CPG-52364 targeted TLR9 regulate lung injury induced by inflammation reaction resulting from elderly hip fracture caused mtDNA release

doi:10.21203/rs.3.rs-2150386/v1

Download PDF

Research Article

CPG-52364 targeted TLR9 regulate lung injury induced by inflammation reaction resulting from elderly hip fracture caused mtDNA release

https://doi.org/10.21203/rs.3.rs-2150386/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background- Acute lung injury (ALI) after elderly hip fracture is the serious and fatal complication, it is associated with inflammation induced by mtDNA release activates TLR9/NF-ƘB pathway after trauma. Inhibiting TLR9 pathway activation can alleviate the systemic inflammation and ALI after elderly hip fracture. In the first part of our study, we investigate the effect of the TLR9 inhibitor (CPG-52364) in the pathological process of inflammation and ALI after elderly hip fracture. In the second part of our study, we investigate the effect of CPG-52364 in the pathological process of inflammation and ALI induced by mtDNA.

Material and Methods- In the first part of our study, the elderly rats received hip fracture operations and CPG-52364 managed. The degree of lung injury and inflammation were evaluated, TLR9/NF-ƘB were determined using Western blot, and mtDNA were analyzed by fluorescent quantitative polymerase chain reaction. In the second part of our study, the elderly rats received mtDNA injection and CPG-52364 managed, the specimens were collected and detected as the first part.

Results- Both hip fracture and mtDNA injection can cause significant cytokines (IL-6 and IL-10) release, TLR9 and NF-ƘBp65 expression, and lung injury in the elderly rats. CPG-52364 can effectively down-regulate the expression of the above pathological indicators.

Conclusion- These results suggest that the CPG-52364 can down-regulate the TLR9/NF-ƘB pathway to control the inflammation and ALI induced by mtDNA release after elderly hip fracture.

elderly hip fracture

mtDNA

ALI

CPG-52364

The mortality rate of elderly hip fracture remains unacceptably high that is associated with acute lung injury (ALI) and subsequent lung infection after trauma [1–4]. Pulmonary infection is a common complication of the elderly hip fracture that is related to mitochondrial DNA (mtDNA) release after fracture [5–7]. MtDNA a newly identified damage-associated molecular pattern, is positively correlated with the risk of systemic inflammatory response syndrome (SIRS) in the pathologic process of acute trauma [8, 9]. MtDNA derived from the circular genomes of bacteria that evolved into the mitochondria of eukaryotic cells. Similar to bacterial DNA, mtDNA contains a higher frequency of unmethylated cytosine–phosphate–guanine (CpG) dinucleotides. Unmethylated CpG motifs can be recognized by the innate immune system and exerts powerful immunostimulatory effects. During stress and injury, certain molecules released from impaired mitochondria function as danger-associated molecular patterns (DAMPs), including mtDNA, which activates neutrophil through TLR9/p38 MAPK, leading to inflammatory cytokines (such as IL-1β, IL-6, TNF-α, etc) release. If inflammation is not effectively controlled, it potentially contributes to the development of post traumatic SIRS [10, 11]. Our previous research also showed that in an elderly hip fracture model of acute lung injury (ALI) that mitochondrial DNA (mtDNA) release induce inflammatory mediator production, it leads to systemic inflammation and lung injury which is correlated with activation of TLR9/NF-ƘB pathway [5, 6]. Hence, Inhibiting TLR9 pathway activation induced by post-trauma mtDNA release is the key of alleviating the systemic inflammation and lung injury after elderly hip fracture. Among the antagonists of TLR9, CPG-52364 deserves attention. CPG-52364 is endosomal TLR9 inhibitor that blocks ligand-induced activation of TLR9[12]. Since CPG-52364 was tested in some autoimmune diseases. The results were positive and indicated that CPG-52364 suppressed autoimmune antibody production and reduced inflammation by inhibiting TLR9 activation [13]. CPG-52364 is being considered for early stage clinical development. The purpose of our study was to investigate the effect of CPG-52364 in inhibiting inflammatory response and ALI induced by mtDNA releasing after elderly hip fracture.

