Increased abnormal erythrocytes caused by spleen filtration deficiency provide a hypoxic environment for the occurrence of psoriasis

doi:10.21203/rs.3.rs-2172554/v1

Download PDF

Research Article

Increased abnormal erythrocytes caused by spleen filtration deficiency provide a hypoxic environment for the occurrence of psoriasis

https://doi.org/10.21203/rs.3.rs-2172554/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background

Psoriasis is a chronic autoimmune disease with a long disease course and frequent relapse characteristics, however, its pathogenesis is still not completely clear. Clinical study indicated that blood state is abnormal in psoriasis and seems related with the severity of psoriasis. However, whether this is true and which constituents of blood play the key role and its mechanism behind is not clear.

Methods

Effect of blood constituents on the psoriasis development was determined by comparing serum, red cells, and leukocytes of psoriasis on the onset of psoriasis of NOG mice, using samples of healthy people as the control. The effect of red cell on psoriasis was further demonstrated by splenectomy using Kunming mice. Red cell morphology and spleen histopathology were studied by microscope. IL-6, IL-17A, IL-23, VEGF, IL-22, MDA, NO and HIF were determined by Elisa kits, and q-PCR was used to detect the mRNA of IL-6, IL-22, and IL-23, and western blot was used to detect CD-11b, SPIC, SIPR-α, TSP-1, and CD47.

Results

The hemorheology of psoriatic patients to be abnormal, and aging and deformed erythrocytes increased in the blood. Red cell and leukocyte from psoriasis were more likely to induce psoriasis when comparing with that of from the healthy volunteers, and the effect of red cell was more strong. When splenectomy, mice were also easy to induce psoriasis, demonstrating by the skin lesion, inflammatory factors and histopathology which all similar with psoriasis patients. Psoriasis spleen showed an increased red pulp and white pulp, and increased CD-11b, SPIC, TSP-1 and decreased SPRP-α, CD47 showed marginal change, indicated that the weakening of the “eat me” function of spleen macrophages phagocytizing aging and deformed erythrocytes, resulting in the dysfunction of spleen filtration and the increase of aging and deformed erythrocytes in the body. Additionally, the decreased oxygen-carrying capacity and the declined antioxidant capacity of those erythrocytes led to the hypoxia environment, making psoriasis more likely to be induced.

Conclusion

These findings demonstrate that spleen filtration dysfunction contributes to the pathogenesis of psoriasis and suggest that improving it may be an effective therapy for psoriasis and control its relapse.

Abnormal erythrocytes

spleen filtration deficiency

psoriasis

macrophages phagocytizing

hypoxia environment

psoriasis

red cell

spleen

filtration

CD-11b

SPRP

SPIC

CD47

TSP-1

Psoriasis is a chronic autoimmune disease with a long disease course and frequent relapse characteristics. The prevalence of psoriasis in all countries ranges from 0.09–5.1%, with the lowest prevalence in Tanzania and the highest prevalence in the USA. However, the data are increasing year by year [1]. The onset of psoriasis is often accompanied by complications, which can involve bone, joints, the endocrine system, and the cardiovascular system, bringing great pain and heavy financial burden to patients, thus affecting their quality of life [2–4].

Psoriasis is now recognized to be associated with inflammatory cytokine skin environments (lymphocytes, antigen-presenting cells, epithelial cells, and keratinocytes). Among them, the Th17 cell produces IL-17 and plays a key role in the maintenance and construction of autoimmunity [5, 6]; regulatory T cells (Treg) are abnormal in the blood and skin of patients with psoriasis [7]. In addition, dendritic cells may contribute to the production of Th1 cytokines and the supplementation of inflammatory cytokines in patients with psoriasis. In contrast, IL-17, IL-22, and IL-23 produced by bone marrow dendritic cells can promote the proliferation of keratinocytes, up-regulate inflammatory gene products and stimulate T cell activation, all of which promote the occurrence and development of psoriasis [8]. Moreover, endothelial cells play a key role in the recruitment of inflammatory cytokines by expressing E selection proteins, which promote the rearrangement of positive T cells (the epidermal lymphocyte-related antigen) into the skin [9]. Besides, some studies have shown that psoriasis may also be caused by heredity, infection, and various environmental factors [10–12]. However, up to now, its etiology and pathogenesis are still not completely clear. For the above reasons, the current psoriasis treatment is based on disease manifestations, the use of immunosuppressive agents, or the development of targets based on inflammatory factors in the disease, which can achieve good short-term efficacy but recurrence that is hard to control, indicated something important in the psoriasis development is still not clear.

Currently, some medical studies found that patients with psoriasis have a microvascular malformation, tube diameter dilation, and slow blood flow. Compared with normal people, the whole blood viscosity and blood ball pressure ratio of patients with psoriasis are significantly increased [13]. Vascular endothelial injury and elevated plasma endothelin levels are also presented [14]. Meanwhile, the content of VEGF in the skin lesions of patients with psoriasis was found to be related to psoriasis activity [15–17]. Although the heart function of patients with psoriasis was normal, the CT scan results suggested that 60% of patients had arterial calcification [18]. Furthermore, clinical evidence indicated that the platelet stimulating factor was significantly increased in patients with psoriasis, while significantly decreased after the condition was improved [19]. All the above data further suggest that psoriasis is closely related to blood metabolism and states. However, what causes the abnormal blood state in patients with psoriasis and whether the abnormal blood states contribute to the pathogenesis of psoriasis are unclear.

The spleen is an important filter in blood circulation, removing foreign matters, bacteria, and aged and dead cells, especially red blood cells and platelets. It also plays a major role in host defense [20–25]. When spleen filtration function is insufficient, the ability to remove abnormal red blood cells, foreign matters, and bacteria decreases [22–24]. As a result, the pathogens' cytokine content in the blood is greatly high, which leads to an irritable state of the immune system. Hence, the immune imbalance state easily appears under the stimulation of external factors. Excess levels of immune factors in the blood of psoriasis patients lead to excess T-cells in the skin may be a direct result of this phenomenon. In the meantime, when the spleen filtration function is insufficient, the blood is thick, and the fluidity of blood is reduced, which easily causes the formation of blood stasis and even increases the occurrence of thromboembolic events [26, 27]. We first propose the hypothesis that splenic dysfunction leads to psoriasis based on the above phenomena.

