Tissue samples
Thirty-six human PCA samples and twenty benign prostatic hyperplasia tissues were obtained from urology of Affiliated Hospital of Nantong University. The samples were frozen quickly in liquid nitrogen and stored at −80 °C. The study was in accordance with the International Ethical Guidelines for Biomedical Research Involving Human Subjects. The protocol was approved by the Ethics Committee of the Affiliated Hospital of Nantong University. All subjects obtained informed consent to participate in this study.
Cell culture
Two PCA cell lines (PC3 and DU145) and a normal human prostate epithelial cells RWPE-1 were purchased from National Collection of Authenticated Cell Cultures (Shanghai, China). All cells were cultured in Roswell Park Memorial Institute (RPMI) 1640 (Gibco, Carlsbad, CA, USA) containing 10% fetal bovine serum (FBS, Gibco) and maintained with a humidified atmosphere containing 5% CO2 at 37 °C. The paclitaxel-resistant (PR) PCA cell lines (PC3-PR and DU145-PR) were established according to the previous report [27]. Then PC3-PR and DU145-PR cells were cultured in normal medium with 10 nM paclitaxel (Selleck, Houston, TX, USA).
Drug treatments
For drug treatments in vitro experiments, the cultured cells were treated with paclitaxel at 50, 100, 200, 500 and 1000 μM for one days. After the drug treatments, the cells were used in specific experiments.
Quantitative Real-time PCR (qRT-PCR)
Total RNA was extracted using Trizol reagent (Invitrogen, Carlsbad, CA) according to manufacturer’s protocol. Then 1 μg of total RNA was reversely transcribed to cDNA using First Strand cDNA Synthesis Kit (Applied Biosystems, Foster City, USA). The whole quantitative amplifications were on Step OnePlus Real-Time PCR Systems (Applied Biosystems, Foster City, USA). GAPDH or U6 was used as an endogenous control. Relative quantification was calculated using the 2–ΔΔCt Method. The primer sequences used in this study were as follows: GAS5, forward: 5’-CTTGCCTGGACCAGCTTAAT-3’, and reverse: 5’-CAAGCCGACTCTCCATACCT-3’; miR-18a-5p forward, 5'‑TAAGGTGCATCTAGTGCA‑3', and reverse: 5'‑CAGTGC
GTGTCGTGGAGT‑3'; GAPDH, forward: 5’-GGTGGTCTCCTCTGACTTCAA-3’, and reverse: 5’-GTTGCTGTAGCCAAATTCGTTGT-3’; U6, forward, 5'‑CGCTTCGGCAGCACATATAC‑3', and reverse, 5'‑AACGCTTCACGAATTTGCGT‑3'.
Construction of recombinant vector and transfection
Cell transfection was performed using Lipofectamine 3000 Transfection Reagent (Invitrogen) according to manufacturer’s instructions. pCDNA3.1-GAS5 and pCDNA3.1-STK4 overexpression plasmids were constructed and synthesized by Genscript Co., Ltd. (Nanjing, China). The hsa-miR-18a-5p mimic and inhibitor were designed and synthesized by Ribo Co., Ltd. (Guangdong, China), miR-CON was designed as a negative control. The luciferase reporter vectors were constructed by Ribo Co., Ltd. (Guangdong, China). In brief, GAS5 cDNA fragment and STK4 3’-untranslated regions (3’UTR) containing the putative potential miR-18a-5p binding sites or mutant sites were amplified by PCR, and then subcloned to pmiR-RB-ReportTM vector in Xhol/Notl sites (Thermo Fisher Scientific). Site-directed mutagenesis of the miR-18a-5p target sites in the GAS5 cDNA (GAS5-MUT) and STK4 3’UTR (STK4-MUT) were performed using the Quick-Change Mutagenesis Kit (Stratagene, Heidelberg, Germany).
Dual luciferase assay
Cells (2.0 × 104) were seeded into 96-well dishes for 12 h to give about 70% confluence and then co-transfected with either miR-18a-5p or empty vector and pmiR-RB-ReportTM reporter (pMIR) comprising GAS5 fragment or 3’UTR of STK4 (wild type or mutant) using Lipofectamine 3000 (Invitrogen). After 48 h of transfection, the Dual-Luciferase Reporter Detection System (Promega, Madison, WI, USA) was used to measure luciferase activity according to the manufacturer’s instructions.