This paper consisted of two parts. In the first part, we studied the influence of CPG-52364 on inflammatory response and ALI in the elderly hip fracture rats. In the second part, we investigated the effects of CPG-52364 in inflammatory response and ALI induced by mtDNA in the elderly rats.

Animals

Rats of 22 to 23 months old are considered elderly [4–6]. A total of 80 elderly male Sprague-Dawley(SD) rats (age:22-23months; weight:450–550g, Animal Experiment Center of Southern Medical University, China) were allowed to acclimate for 1 week prior to the experimental procedures. Experiments were performed according to the guidelines for experimental animal care and use approved by the Southern Medical University.

First part

Grouping of animals- 40 elderly rats were divided into 4 groups randomly (sham group, fracture group, control group, CPG-52364 group). The sham group(n = 10) only received anesthesia, cannulation, and observation. In addition to these, the other three groups also received hip fracture operations, the models are made by referring to our previous articles [4–6]. Moreover, the control group (n = 10) immediately received intravenous injections with 1 ml saline after hip fracture, and the CPG-52364 group (n = 10) received intravenous injections with 1 ml CPG-52364 solution (1.25mg/ml).

Collection of samples-The rats were sacrificed by cervical dislocation at 24 h after treatment, samples were collected by referring to our previous articles [5]. The blood samples were rapidly collected by heart puncture after the thoraxes were opened, then centrifuged at 3000rpm for 10min, and the serum was extracted, stored at -80℃ for later mtDNA and cytokines assay. Bronchoalveolar lavage fluid was collected through the left trachea, then centrifuged at 3000rpm for 10min. The supernatant was frozen at -80℃for cytokines and protein assay. The right middle lung lobes were taken for myeloperoxidase (MPO), neutrophil elastase (NE), TLR9, and NF-ĸB measurement. The right lower lung lobes were collected for wet/dry(W/D) ratio measured; the rest of the right lung was fixed immediately in 10% formalin and stored at -4℃ for subsequent histological observation and pathological scoring.

Lung tissue W/D ratio-The right lower lung lobe specimens were collected and weighed to measure the wet weight; subsequently, the samples were placed in an -80℃drying oven for 48h until the weights unchanged. The dried lung tissue was weighed again for dry weight, and then W/D ratio of lung tissue was calculated.

Histological analysis-Lung specimens were embedded in paraffin. Tissue sections (5–8µm) were prepared and stained with hematoxylin and eosin. Briefly, 3 slices were randomly selected from each rat, and 3 fields of each slice were reviewed under a microscope(original magnification ×100; Olympus DP71, Tokyo, Japan). All slides were examined and scored by a pathologist (R.Z.) experienced and blinded to the experimental groups according to the lung injury scoring system [14]. The score was based on categories of inflammatory cell infiltration, pulmonary edema, congestion, and intra-alveolar hemorrhage that were graded on a scale from normal(zero), mild (1), moderate (2), to severe injury (3), with a maximum possible score of 12.

Protein assay-The total protein concentration in the bronchoalveolar lavage fluid (BALF) was determined by bicinchoninic acid protein assay kit (Pierce Biotechnology, Rockford, Ill) following the manufacturer’s instructions.

Cytokine assay-The cytokines (IL-6 and IL-10) of serum and BALF were measured by enzyme-linked immunosorbent assay system (R&DSystems, Minneapolis, Minn) following the manufacturer’s instructions.

MPO and NE Activity Assay-The pulmonary tissues were placed in 1ml of homogenization buffer (4℃). Samples were homogenized and incubated at 4℃for 1h. The final homogenate was centrifuged at 10,000rpm for 15min. Tissue supernatants were used for the determination of NE and MPO activity. MPO activity was measured by MPO kit (Miltenyi Biotec, Bergisch Gladbach, Germany) according to manufacturer’s instructions. NE activity was determined by quantitative sandwich enzyme immunoassay (R&D Systems) following the manufacturer’s instructions.