To test our hypothesis, we decided to explore the pathogenic factors of psoriasis in blood and splenic dysfunction by examining the blood state of psoriasis patients and changes in skin appearance, pathology and related factors in a mouse model induced by different blood components or splenectomy. In addition, the internal mechanism was studied to explain the connection between spleen dysfunction-blood state-psoriasis. This study could promote the study of the pathogenesis of psoriasis and provide a new idea for the treatment of psoriasis.

Mice and human subjects

The Animal Ethics Committee of Guangdong Provincial Hospital of Traditional Chinese Medicine approved all experimental animal procedures. The study was carried out following the National Institutes of Health Guide for the Care and Use of Laboratory Animals. Balb/c mice (certificate NO: 44824700001134) were purchased from Guangdong Yaokang Biotechnology Co., Ltd. NOG mice (certificate NO: 11400700192880) were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. Kunming (KM) mice (certificate NO: 4400720014862) were purchased from Guangdong Medical Laboratory Animal Center. During all experiments, mice were kept in an air-conditioned room at 22 ± 2°C for 3 days with a 12 h light and 12 h darkness cycle and free access to standard laboratory chow and tap water. The Human Ethics Committee approved the human studies of Guangdong Provincial Hospital of Traditional Chinese Medicine (Registration NO. ChiCTR-IOR-15006768), and written informed consent was obtained from individual or guardian participants.

Blood state evaluation

According to the inclusion and exclusion criteria, this study collected venous blood from 65 psoriasis patients (Supplementary material 1) and detected blood viscosity, erythrocyte aggregation index, erythrocyte rigidity index, hematocrit and, triglycerides, and high-density lipoprotein cholesterol.

The samples of the blood smear study were collected from 42 psoriasis patients and 30 healthy volunteers. A blood smear should be prepared within 4 hours and observed within 24 hours. First, three different fields were randomly selected under an upright microscope (BX41, Olympus, Japan), the number of poikilocytes was recorded, and then the poikilocyte rate was calculated.

A discontinuous percoll density gradient centrifugation separated the density layers of blood-red cells. Briefly, venous blood was harvested and a discontinuous percoll density gradient centrifugation separated the red blood cells. Then, a percoll gradient with five different density layers in glass tubes (1.0910g/mL, 1.0985g/mL, 1.1060g/mL, 1.1135g/mL, and1.1210g/mL from top to bottom) was prepared and the blood cells were centrifuged and distributed into different layers of similar densities. Finally, we measured the different layers' thickness with a caliper.

Separation of different human blood components

In this stage, 3 mL of whole blood from psoriasis patients or healthy volunteers were collected into a vacuum anticoagulative tube, and the subsequent separation of different blood components was carried out in a sterile environment to avoid contamination. After standing for 1 h, the blood was centrifuged at 3,000 rpm for 10 min. The plasma in the upper layer was taken and placed at 2–6°C for further use. The lower liquid was added with the same volume of PBS and mixed. Then, the mixture was transferred to a centrifuge tube containing 13 mL of lymphocyte separation fluid. After centrifuging at 800 rpm for 20 min, the middle leukocyte layer and the underlying erythrocytes were taken. Leukocytes were washed by PBS two times and cultured in a 1640 medium containing 10% FBS (Gibco, BRL) and 1% penicillin-streptomycin (Gibco, BRL). Erythrocytes were then mixed with Erythrocyte storage solution in a ratio of 1:1 at 2–6°C for further use.

Establishment and evaluation of an animal model of psoriasis

Mouse model of psoriasis induced by different human blood components

A total of 48 NOG mice were divided into eight groups: blank control group, imiquimod group, plasma of psoriasis patients group, leukocytes of psoriasis patients group, erythrocytes of psoriasis patients group, plasma of healthy human group, leukocytes of healthy human group, and erythrocytes of the healthy human group. Then, 200 µL of plasma, leukocytes (containing 1× 10⁶ leukocytes), or erythrocytes (1× 10⁹ erythrocytes) from psoriasis patients or healthy humans were injected into NOG mice through the tail vein separately for 5 days, while mice in the blank control group and imiquimod group were injected with the same volume of PBS buffer. The hair of all groups of mice was removed from a 3 cm*2 cm rectangle of skin above the root of the rat tail. Subsequently, all groups were smeared with 50 mg of imiquimod for 5 days except for the normal control group. The skin condition was observed, and photos were taken daily. At the end of the experiments, mice were sacrificed, and hairless skin was taken for further study. The skin was divided into two parts. One part of the skin was blocked in paraffin for hematoxylin-eosin (HE) staining to observe pathological features, and the other part was used to detect related factors (IL-6, IL-17, IL-22, IL-23, and VEGF) by Elisa kits (Rabiotech Co Ltd, South Korea).

Mouse model of psoriasis induced by imiquimod and propranolol

In this stage, 48 Balb/c mice were randomly divided into three groups: blank control group, imiquimod group, and propranolol group. The hair of all groups of mice was removed from a 3 cm*2 cm rectangle of skin above the root of the rat tail. Mice in the imiquimod group or propranolol group were smeared with 50 mg of imiquimod or 50 µL of 5% propranolol microemulsion for 7 days separately. The skin condition was observed, and photos were taken daily. At the end of the experiments, mice were sacrificed, and blood and spleen were taken for western blot analysis.

