.1007/BF00014450
Gegenheimer P (1990) Preparation of extracts from plants. Methods. Enzymol 182:174–193
Gerald E E, Carlos S A (1992) NADP-malic enzyme from plants. Phytochemistry 31:1845–1857. https://doi.org/10.1016/0031-9422(92)80322-6
Goss T, Hanke G (2014) The End of the Line: Can Ferredoxin and Ferredoxin NADP(H) Oxidoreductase Determine the Fate of Photosynthetic Electrons? Curr Protein Pept Sci 15:385–393. https://doi.org/10.2174/1389203715666140327113733
Govindjee (1995) Sixty-three years since Kautsky: chlorophyll a fluorescence. Aust J Plant Physiol 22:131–160. https://doi.org/doi:10.1071/PP9950131
Guo P, Baum M, Grando S, et al (2009) Differentially expressed genes between drought-tolerant and drought-sensitive barley genotypes in response to drought stress during the reproductive stage. J Exp Bot 60:3531–3544. https://doi.org/10.1093/jxb/erp194
Hare PD, Cress WA, Van Staden1 J (1999) Proline synthesis and degradation: a model system for elucidating stress-related signal transduction. J Exp Bot 50:413–434
Hatch M (1987) C4 Photosynthesis: a unique blend of modified biochemistry, anatomy abd ultrastructure. Biochim Biophys Acta 895:81–106. https://doi.org/10.1016/0003-9861(88)90351-7
Hayat S, Hayat Q, Alyemeni MN, et al (2012) Role of proline under changing environments: A review. Plant Signal Behav 7:1456–1466. https://doi.org/10.4161/psb.21949
Hibberd JM, Sheehy JE, Langdale JA (2008) Using C4 photosynthesis to increase the yield of rice—rationale and feasibility. Curr Opin Plant Biol 11:228–231. https://doi.org/10.1016/J.PBI.2007.11.002
Hodges DM, DeLong JM, Forney CF, Prange RK (1999) Improving the thiobarbituric acid-reactive-substances assay for estimating lipid peroxidation in plant tissues containing anthocyanin and other interfering compounds. Planta 207(4):604–611
Huang H, Ullah F, Zhou DX, et al (2019) Mechanisms of ROS regulation of plant development and stress responses. Front Plant Sci 10:1–10. https://doi.org/10.3389/fpls.2019.00800
Jilani A, Kar S, Bose S, Tripathy BC (1996) Regulation of the carotenoid content and chloroplast development by levulinic acid. Physiol Plant 96:139–145. https://doi.org/10.1111/j.1399-3054.1996.tb00194.x
Kalemba EM, Alipour S, Wojciechowska N, Omaye S (2021) NAD(P)H Drives the Ascorbate-Glutathione Cycle and Abundance of Catalase in Developing Beech Seeds Differently in Embryonic Axes and Cotyledons. Antioxidants 10(12) https://doi.org/10.3390/antiox10122021
Kandoi D, Mohanty S, Govindjee, Tripathy BC (2016) Towards efficient photosynthesis: overexpression of Zea mays phosphenolpyruvate carboxylase in Arabidopsis thaliana. Photosynth Res. 130(1-3):47-72. https://doi.org/10.1007/s11120-016-0224-3
Kandoi D, Mohanty S, Tripathy BC (2018) Overexpression of plastidic maize NADP-malate dehydrogenase (ZmNADP-MDH) in Arabidopsis thaliana confers tolerance to salt stress. Protoplasma 255:547–563. https://doi.org/10.1007/S00709-017-1168-Y
Kandoi D, Ruhil K, Govindjee G, Tripathy BC (2022) Overexpression of cytoplasmic C4 Flaveria bidentis carbonic anhydrase in C3 Arabidopsis thaliana increases amino acids, photosynthetic potential, and biomass. Plant Biotechnol J 20(8): 1518–1527. https://doi.org/10.1111/pbi.13830
Karnovsky MJ (1965) A formaldehyde-glutaraldehyde fixative of high osmolality for use in electron microscopy. J Cell Biol 27:137–138
Krause GH, Weis E (1991) Chlorophyll Fluorescence and Photosynthesis: The Basics. Annu. Rev. Plant Physiol. Plant Mol. Biol. 42:313–349
Laporte MM, Shen B, Tarczynski MC (2002) Engineering for drought avoidance: expression of maize NADP-malic enzyme in tobacco results in altered stomatal function. J Exp Bot. 53(369):699-705. doi: 10.1093/jexbot/53.369.699. PMID: 11886890.
Liu S, Cheng Y, Zhang X, et al (2007) Expression of an NADP-malic enzyme gene in rice (Oryza sativa. L) is induced by environmental stresses; over-expression of the gene in Arabidopsis confers salt and osmotic stress tolerance. Plant Mol Biol 64:49. https://doi.org/10.1007/s11103-007-9133-3