Western blot-Total protein was extracted from pulmonary tissue using a total protein extraction kit (Applygen, Beijing, China) following the manufacturer’s instructions. The protein concentrations of extracts were determined using a bicinchoninic acid protein assay reagent kit (Novagen, Madison, Wisc). Proteins (10µg) were separated in sodium dodecyl sulfate polyacrylamide gel electrophoresis gels and transferred to polyvinylidene difluoride membranes. After the membranes were blocked in Tris-buffered saline (TBS) with 5% bovine serum albumin for 60 min at room temperature, incubated with the corresponding primary antibodies for TLR9, phosphorylated(p)-NF-ĸBp65 (Cell Signaling Technology, Danvers, Mass), and GAPDH (Santa Cruz Biotechnology, Santa Cruz, Calif) at 4℃overnight. Membranes loaded with primary antibodies were washed with Trisbuffered saline with Tween buffer on the second day and then were incubated with fluorescent labeling second antibodies for 1h at room temperature. An imaging densitometer (LI-COR Bioscience, Lincoln, Neb) was used to analyze the relative density of each band.

Serum mtDNA isolation-Serum was extracted before the blood samples were incubated at 37℃for 1h and centrifuged at 2,500rpm for 10min. Serum DNA was extracted from 200µl serum using a QIAamp Blood Mini Kit based on affinity columns(Qiagen, Hilden, Germany) according to the manufacturer’s recommendations.

Real-time fluorescent quantitative polymerase chain reaction- Mitochondrial DNA gene primers were designed according to a previous study [5] as follows: forward: CAGCCGCTATTAAAGGTTCG, reverse: CCTGGATTACTCCGGTCTGA. The product size was 79 base pairs. The mtDNA plasmid was constructed using a TA cloning kit as follows: the purified polymerase chain reaction (PCR) products were linked into the pMD18-T vector(TaKaRa, Japan), and the connective product was transformed to DH5αcompetent Escherichia coli. The positive clone E.coli was screened and enriched, then mtDNA was extracted from the plasmid and measured. A standard curve was generated by 6 dilutions of DNA (range, 102–107 copies per microliter) using an ABI 7500 sequence detection system (ABI, USA). Fluorescent quantitative PCR(FQ-PCR) reactions were conducted in 96-well plates within a total volume of 20 µl per well containing the following reagents: SYBR Premix ExTaq^TMII (2×),10µl; forward primer, 0.8µl; reverse primer, 0.8µl; ROX reference DyeII (50×), 0.4µl; DNA,2µl; and ddH₂O, 6µl. The PCR kit was purchased from TaKaRa Company (TaKaRa, Japan). The PCR reaction was conducted using the following conditions: 95℃for 30s, followed by 95℃for 5s, and 60℃for 34s, repeated for 40 cycles. Each sample and DNA standard were analyzed in duplicate, and the mean value was used for quantification. Only a standard curve with a coefficient of correlation greater than 0.96 was accepted.

Second part

Rat femur mtDNA preparation-Ten rats were sacrificed by cervical dislocation, and then femurs were collected; the femurs’ mitochondria were isolated using a mitochondrial isolation kit (Pierce Biotechnology) following the manufacturer’s instructions. Subsequently, the mitochondrial pellets were resuspended in Hank balanced salt solution (HBSS) (Gibco Life Technologies, Carlsbad, Calif). After a protease inhibitor cocktail (1:100) (Qiagen, German town, Md) was added, the suspension was sonicated on ice (VCX130-Vibra Cell; Sonics and Materials, New town, Conn) at 100% amplitude, 10 times for 30s each with 30s intervals. The mtDNA was isolated by centrifugation at 15,000g for 10min at 4℃followed by centrifugation at 100,000g at 4℃for 30min. The mtDNA were extracted from the isolated mitochondrial pellets using the DNeasy Blood and Tissue kit(Qiagen) following the manufacturer’s instructions. The purity and concentrations of the mtDNA were determined by FQ-PCR and spectrophotometry, respectively [5].