Mouse model of psoriasis induced by splenectomy and propranolol

Forty Kunming mice were randomly divided into five groups: blank control group, propranolol group, Sham Operation (SO) group, Splenectomy model (SM), and Splenectomy + Propranolol (SP) group. The SP and SM groups underwent partial splenectomy. In the SO group, the abdominal cavity was opened, but the spleen was not resected. The SP, SO, and Control groups were then smeared with 50 uL of 5% propranolol microemulsion for 4 days. The skin condition was observed, and photos were taken daily. At the end of the experiments, mice were sacrificed, and blood and hairless skin were taken for further study. The skin was divided into three parts. One part of the skin was blocked in paraffin for hematoxylin-eosin (HE) staining to observe pathological features, and the other two parts were used to detect related factors (IL-6, IL-22, IL-23, VEGF, and HIF) by qPCR and Elisa kits (Rabiotech Co Ltd, South Korea). The spleen was weighed, and the spleen index was calculated. Then, the spleen's microstructure was detected by transmission electron microscope (JEM-1200EX, JEOL, Japan). Serum was separated from the blood, and serum SOD, MDA, and NO levels were determined.

Quantitative real-time PCR (q RT-PCR)

Skin tissues were homogenized by Trizol reagent to obtain total RNA according to the manufacturer's instructions. The cDNA was prepared from 1 µg total RNA using oligo-primers, the First-Strand Synthesis Kit (Invitrogen). Power SYRB® Green PCR Master Mix qPCR kit was used for real-time qPCR reaction on an ABI Prism TM 7500 Real-Time qPCR System (ABI, US). The mRNA expression relative to actin mRNA levels was calculated using the delta-delta threshold cycle (2-∆∆CT) method. Primers that were used are as follows: IL-6, F 5'- GCTGGAGTCACAGAAGGAGTGGC − 3', R 5'-GGTCACTCCAGCAGGCTTAG-3'; IL-22, F 5'- TGACGACCAGAACATCCAGA − 3', R 5'- CGCCTTGATCTCTCCACTCT − 3'; IL-23, F 5' - CACCTCCCTACTAGGACTCAGC-3', R 5'- TGGGCATCTGTTGGGTCT − 3'; VEGF, F 5'- CTGTGCAGGCTGCTGTAACG − 3', R 5'- GCTCATTCTCTCTCTATGTGCTGGC-3'; HIF, F 5'- GACAATAGCTTCGCAGAATGC − 3', R 5'- TCGTAACTGGTCAGCTGTGG − 3'; GAPDH, F 5'-TGGCAAAGTGGAGATTGTTGCC-3', R 5'- AAGATGGTGATGGGCTTCCC G-3'.

Enzyme-linked immunosorbent assay (ELISA)

In this stage, 20 mg of skin tissues were homogenized by 500 µL cell lysis buffer. The levels of inflammatory cytokines of IL-6, IL-17, IL-22, IL-23, VECF, and HIF in skin tissue of different groups of mice were evaluated using respective ELISA kits (Rabiotech Co. Ltd., South Korea) as the manufacturer's instructions.

Western blot assay

Blood and spleen were lysed or homogenized five times with RIPA lysis buffer and then centrifuged at 10,000 rpm for 15 min. The supernatants were collected as samples. Total proteins were determined by a bicinchoninic acid protein assay kit (BCA, Invitrogen, United States). Furthermore, 90 µg of samples were subjected to 8% SDS-polyacrylamide gel electrophoresis. Proteins were transferred to PVDF membranes, followed by blocking with Tris-buffered saline containing 0.1% Tween 20 (TBST) and 5% (w/v) BSA for 1h. The membranes were incubated with primary antibodies of rabbit against CD11b (GR3263081-4, Abcam), SPIC (335E8A26, Thermo Scientific), SIRPα (GR178545-1, Abcam), TSP-1 (ab263905, Abcam) and CD47 (GR3372602-1, Abcam; 1: 1,000 dilution) overnight at 4ºC. The membranes were washed thrice in TBST and incubated with a secondary antibody (BT1D11A, Abcam) for 1 h. Protein bands were visualized by a chemiluminescence kit (Millipore Corp, Billerica, MA, USA).

Statistical analysis

Statistical analyses were performed using the Prism (GraphPad) software version 6 and SPSS software version 17.0. A Student’s t-test was used for pair-wise comparisons, while a one-way ANOVA test was used for multiple comparisons. P < 0.05 or P < 0.01 was considered statistically significant.

Aged and deformed erythrocytes increase in psoriatic patients

The values of erythrocyte rigidity index, whole blood viscosity (middle shear rate), whole blood viscosity (high shear rate), cholesterol, and triglyceride in psoriatic patients were higher than the upper limit of normal reference values (Table 1, Table S1).

Table 1

Blood rheological change and biochemical change of venous blood in psoriasis patients (n = 65, x̄ ± s)
Detection index	Index value	Normal range
Whole blood viscosity (low share rate)	9.39 ± 1.04	6.80–9.58
Whole blood viscosity (middle share rate)	5.59 ± 0.49↑	4.51–5.57
Whole blood viscosity (high shear rate)	4.66 ± 0.44↑	3.73–4.60
Erythrocyte deformability index	0.88 ± 0.05	0.66–0.96
Erythrocyte rigidity index	5.89 ± 0.59↑	3.71–5.61
Erythrocyte aggregation index	2.01 ± 0.11	1.95–2.99
Cholesterol	5.30 ± 0.93↑	3.38–5.20
Triglycerides	2.05 ± 1.44↑	0.55–1.70
High density lipoprotein cholesterol	1.23 ± 0.34	＞1.15
Red blood cell count	5.25 ± 0.49	4.30–5.80*10¹²
Hemoglobin determination	155.00 ± 11.54	130–175
Mean corpuscular volumn	88.68 ± 7.43	82.0-100.0
C-reactive protein	3.42 ± 5.07	0.00–6.00
Note: The normal range is the reference value of Guangdong provincial hospital of Chinese medicine and the normal range is the index range of 95% of the healthy people.