Madan S, Nainawatee HS, Jain RK, Chowdhury JB (1995) Proline and Proline Metabolising Enzymes in in-vitro Selected NaCl-tolerant Brassica juncea L. under Salt Stress. Ann Bot 76:51–57. https://doi.org/10.1006/anbo.1995.1077
Mittova V, Theodoulou FL, Kiddle G, Gómez L, Volokita M, Tal M, Foyer CH, Guy M (2003)
Coordinate induction of glutathione biosynthesis and glutathione-metabolizing enzymes is correlated with salt tolerance in tomato. FEBS Letters 554 (3): 417-421. https://doi.org/10.1016/S0014-5793(03)01214-6
Mu¨ller P, Li XP, Niyogi KK (2001) Non-photochemical quenching: a response to excess light energy. Plant Physiol 125:1558–1566
Nascimento E, Silva D, Ribeiro RV, et al (2011) Salt stress induced damages on the photosynthesis of physic nut young plants. Sci Agric (Piracicaba, Braz.) 68:62–68. https://doi.org/10.1590/S0103-90162011000100010
Netondo GW, Onyango JC, Beck E (2004) Sorghum and Salinity. Crop Sci 44:806–811. https://doi.org/10.2135/CROPSCI2004.8060
Neubauer C, Schreiber U (1987) The Polyphasic Rise of Chlorophyll Fluorescence upon Onset of Strong Continuous Illumination: I. Saturation Characteristics and Partial Control by the Photosystem II A cceptor Side. Zeitschrift für Naturforschung C 42: 1246-1254
Nguyen HT, Leipner J, Stamp P, Guerra-Peraza O (2009) Low temperature stress in maize (Zea mays L.) induces genes involved in photosynthesis and signal transduction as studied by suppression subtractive hybridization. Plant Physiol Biochem 47:116–122. https://doi.org/https://doi.org/10.1016/j.plaphy.2008.10.010
Nickrent DL (1994) From field to film: rapid sequencing methods for field-collected plant species. Biotechniques 16(3):470–475
Niyogi KK (1999) Photoprotection revisited: genetic and molecular approaches. Annu Rev Plant Physiol Plant Mol Biol 50:333–359
Padhi, B., Chauhan, G., Kandoi, D., Stirbet, A., Tripathy, B.C., & Govindjee, G. (2021). A comparison of chlorophyll fluorescence transient measurements, using Handy PEA and FluorPen fluorometers. Photosynthetica, 59:399-408. doi: 10.32615/ps.2021.026
Papageorgiou GC, Govindjee (eds) (2004) Chlorophyll a fluorescence: a signature of photosynthesis. Advances in photosynthesis and respiration, vol 19. Springer, Dordrecht
Pattanayak GK, Biswal AK, Reddy VS, Tripathy BC (2005) Lightdependent regulation of chlorophyll b biosynthesis in chlorophyllide a oxygenase overexpressing tobacco plants. Biochem Biophys Res Commun 326(2):466–471
Pinto ME, Casati P, Hsu T-P, et al (1999) Effects of UV-B radiation on growth, photosynthesis, UV-B-absorbing compounds and NADP-malic enzyme in bean (Phaseolus vulgaris L.) grown under different nitrogen conditions. J Photochem Photobiol B Biol 48:200–209. https://doi.org/https://doi.org/10.1016/S1011-1344(99)00031-7
Porra RJ, Thompson W a, Kriedemann PE (1989) Determination of Accurate Extinction Coefficients and Simultaneous-Equations for Assaying Chlorophyll-a and Chlorophyll-B Extracted with 4 Different Solvents - Verification of the Concentration of Chlorophyll Standards by Atomic-Absorption Spectroscopy. Biochim Biophys Acta 975:384–394. https://doi.org/Doi 10.1016/S0005-2728(89)80347-0
Putter J (1974) Peroxidase. In: Bergmeyer HU (ed) Methods of enzymatic analysis. Verlag Chemie, Weinhan, pp 685–690
Sage RF (2004) The evolution of C 4 photosynthesis. New Phytol 161:341–370. https://doi.org/10.1046/j.1469-8137.2004.00974.x
Sambrook J, Russell DW (2001) Molecular cloning: a laboratory manual, 3rd edn. Cold Spring Harbor Laboratory Press, New York
Schansker G, Strasser RJ (2005) Quantification of non-QB-reducing centers in leaves using a far-red pre-illumination. Photosynth Res 84:145–151. https://doi.org/10.1007/s11120-004-7156-z
Schreiber U (2004) Pulse-amplitude-modulation (PAM) fluorometry and saturation pulse method: an overview. In: Papageorgiou GC, Govindjee (eds) Chlorophyll a fluorescence: a signature of photosynthesis. Advances in photosynthesis and respiration, vol 19. Springer, Dordrecht, pp 279–319