Mitochondrial DNA inoculation of animals-40 elderly rats were divided into 4 groups randomly (sham group, mtDNA group, CPG-52364 group and control group). Then, the control group(n = 10) received intravenous injections with 1mL phosphate-buffered saline and 1mL of 10µg/ml mtDNA, the mtDNA group(n = 10) received injections with 1mL of 10µg/ml mtDNA, and the CPG-52364 group(n = 10) received injections with 1mL of 10µg/ml mtDNA and 1 ml CPG-52364 solution (1.25mg/ml). The mtDNA concentration was selected according to our previous experiments [5]. After 24h, the animals were sacrificed by cervical dislocation, and then specimens were collected and detected as in the first part.

Statistical Analysis-Data were presented as means ± standard deviation. All data were analyzed by SPSS software (version13.0). One-way ANOVA with Bonferroni post hoc tests were performed to compare the data of all groups at each monitoring point. Quantitative data were compared between two groups using t-test. A P value of less than 0.05 was considered to be statistically significant.

First part

As shown in Fig. 1A, the lung tissue structure was clear, the alveolar walls were normal without significant inflammatory corpuscle infiltration after treatment. However, the pulmonary tissue slices of the fracture group (Fig. 1B) and the control group (Fig. 1D) exhibited increased congestion, pulmonary edema, polymorphonuclear and mononuclear cell infiltrates, and damaged alveolar architecture. The above pathological changes were significantly alleviated in the CPG-52364 group (Fig. 1C).

Compared to the sham group (Fig. 2 and Fig. 3), the serum mtDNA, IL-6, and IL-10 levels, the pulmonary histological score, the cytokines (IL-6 and IL-10) and protein concentrations in the BALF, the lung tissue W/D ratio, MPO and NE activities, and the TLR9 and NF- ƘBp65 protein expressions increased significantly in the fracture group and the control group (all P༜0.05). These indicators decreased significantly in the CPG-52364 group (all P༜0.05).

Second part

As shown in Fig. 4, the pulmonary tissue slices of the mtDNA group (Fig. 4B) show typical manifestations of acute lung injury. The pathological changes were significantly alleviated in the CPG-52364 group (Fig. 4C).

Compared to the sham group(Fig. 5and Fig. 6), the serum IL-6 and IL-10 levels, the pulmonary histological score, the cytokines (IL-6 and IL-10) and protein concentrations in the BALF, the lung tissue W/D ratio, MPO and NE activities, and the TLR9 and NF- ƘBp65 protein expressions increased significantly in the mtDNA group (all P༜0.05). These indicators decreased significantly in the CPG-52364 group (all P༜0.05).

Recognition of pathogen-associated molecular patterns (PAMPs) or endogenous DAMPs by innate immune cells as well as non-immune cells is the first line of response to pathogen or sterile tissue injury. Innate immune signaling triggered by DAMPs (including mtDNA) during sterile inflammation or the persistence of pathogens [15–17]. TLR9 play an important role in the recognition of exogenous and endogenous danger signals. TLR9 gives rise to rapid activation of signaling pathways, such as those involving NF-Ƙβ responsive factors, thereby leading to the secretion of pro-inflammatory cytokines, reactive oxygen species, antimicrobial peptides and acute-phase proteins. The signaling through TLR9 is an important element of host defense-induced by mtDNA[18–20].

MtDNA damage and exposure, it is an early event in damage exposed cells that provokes the immune response via the activation of TLR9, can trigger a systemic inflammatory response and result in ALI [21]. Thus, inhibition of TLR9 activation induced by post-traumatic mtDNA release indeed has the potential to inhibit systemic inflammation and lung injury after trauma.