Compared with healthy volunteers, we observed that there were red blood cells changed into poikilocytes showing acanthocyte, drop shape, and irregular shape under the microscope (Fig. 1A). In addition, the poikilocyte rate under the microscopic and poikilocyte rate of psoriatic patients was significantly increased (Figs. 1B, C). Then red blood cells were separated by discontinuous percoll density gradient centrifugation to detect changes in erythrocyte density in psoriasis patients. The percoll was confected into five different density layers in the glass tubes, and the density layers were 1.0910 g/mL, 1.0985 g/mL, 1.1060 g/mL, 1.1135 g/mL, and 1.1210 g/mL from the top to bottom (Fig. 1D). Red blood cells in psoriatic patients were distributed in high density with a high degree of aging; those in the healthy volunteers were distributed in the low-density level with a low degree of aging (Fig. 1E). Changes in the cytoskeleton of erythrocytes are a symptom of aging, and erythrocytes become smaller and denser at this stage [27], so the above results suggested that aged and deformed erythrocytes increased in psoriatic patients.

Erythrocytes of psoriatic patients induce psoriasis in mice

NOG mice injected with erythrocytes and leukocytes of psoriasis patients revealed more serious layered scales, erythema skin wrinkles, and inflammatory infiltration when compared with NOG mice injected with the erythrocytes and leukocytes of healthy volunteers, but the serum of psoriasis patients had little effect on skin lesions (Figs. 2A, B). Above result was further confirmed by the Psoriasis Area and Severity Index (PASI) scores for the skin lesions and Baker scores for the histopathology change of the skin. Both scores in IMQ + patient leukocytes group and IMQ + patient erythrocyte group were significant higher than those in healthy volunteer’s groups, but the difference was not obvious between IMQ + patient plasma group and IMQ + healthy volunteer erythrocyte group (P < 0.01, Figs. 2C, D), indicated that elevated inflammatory factors in plasma has marginal effect on the psoriasis development.

As shown in Figs. 3A-E, compared with the IMQ + healthy volunteer’s leukocyte group and IMQ + healthy volunteer erythrocyte group, IL-6, IL-17, and VEGF protein levels in the IMQ + patient leukocyte group and IMQ + patient erythrocyte group were significantly increased, while the protein level of IL-22 was remarkably increased only in the IMQ + patient erythrocyte group (P＜0.05, P＜0.01). However, there was no obvious difference of all inflammatory factors and VEGF between the IMQ + patient plasma group and the IMQ + healthy volunteer plasma group, so did the IMQ group and IMQ + different blood parts of healthy volunteers groups. Above results were consistent with the changes of skin lesions, and showed that leukocyte and erythrocyte in psoriasis patients could aggravate psoriasis in mice, further indicating that abnormal erythrocytes were closely related to the onset of psoriasis.

Spleen filtration function is abnormal in psoriatic mice

Imiquimod and propranolol are precipitating factors, and usually used to prepare psoriasis model, therefore we observed the change after these two drugs treatment. The mice in the blank control group had smooth skin with normal color; mice in the imiquimod and propranolol group revealed hard skin with patches, erythema skin wrinkles, and inflammatory infiltration (Fig. 4A). The above results indicated that the psoriasis model was successfully constructed. Compared with normal control group, the PASI scores in the imiquimod and propranolol group were significantly increased, and the score in imiquimod group was higher than that in propranolol group (Fig. 4B). We also observed the morphology of erythrocytes in psoriatic mice. As such, compared with the blank control group, abnormal erythrocytes such as spines, water drops, and irregularity could be observed (Fig. 4C). In addition, the poikilocyte rate under the microscopic was significantly increased (P < 0.01), and the rate in imiquimod group was also higher than that in propranolol group (Fig. 4D). Then, we observed the pathological section of the spleen. The results showed that the structure of red and white pulp of the spleen in normal mice was clear, the trabecula of the spleen was not thickened, the shape of the splenic corpuscle was normal, and the germinal center was clear. In the model group, the structure of the red and white pulp of the spleen was also clear, but the white pulp and red pulp both increased significantly (Figs. 4E, F), and the change in imiquimod group was more obvious than that in propranolol group. The above results showed that psoriasis cause the increased aging and abnormal erythrocytes and then splenic filtration dysfunction.

Spleen filtration deficiency contributes to the pathogenesis of psoriasis

Next, we explored that whether spleen filtration deficiency, in turn, induced psoriasis. The results showed mice in the blank control group, SO group, and SM group had smooth skin with normal color; mice in the propranolol group had rough skin with slightly reddish; and the skin of mice in the SP group revealed hard skin with patches, erythema skin wrinkles, and inflammatory infiltration (Fig. 5A). The pathological study showed that the SP group exhibited several features, including thickened spinous layer, decreased granular layer cells, and inflammatory cell infiltration (Fig. 5B). The inflammatory factors showed that the gene and protein expressions of IL-6 were significantly higher in the skin of SP than in other groups. However, there were no significant differences among the skin of the blank control group, propranolol group, SO group, and SM group (P < 0.01, Figs. 5C, D). For IL-22, its gene expression in the skin of the SP group was only significantly higher than in the blank group (P < 0.01, Fig. 5E). In contrast, its protein expression in the skin of the SP group significantly increased when compared with the blank, SO, and SM groups (P < 0.01, Fig. 5F). The gene and protein expression of IL-23 in the propranolol and SP group was significantly higher than in the blank group. Furthermore, its protein expression in both groups was significantly higher than in the SM group (P < 0.05, P < 0.01, Figs. 5G, H). We also carried out the effect of splenectomy on imiquimod induced psoriasis, and the results of skin lesions were consistent with those on propranolol induced psoriasis (Fig. S2). Those results confirmed that spleen filtration deficiency could induce psoriasis.

Both gene and protein expressions of HIF and VEGF were significantly higher in the skin of SP than in other groups. However, there were no significant differences among the skin of the blank control group, propranolol group, SO group, and SM group (P < 0.01, Figs. 6A, B, and S1). The results for the indicators of oxidative metabolism showed that the serum MDA levels in the propranolol group, SO group, SM group, and SP group were significantly increased when compared with the blank group (P < 0.01), and the serum MDA in SP was significantly higher than in the propranolol group, SO group, and SM group (P < 0.05, P < 0.01; Fig. 6C). Besides, the serum MDA in the SM group was significantly higher than in the propranolol group (P < 0.05; Fig. 6C). In addition, the level of serum NO in the SP group was significantly higher than in the blank group, propranolol group, SO group, and SM group (P < 0.01; Fig. 6D). The above data indicated that the splenectomy + propranolol induced psoriasis model was established and easier to be successfully induced than the traditional model induced by propranolol only, demonstrated that spleen filtration deficiency contributed to the development of psoriasis.