Sicher R, Bunce J, Barnaby J, Bailey B (2015) Water-deficiency effects on single leaf gas exchange and on C4 pathway enzymes of maize genotypes with differing abiotic stress tolerance. Photosynthetica 53:3–10. https://doi.org/10.1007/s11099-015-0074-9
Speer M, Kaiser WM (1991) Ion Relations of Symplastic and Apoplastic Space in Leaves from Spinacia oleracea L. and Pisum sativum L. under Salinity. Plant Physiol 97:990–997. https://doi.org/10.1104/PP.97.3.990
Sun X, Han G, Meng Z, et al (2019) Roles of malic enzymes in plant development and stress responses. Plant Signal Behav 14:10:. https://doi.org/10.1080/15592324.2019.1644596
Swain A, Behera D, Karmakar S, et al (2021) Morphophysiological alterations in transgenic rice lines expressing PPDK and ME genes from the C4 model Setaria italica. J Plant Physiol 264:. https://doi.org/10.1016/j.jplph.2021.153482
Szabados L, Savouré A (2010) Proline: a multifunctional amino acid. Trends Plant Sci 15:89–97. https://doi.org/10.1016/J.TPLANTS.2009.11.009
Takeuchi Y, Akagi H, Kamasawa N, et al (2000) Aberrant chloroplasts in transgenic rice plants expressing a high level of maize NADP-dependent malic enzyme. Planta 211:265-74
Tsuchida H, Tamai T, Fukayama H, et al (2001) High level expression of C4-specific NADP-malic enzyme in leaves and impairment of photoautotrophic growth in a C3 plant, rice. Plant Cell Physiol 42:138–145. https://doi.org/10.1093/pcp/pce013
Turan S, Tripathy BC (2015) Salt-stress induced modulation of chlorophyll biosynthesis during de-etiolation of rice seedlings. Physiol Plant 153:477–491. https://doi.org/10.1111/ppl.12250
Von Caemmerer S, Quick WP, Furbank RT (2012) The Development of C4 Rice: Current Progress and Future Challenges. Science 336:1671–1672. https://doi.org/10.1126/SCIENCE.1220177
Walter Michael H, Grima‐Pettenati J, Feuillet C (1994) Characterization of a Bean (Phaseolus vulgaris L.) Malic‐enzyme Gene. Eur J Biochem 224:999–1009. https://doi.org/10.1111/j.1432-1033.1994.t01-1-00999.x
Wang Y, Long SP, Zhu XG (2014) Elements required for an efficient NADP-malic enzyme type C4 photosynthesis. Plant Physiol 164:2231–2246. https://doi.org/10.1104/pp.113.230284
Wheeler MCG, Tronconi MA, Drincovich MF, et al (2005) A comprehensive analysis of the NADP-malic enzyme gene family of Arabidopsis. Plant Physiol 139:39–51. https://doi.org/10.1104/pp.105.065953
Wingler A, Walker RP, Chen Z, Leegood RC (1999) Phosphoenolpyruvate carboxykinase is involved in the decarboxylation of aspartate in the bundle sheath of maize. Plant Physiol. 120:539-46.
Zell MB, Fahnenstich H, Maier A, et al (2010) Analysis of Arabidopsis with highly reduced levels of malate and fumarate sheds light on the role of these organic acids as storage carbon molecules. Plant Physiol 152:1251–1262. https://doi.org/10.1104/pp.109.151795
Zhu X-G, Long SP, Ort DR (2008) What is the maximum efficiency with which photosynthesis can convert solar energy into biomass? Curr Opin Biotechnol 19:153–159. https://doi.org/10.1016/j.copbio.2008.02.004
Zlatev ZS, Yordanov IT (2004) Effects of soil drought on photosynthesis and chlorophyll fluorescence in bean plants. Journal of Plant Physiology 30:3–18

No competing interests reported.

Download PDF

Journal Publication

published 10 Aug, 2023

Read the published version in Photosynthesis Research →

Editorial decision: Major revision
13 Apr, 2023
Reviews received at journal
13 Apr, 2023
Reviewers agreed at journal
04 Apr, 2023
Reviews received at journal
21 Feb, 2023
Reviewers agreed at journal
21 Feb, 2023
Reviewers invited by journal
20 Feb, 2023
Editor assigned by journal
10 Oct, 2022
Submission checks completed at journal
09 Oct, 2022
First submitted to journal
07 Oct, 2022

You are reading this latest preprint version

Overexpression of chloroplastic Zea mays NADP-malic enzyme (ZmNADP-ME) confers tolerance to salt stress in Arabidopsis thaliana

Status:

Journal Publication

Version 1

Abstract

Figures

Introduction

Materials And Methods

Results

Discussion

Abbreviations

Declarations

References

Additional Declarations

Status:

Journal Publication

Version 1