In this study, we have characterized CPG-52364, a new TLR9 antagonist by animal studies, as a potential promising therapeutic for the treatment of systemic inflammation and subsequent ALI, which are induced by mtDNA release after elderly hip fracture. In the first part of experiment, the inflammatory chain reaction caused by TLR9 activation-induced mtDNA release after elderly hip fracture is effectively controlled by the CPG-52364. In the CPG-52364 group, the TLR9 pathway activating protein (TLR9 and NF-ƘBp65) expressions decreased significantly; the serum mtDNA levels, the indicators of systemic inflammation (serum IL-6 and IL-10 levels) and ALI (pulmonary histological score, cytokine and protein concentrations in the BALF, lung tissue W/D ratio, MPO and NE activities) were effectively controlled.

In order to further verify the role of CPG-52364 in the pathological process of mtDNA-induced inflammatory response, we carried out the second part of this experiment. In the CPG-52364 group, the TLR9 pathway activating protein (TLR9 and NF- ƘBp65) expressions decreased significantly; the indicators of systemic inflammation and ALI also were effectively controlled. The CPG-52364 can indeed inhibit mtDNA-induced activation of the TLR9 pathway, thus inhibiting the downstream inflammatory responses.

A growing body of evidence indicates that dysregulation of the receptors play a role in the pathogenesis of sepsis. The massive release of inflammatory mediators into the bloodstream following TLR activation is associated with sepsis, culminating in multiple organ failure. TLR9 play an important role in the recognition of exogenous and endogenous danger signals. TLR9 engagement gives rise to rapid activation of signaling pathways, such as it involving NF-Ƙβ responsive factors, thereby leading to the secretion of pro-inflammatory cytokines, reactive oxygen species, antimicrobial peptides and acute-phase proteins [21].

Although some novel therapeutic agents (the TLR9 blockader) have recently been introduced in the field of sepsis, their clinical efficacy remain controversial, as the mortality rate remains unacceptably high and they are associated with significant side effects [22, 23]. Hence, further investigation into the side effects of the CPG-52364 are required in controlling lung injury induced by inflammation reaction resulting from elderly hip fracture caused mtDNA release.

Ethical Approval

Our work has abided by the statement of ethical standards for manuscripts submitted to Inflammation.

Competing interests

There is no any competing financial and/or non-financial interests in relation to our work. There is no conflict of interest among any of the authors.

Authors' contributions

Xiao Yang, Guangpeng Ou and Bei Li contributed equally to this paper.

Funding

This work was supported by the natural science foundation of Guangdong province (2018A030313619).

Availability of data and materials

None of this work or any related articles have been submitted or are under review elsewhere. This is an original contribution from us.