Decrease in macrophage phagocytosis is the cause of the splenic filtration deficiency in psoriatic mice

CD11b is a macrophage marker, and SPIC is highly expressed in red pulp macrophages. Compared with the normal control group, the protein expression of CD11b and SPIC was significantly increased in the spleen of the imiquimod group and propranolol group (P < 0.05, P < 0.01; Figs. 7A–C), which indicated that macrophages, especially red pulp macrophages, increased in the spleen of psoriatic mice. The SIRPα/CD47 pathway plays an important role in macrophage phagocytosis. CD47 is recognized after binding of thrombospondin-1 (TSP-1) as an “eat me” signal by SIRPα [28, 29]. Compared with the normal control group, the protein expressions of SIRPα and TSP-1 in the spleen of the imiquimod group and propranolol group were significantly decreased (P < 0.05, P < 0.01; Figs. 7A, D, E). The protein expression of CD47 in red cells of the imiquimod group and propranolol group was decreased slightly but not significantly when compared with the normal control group (P>0.05; Figs. 7A, F). The results indicated that the function of macrophages to recognize the “eat me” signal of aging and deformed erythrocytes is weakened so that they could not be effectively engulfed.

This study explored the relationship between splenic filtration dysfunction, blood state and psoriasis for the first time. We found that the ability of spleen red pulp macrophages to recognize aging and deformed erythrocytes decreased in the psoriatic body, resulting in the dysfunction of spleen filtration and the increase of aging and deformed erythrocytes in the body. Furthermore, due to the hypoxia environment caused by decreased oxygen-carrying capacity and the decline of their antioxidant capacity of aging and deformed erythrocytes, the indicators of HIF, VEGF, MDA and NO increased, thus making psoriasis more likely to be induced. Finally, the long-term existence of aged and damaged red blood cells in blood circulation would cause the accumulation of toxins. When the toxin accumulates to a certain level, psoriasis recurs (Fig. 8).

Our clinical data showed that the blood lipids and blood viscosity were increased in psoriatic patients. Blood viscosity and blood lipid are vital indicators for detecting blood states, and blood lipid is closely related to blood viscosity [29–31]. Furthermore, the erythrocyte rigidity index increased in psoriasis patients, indicating that the erythrocyte deformability decreased, and the shape of erythrocytes may change due to external force or osmotic pressure change. The increased heteromorphic erythrocytes confirmed this speculation in the blood of psoriatic patients. Erythrocyte deformability is closely related to the structure of the membrane and aging degree [27, 32]. Changes in the cytoskeleton of erythrocytes are a symptom of aging, and erythrocytes become smaller and denser at this stage [23, 25]. This study found that the high density of erythrocytes in psoriatic patients increased significantly compared with healthy volunteers, as well as the aged erythrocytes increased. Although, at present, the main treatment of psoriasis is topical drugs to treat superficial symptoms, as well as the use of immunosuppressants to treat abnormally activated immune systems, the symptoms of abnormal blood state are often ignored. Psoriasis is often difficult to cure and recurs repeatedly. This leads to the following question: could this failure be related to the neglected abnormal blood state? We investigated the effect of plasma, erythrocytes, and leukocytes of psoriasis patients on psoriasis in mice to explore the problems. The results showed that erythrocytes and leukocytes could promote the occurrence of psoriasis in mice. At present, leukocyte abnormality has been proved to be one of the causes of psoriasis. However, there are few reports about the connection between abnormal red blood cells and psoriasis. Therefore, our results first confirmed that abnormal erythrocytes could promote psoriasis.

Under normal conditions, aging and deformed erythrocytes can be removed by the spleen which has blood filtration function. The increase of the abnormal erythrocytes in circulation manifests in splenic filtration deficiency [21–23]. We observed white and red pulp enlargement in the spleen of psoriatic mice. The spleen is a systemic immune organ mediated by the general circulation vascular system, so spleen is tightly bound to blood and immunity. Blood and immunity are also closely related to psoriasis. The white pulp is composed of dense lymphocytes, the main place for specific immunity [24, 33]. The red pulp is mainly composed of splenic blood sinus and splenic cord. The blood flow in the red pulp is slow, promoting the full contact between the blood and phagocytes, thus ensuring the filtration function [24, 33]. Our results found that psoriasis caused abnormal spleen immune function and filtration function. At present, the abnormally activated immune system is the main direction of the pathogenesis of psoriasis. Therefore, although previous studies observed the changes in the spleen, they only focused on its immune function and ignored the changes in its filtration function.

Based on the above results and the results that abnormal erythrocytes could cause psoriasis, we further explored the relationship between splenic filtration function and psoriasis in a psoriatic mice model induced by partial splenectomy. We found that psoriasis induced by partial splenectomy and propranolol presented more typical psoriasis-like appearances, pathologic features, and immunological features than that induced only by propranolol. Therefore, we discovered that the deficiency of spleen filtration function might lead to psoriasis.

The deficiency of spleen filtration function leads to increased aging and deformed erythrocytes, and oxygen-carrying capacity of aging and deformed erythrocytes, which form the hypoxia environment. Our results showed that HIF was activated in the SP model, and HIF activation promotes VEGF expression. HIF can well reflect the hypoxia of the body. It regulates the transcription of VEGF by interacting with the VEGF5'-end enhancer [34, 35]. VEGF plays a decisive role in the abnormal blood vessels in psoriasis skin lesions, which aggravate the inflammatory response in the psoriasis skin lesions and promote the pathological process of psoriasis [36]. Besides, the cell membranes of aging and deformed red blood cells are damaged, leading to the decline of their antioxidant capacity. Malondialdehyde (MDA) and nitric oxide (NO) are indicators of oxidative metabolism. MDA is the end product of lipid oxidation, and its content increases in the serum of psoriasis patients [37–39]. NO can be highly expressed in keratinocytes and endothelial cells under the stimulation of immune factors. It promotes local angiogenesis, inflammatory response, Th1 cell proliferation, and synthesis of some cytokines in skin lesions [40]. Our results showed that MDA and NO content activity increased significantly in the SP group compared with the blank and propranolol group, which might break the balance of oxidation and peroxidation in the skin and then increase the risk of psoriasis or aggravate it.

Our study found that psoriasis caused splenic filtration dysfunction, resulting in aging and abnormal erythrocyte increase, which in turn induced psoriasis. This circulation process may be one of the reasons why psoriasis is easy to relapse. If so, what could be the internal mechanism? Aging and deformed erythrocytes can hardly be observed in the blood of the normal body because they would be engulfed and digested by macrophages in the red pulp of the spleen based on its filtration function. The filtration function of the spleen mainly depends on the phagocytosis of macrophages. We found that the expression of macrophages, especially red pulp macrophages, increased significantly. The SIRPα/CD47 pathway plays an important role in macrophage phagocytosis. As an important regulator of macrophage phagocytosis, CD47 exists widely in vivo and is highly expressed in hematopoietic cells [41]. SIRPα, which is highly expressed in macrophages, promotes immune recognition and phagocytosis of tumor cells or pathogens [42]. CD47 expression by erythrocytes is a molecular switch for controlling erythrocyte phagocytosis. Its expression on the surface of normal erythrocytes is considered a “do not eat me” signal through binding to SIRPα on the macrophage [28]. However, on the surface of aging and deformed erythrocytes, CD47 is recognized after binding of thrombospondin-1 as an “eat me” signal by SIRPα because of this conformational change [28, 29]. Our results showed that the expression of SIRPα and TSP-1 decreased in the spleen. However, the expressions of CD47 did not change obviously in psoriatic mice, indicating that the function of macrophages to recognize the “eat me” signal of aging and deformed erythrocytes is weakened so that they could not be effectively engulfed. Therefore, the number of aging and deformed erythrocytes increased in the blood. Although psoriasis caused the increase in macrophages in the red pulp of the spleen, its phagocytic function was compromised, resulting in the dysfunction of spleen filtration.

This study found a close relationship between splenic filtration dysfunction, abnormal erythrocytes, and psoriasis. However, we are not sure which occurs first because the psoriasis patients included in our study had a long disease course, and our findings may not be applicable to the early stages of the disease. Because psoriasis is difficult to heal and easy to relapse, some patients on long-term tend to seek the help of traditional Chinese medicine. According to traditional Chinese medicine, psoriasis is mainly divided into three types of syndromes (blood heat, blood stasis and blood dryness), so psoriasis is mainly treated from the blood [43]. And herbs with the effect of dispersing blood stasis or cooling blood such as Curcuma Aeruginosa Roxb, Radix Paeoniae Rubra, Radix Angelicae Sinensis, Indigo Naturalis, Rubix Rubiae etc are frequently appeared at the prescriptions as the main herb when treating psoriasis [44–46]. PSORI is a cipher prescription our hospital used to treat psoriasis for many years [44, 48], it contained two kinds of drugs, one is herbs with dispersing blood stasis effect and the other is with the effect of clearing heat-toxin, when compared their effect on psoriasis in mice model, the results showed that dispersing blood stasis drugs showed a better effect [49], and this is accorded with the theory of traditional Chinese Medince and the results of manuscript. Our results provide experimental evidence for the theory of treating psoriasis from blood.

CONSENT FOR PUBLICATION

Not application.

DATA AVAILABILITY and MATERIAL

The original contributions presented in the study are included in the article/supplementary material. Further inquiries can be directed to the corresponding author.

COMPETING INTERESTS

The authors declare that they have no competing interests.

AUTHOR CONTRIBUTIONS

Ya Zhao, Dancai Fan and Yayun Wu performed experiments. Dancai Fan, Ya Zhao and Lijuan Liu performed animal modeling experiments, qRT-PCR, and ELISA assay. Yayun Wu performed animal modeling experiments and Western blot assay. Hao Deng and Danni Yao were responsible for collecting blood samples of healthy volunteers and psoriasis patients. Shigui Deng supervised the animal modeling experiments. Ruizhi Zhao and Ya Zhao wrote the manuscript. Ruizhi Zhao conceived the study design details. Chuanjian Lu was responsible for overall project management.

FUNDING

This work was generously supported by the Project of State Key Laboratory of Dampaness Syndrome of Chinese Medicine (No. SZ2021ZZ51), Project of Guangdong Provincial Key Laboratory of Clinical Research on Traditional Chinese Medicine Syndrome (No. ZH2019ZZ05), and Science and Technology Planning Project of Guangdong Province (No. 2017B030314166).

Acknowledgments

We thank LetPub (www.letpub.com) for its linguistic assistance during the preparation of this manuscript.

Conflict of Interest:

The authors declare that the research was conducted without any commercial or financial relationships that could be construed as a potential conflict of interest.

Publisher’s Note:

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations or those of the publisher, the editors, and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.