Gupta R, Vashist D, Gupta P, et al. Predictors of 1-year Mortality After Hip Fracture Surgery in Patients with Age 50 years and Above: An Indian Experience[J]. Indian Journal of Orthopaedics, 2021(5):1–7.
Wu L C, Chou M Y, Liang C K, et al. Factors Affecting One-year Mortality of Elderly Patients After Surgery for Hip Fracture[J]. International Journal of Gerontology, 2016, 10(4).
Yu X, Chen X, Sun T. MicroRNA-205-5p Targets HMGB1 to Suppress Inflammatory Responses during Lung Injury after Hip Fracture[J]. BioMed Research International, 2019, 2019:1–13.
Gan L, Sun T, Li B, et al. Serum miR-146a and miR-150 as Potential New Biomarkers for Hip Fracture-Induced Acute Lung Injury[J]. Mediators of Inflammation, 2018, 2018:1–9.
Gan L, Chen X, Sun T, et al. Significance of Serum mtDNA Concentration in Lung Injury Induced by Hip Fracture.[J]. Shock, 2015, 44(1):52–57.
Li G, Zhong J, Zhang R, et al. The Immediate Intramedullary Nailing Surgery Increased the Mitochondrial DNA Release That Aggravated Systemic Inflammatory Response and Lung Injury Induced by Elderly Hip Fracture[J]. Mediators of Inflammation, 2015, 2015:587378.
Hai-Peng L I, Yao J H, Sun T S, et al. Analysis on mortality of elderly inpatients from orthopedic department[J]. Chinese Journal of Multiple Organ Diseases in the Elderly, 2016.
Faust H E, Reilly J P, Anderson B J, et al. Plasma Mitochondrial DNA Levels are Associated with Acute Respiratory Distress Syndrome in Trauma and Sepsis Patients[J]. Chest, 2019, 157(1).
Hef A, Jprb D, Bja B, et al. Plasma Mitochondrial DNA Levels Are Associated With ARDS in Trauma and Sepsis Patients[J]. 2020.
Thurairajah K, Briggs G D, Balogh Z J. The source of cell-free mitochondrial DNA in trauma and potential therapeutic strategies[J]. European Journal of Trauma and Emergency Surgery, 2018.
Faust H E, Oniyide O, Wang Y, et al. Early Plasma Nuclear DNA, Mitochondrial DNA, and Nucleosome Concentrations Are Associated With Acute Kidney Injury in Critically Ill Trauma Patients[J]. Critical Care Explorations, 2022, 4.
Chao-Yang L, Yu-Wen S, Kuo-I L, et al. Natural Modulators of Endosomal Toll-Like Receptor-Mediated Psoriatic Skin Inflammation[J]. Journal of Immunology Research, 2017, 2017:7807313.
Lai CY, Yeh DW, Lu CH, Liu YL, Huang LR, Kao CY, Chen HY, Huang CY, Chang CH, Luo Y, Xiang R, Chuang TH. Identification of Thiostrepton as a Novel Inhibitor for Psoriasis-like Inflammation Induced by TLR7-9. J Immunol. 2015 Oct 15;195(8):3912–21.
Deree J, Martins J, Campos T D, et al. Pentoxifylline Attenuates Lung Injury and Modulates Transcription Factor Activity in Hemorrhagic Shock[J]. Journal of Surgical Research, 2007, 143(1):99–108.
Moticka E J. Recognition Structures on Cells of the Innate Host Defense Mechanisms-ScienceDirect[J]. A Historical Perspective on Evidence-Based Immunology, 2016:121–128.
Reddy V P, Verma S, Sharma D, et al. Role of resistant-proteins in plant innate immunity-A review[J]. Agricultural Research Communication Centre, 2019(1).
Hauser, C, J, et al. Danger signals from mitochondrial DAMPS in trauma and post-injury sepsis[J]. European journal of trauma and emergency surgery: official publication of the European Trauma Society, 2018, 44(3):317–324.
Koenig A, Buskiewicz-Koenig IA. Redox Activation of Mitochondrial DAMPs and the Metabolic Consequences for Development of Autoimmunity. Antioxid Redox Signal. 2022 Mar;36(7–9):441–461.
Faas MM, de Vos P. Mitochondrial function in immune cells in health and disease. Biochim Biophys Acta Mol Basis Dis. 2020;1866(10):165845.
Pinti M. Molecular Mechanisms of mtDNA-Mediated Inflammation[J]. Cells, 2021, 10.
Kirtland ME, Tsitoura DC, Durham SR, Shamji MH. Toll-Like Receptor Agonists as Adjuvants for Allergen Immunotherapy. Front Immunol. 2020; 12(11):599083.
Chen JQ, Szodoray P, Zeher M. Toll-Like Receptor Pathways in Autoimmune Diseases. Clin Rev Allergy Immunol. 2016;50(1):1–17.
Balak DM, van Doorn MB, Arbeit RD, Rijneveld R, Klaassen E, Sullivan T, Brevard J, Thio HB, Prens EP, Burggraaf J, Rissmann R. IMO-8400, a toll-like receptor 7, 8, and 9 antagonist, demonstrates clinical activity in a phase 2a, randomized, placebo-controlled trial in patients with moderate-to-severe plaque psoriasis. Clin Immunol. 2017;174:63–72.

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

CPG-52364 targeted TLR9 regulate lung injury induced by inflammation reaction resulting from elderly hip fracture caused mtDNA release

Status:

Version 1

Abstract

Figures

Introduction

Materials And Methods

Results

Discussion

Declarations

References

Additional Declarations

Status:

Version 1