Parisi R, Iskander IYK, Kontopanelis E, Augustin M, Griffiths CEM, Ashcroft DM. Global Psoriasis Atlas. National, regional and worldwide epideiology of psoriasis: systemmatic analysis and modelling study. BMJ. 2020,369: m1590
Bagel J, Schwartzman S. Enthesitis and Dactylitis in Psoriatic Disease: A Guide for Dermatologists. Am J Clin Dermatol. 2018; 19(6):839–52.
AIQassimi S, AIBrashdi S, Galadari H, Hashim MT. Global burden of psoriasis- comparison of regional and global epidemiology, 1990 to 2017. Int J Dermatol. 2020; 59(5): 566–571
Li AH, Qi MM, Li WW, Yu XQ, Yang LL, Wang J, Li D. Predition and verification of the effect of psoriasis on coronary heart disease based on artifical neatral network. Heliyon 2022, 8(9): e10677
Blauvelt A, Chiricozzi A. The Immunologic Role of Il-17 in Psoriasis and Psoriatic Arthritis Pathogenesis. Clin Rev Allergy Immu. 2018; 55(3):379–90.
Silfvast-kaiser A, Paek SY, Menter A. Anti-IL17 therapies for psoriasis. Expert Opin Biol Ther. 2019, 19(1): 45–54
Nussbaum L, Chen YL, Ogg GS. Role of regulatory T cells in psoriasis pathogenesis and treatment. Br J Dermatol 2021, 184(1): 14–24
Kim J, Krueger JG. The immunopathogenesis of psoriasis. Dermatol Clin 2015, 33(1): 13–23
Laws P, Pemberton P, Griffiths C, Young H. E-Selectin: A Biomarker of Cardiovascular Disease Risk with Potential Utility in Patients with Psoriasis. J Invest Dermatol. 2011; 131:S43-S.
Rademaker M, Agnew K, Anagnostou N, Andrews M, Armour K, Baker C, et al. Psoriasis and Infection. A Clinical Practice Narrative. Australas J Dermatol. 2019; 60(2):91–98.
Rousset L, Halioua B. Stress and Psoriasis. Int J Dermatol. 2018; 57(10):1165–72.
Singh S, Pradhan D, Puri P, Ramesh V, Aggarwal S, Nayek A, Jain AK. Genomic Alterations Driving Psoriasis Pathogenesis. Gene. 2019; 683:61–71.
Zheng Y, Danilenko DM, Valdez P, Kasman I, Eastham-Anderson J, Wu J, Ouyang W. Interleukin-22, a T(H)17 Cytokine, Mediates Il-23-Induced Dermal Inflammation and Acanthosis. Nature. 2007; 445(7128):648–51.
Boehncke W-H, Boehncke S. Cardiovascular mortality andmortality in psoriasis and psoriatic arthritis: epidemiology, pathomechanisms, therapeutic implications, and perspectives. Curr Rheumatol Rep. 2012; 14(4):343–8.
Sudhesan A, Rajappa M, Chandrashekar L, Ananthanarayanan PH, Thappa DM, Satheesh S, et al. Vascular Endothelial Growth Factor (Vegf) Gene Polymorphisms (Rs699947, Rs833061, and Rs2010963) and Psoriatic Risk in South Indian Tamils. Hum Immunol. 2017; 78(10):657–63.
Zablotna M, Sobjanek M, Nedoszytko B, Lange M, Kozicka D, Glen J, Roszkiewicz. Association of Psoriasis with the Vegf Gene Polymorphism in the Northern Polish Population. J Eur Acad Dermatol Venereol. 2013; 27(3):319–23.
Luengas-Martinez A, Paus R, Young HS. A novel personzlized treatment approach for psoriasis. Br J. Dermatol. 2022.186(5): 782–91
Boehncke W-H, Boehncke S. Research in Practice: The Systemic Aspects of Psoriasis. J DTSCH Dermatol Ges. 2008; 6(8):622–5.
Traki A, Wolf P, Eichmann TO, Scharnagl H, Stadler JT, Salmhofer W, Knuplez E, Holzer M, Marsche G. Biological anti-psoriatic therapy profoundly affects high-density lipoprotein function. Biochin Biophyl Acta Mol Cell Biol Lipids. 2021,1866(7): 158943
Noble BT, Brennan FH, Popovich PG. The Spleen as a Neuroimmune Interface after Spinal Cord Injury. J Neuroimmunol. 2018; 321:1–11.
Dondorp AM, Chotiuanish KT, Fucharoen S, Silamut K, Vreeken J, Kager PA, White NJ. Red cell deformability, splenic function and anaemia in thalassaemia. Br J Haematol. 1999, 105(2):505–8
Miko I, Nemeth N, Sajtos E, Brath E, Peto K, Furka A, et al. Splenic Function and Red Blood Cell Deformability: The Beneficial Effects of Spleen Autotransplantation in Animal Experiments. Clin Hemorheol Micro. 2010; 45(2–4):281–8.
Pivkin IV, Peng Z, Karniadakis GE, Buffet PA, Dao M, Suresh S. Biomechanics of red blood cells in human spleen and consequences for physiology and disease. Proc Natl Acad Sci USA 2016,113(28):7804–9
Mebius, Re, Kraal. Structure and Function of the Spleen. Nat Rev Immunol. 2005; 5(8):606–16.
Li H, Lu L, Li X, Buffet PA, Dao M, Karniadakis GE, Suresh S. Mechanics of diseased red blood cells in human spleen and consequences for hereditary blood disorders. Proc Natl Sci USA. 2018,115(38): 9574–79
Lin JN, Lin CL, Lin MC, Lai CH, Lin HH, Yang CH, et al. Increased Risk of Hemorrhagic and Ischemic Strokes in Patients with Splenic Injury and Splenectomy: A Nationwide Cohort Study. Medicine (Baltimore). 2015;94(35):e1458.
Goris AP, Zarubina EG, Moskvin SV. Dependence of Erythrocyte Deformability on the Human Age. Lazernaya meditsina 2013; 17(2):24–6.
Burger P, Hilarius-Stokman P, de Korte D, van den Berg TK, van Bruggen R. Cd47 Functions as a Molecular Switch for Erythrocyte Phagocytosis. Blood. 2012; 119(23):5512–21.
Vaya A, Gimenez C, Alis R, Murado J, Fuster O. Influence of Lipids on Blood and Plasma Viscosity. Clin Hemorheol Micro. 2014; 58(4):551–3.
Chen R, Chen M, Xiao Y, Liang Q, Cai Y, Chen L, et al. Bioinformatics Analysis of Micrornas Related to Blood Stasis Syndrome in Diabetes Mellitus Patients. Bioscience Rep. 2018; 38.
Liao Y, Liang F, Liu H, Zheng Y, Li P, Peng W, et al. Safflower Yellow Extract Inhibits Thrombus Formation in Mouse Brain Arteriole and Exerts Protective Effects against Hemorheology Disorders in a Rat Model of Blood Stasis Syndrome. Biotechnol Biotec Eq. 2018; 32(2):487–97.
Jayavanth S, Singh M. Changes in Erythrocyte Aggregation and Deformability During Human Ageing. Curr Sci India. 2002; 82(2):191–6.
Cesta MF. Normal Structure, Function, and Histology of the Spleen. Toxicol Pathol. 2006; 34(5):455–65.
Arrais-Silva WW, Paffaro VA, Yamada AT, Giorgio S. Expression of Hypoxia-Inducible Factor-1 Alpha in the Cutaneous Lesions of Balb/C Mice Infected with Leishmania Amazonensis. Exp Mol Pathol. 2005; 78(1):49–54.
Ahluwalia A, Tarnawski AS. Critical Role of Hypoxia Sensor - Hif-1 Alpha in Vegf Gene Activation. Implications for Angiogenesis and Tissue Injury Healing. Curr Med Chem. 2012; 19(1): 90–7.
Li W, Man X-Y, Chen J-Q, Zhou J, Cai S-Q, Zheng M. Targeting Vegf/Vegfr in the Treatment of Psoriasis. Discov Med. 2014; 18(98):97–104.
Asha K, Singal A, Sharma SB, Arora VK, Aggarwal A. Dyslipidaemia & Oxidative Stress in Patients of Psoriasis: Emerging Cardiovascular Risk Factors. Indian J Med Res. 2017; 146:708–13.
Tanhapour M, Falahi B, Vaisi-Raygani A, Bahrehmand F, Kiani A, Rahimi Z, Vaisi-Rayaani AA, Shakiba E, Pourmotabbed T. Angiotensin-Converting Enzyme Insertion/Deletion (Rs106180) and Angiotensin Type 1 Receptor A1166 C (Rs106165) Genotypes and Psoriasis: Correlation with Cellular Immunity, Lipid Profile, and Oxidative Stress Markers. J Cell Biochem. 2018; doi: 10.1002/jcb.27569.
Elghareeb MI, Khater MH, Fakhr A, Khedr HA. Rsik and severity of psoriasis vulgaris in relation to angiotesin II type I receptor gene polymorphism and metabolic syndrome. Clin Cosmet Invest Dermatol. 2019;12: 683–690
Brotzman EA, Sandoual LF, Crane J. Use of nitrous oxide in dermatory: a systemic review. Dermatol Surg. 2018; 44(5): 661–9
Barclay AN, van den Berg TK. The Interaction between Signal Regulatory Protein Alpha (Sirp Alpha) and Cd47: Structure, Function, and Therapeutic Target. In: Littman DR, Yokoyama WM, editors. Annual Review of Immunology. 2014; (32):25–50.
Murata Y, Kotani T, Ohnishi H, Matozaki T. The Cd47-Sirp Alpha Signalling System: Its Physiological Roles and Therapeutic Application. J Biochem. 2014; 155(6):335–44.
Li TH, Qu X. Study on the Rule of Distribution of Tcm Syndromes of Psoriasis.JTCM. 2010; 51(6):544–6.
Parker S, Zhang AL, Zhang CS, Goodman G, Wen Z, Yan Y, Yao D, Wu H, Deng H, Lu C, Xue CC. Add-on effect of PSORI-CM 01 to topical calcipotriol for moderate psoriasis vulgaris: a multi-center, randomized, double-blind pilot study. Clin Transl Med 2021, 11(1): e286
Lin L, Yang S, Bai Q, An Y. TCM treatment and drug co-occurrence analysis of psoriasis. Comput Intell Neurosci. 2022; 2022: 4268681
Souza GA, Alvares Goulart R, Sousa Gonzaga ML. Dermatological effects of curcuma species: a systematic review. Clin Exp Dermatol. 2021; http://doi.rg/10.1111/ced.14584
Damevska K, França K, Lotti T, Nikolovska S, Pollozhani N. Complementary and Integrative Therapies for Psoriasis: Looking Forward. Dermatol Ther.2018;e12627.
Lu Y, Yang Y, Zhang J, Zhang H, Ma C, Tang X, Wu J, Li L, Wei J, Chen H, Lu C, Han L. Anti-angiogenic efficacy of PSORI-CM02 and the associated mechanism in psoriasis in vitro and in vivo. Frant Immunol 2021, 12: 649591
Liu L, Zhao R, Lu C. Discussion on the synergy rule of PSORI-CM02 in treating psoriasis based on pharmacodynamic-component analysis. CJTCMP 2020, 35(8): 4171–74

Supplementary Materials are not available with this version.

Download PDF

Version 1

posted

You are reading this latest preprint version

Increased abnormal erythrocytes caused by spleen filtration deficiency provide a hypoxic environment for the occurrence of psoriasis

Status:

Version 1

Abstract

Background

Methods

Results

Conclusion

Figures

Introduction

Materials And Methods

Mice and human subjects

Blood state evaluation

Separation of different human blood components

Establishment and evaluation of an animal model of psoriasis

Mouse model of psoriasis induced by different human blood components

Mouse model of psoriasis induced by imiquimod and propranolol

Mouse model of psoriasis induced by splenectomy and propranolol

Quantitative real-time PCR (q RT-PCR)

Enzyme-linked immunosorbent assay (ELISA)

Western blot assay

Statistical analysis

Results

Aged and deformed erythrocytes increase in psoriatic patients

Erythrocytes of psoriatic patients induce psoriasis in mice

Spleen filtration function is abnormal in psoriatic mice

Spleen filtration deficiency contributes to the pathogenesis of psoriasis

Decrease in macrophage phagocytosis is the cause of the splenic filtration deficiency in psoriatic mice

Discussion

Declarations

References

Supplementary Materials

Status:

Version 1