Cell proliferation assay
Cells (5.0 × 103) were seeded to a 96-well plate and incubated for 24 h, 48 h, 72 h, respectively. Cell viability was determined using a cell counting kit-8 (CCK8) kit (Beyotime Biotechnology, Jiangsu, China). The absorbance was detected at a wavelength of 450 nm by Elx800 Reader (Bio-Tek Instruments Inc., Winooski, VT, USA).
Colony formation assay
The PR PCA cells (200 per well) were seeded to a 6-well dish and cultured for 14 days. The cells were fixed with methanol and stained with 0.1% concentration of crystal violet (Sigma‑Aldrich, USA) for 10 minutes, and then visible colonies were manually counted.
Migration and invasion assays
For migration assays, the transwell chambers were used. Cells (5 × 105) were seeded into the upper chamber that without Matrigel (BD Biosciences, San Jose, CA, USA) coated. For transwell invasion assay, the diluted Matrigel was add to each upper chamber for 1 h at 37 ℃. Then the treated cells (5×105) were added to the upper chamber that cultured in serum-free medium and the lower chamber was filled with complete medium. After 24 h incubation, cells that migrated ort invaded through the pores were fixed with 4% paraformaldehyde for half an hour and stained with crystal violet solution for 15 minutes and then counted.
Flow cytometry analysis
Cells (1×106) were seeded to a 6-well plate and cultured for 24 h. Then the trypsinized cells were washed with cold PBS and fixed with 70% ethyl alcohol at 4 ℃ overnight. Then cells were incubated with propidium iodide (PI, 0.5 mg/ml) (BD Biosciences, San Diego, CA) for 15 min. DNA content was detected by a flow cytometer (BD Biosciences, San Jose, CA).
5-Ethynyl-2’-deoxyuridine (EdU) assay
Cells (5 × 104 per well) were seeded into 96-well plates for 48 h at 37 ℃. Then, 100 μl of medium containing 50 μM EDU (RiboBio, Guangdong, China) was added for another 2 h at 37 ℃ and fixed with 4% paraformaldehyde for 30 min. The fixed cells were permeabilized with 0.5% Triton X-100 for 10 min. The cells were then stained with Apollo® 567 and Hoechst33342, respectively.
Western blotting analysis
Total protein was extracted using a protein extraction kit (Beyotime Biotechnology, Shanghai, China) according to the manufacturer's instructions. Protein concentrations were quantified using a bicinchoninic acid (BCA) kit (Sigma-Aldrich, St. Louis, USA). The protein lysates (40 μg per lane) were separated by 10% polyacrylamide gel electrophoresis and then transferred onto polyvinylidene fluoride (PVDF) membranes (Millipore, Burlington, MA, USA). Membranes were blocked with 5% fat free milk that containing 0.1% Tween-20 for 1 h at room temperature and then incubated with primary antibodies at 4 °C overnight. The following day, membranes were rinsed with Tris-buffered Saline Tween 20 (TBST) and incubated with the corresponding secondary antibody for 1 h at room temperature. The target bands were scanned and visualized using chemiluminescence method with Bio-Rad Gel Doc EZ imager (Life Science Research, California, USA). Image J software (National Institutes of Health, Maryland) was applied to analyze the intensity of the target bands. β-actin was used as an internal control. The antibodies used were as follows: anti-STK4 (Santa Cruz, CA, USA), anti-E-cadherin (Cell Signaling Technology, Danvers, MA, USA), anti-N-cadherin (Cell Signaling Technology, Danvers, MA, USA), anti-vimetin (Cell Signaling Technology, Danvers, MA, USA), anti-SOX2 (Abcam, Cambridge, UK), anti-CD133 (Abcam, Cambridge, UK), anti-Nanog (Abcam, Cambridge, UK) and β-actin (Abcam, Cambridge, UK).
Immunohistochemical (IHC) staining analysis
Tissue samples were fixed in 4% paraformaldehyde overnight and embedded in paraffin according to standard protocols. After that, the paraffin tissue sections were pasted on glass slides, and then deparaffinized followed by antigen heat retrieval. After inactivating activity of endogenous peroxidase by using 3% H2O2 for 10 min, specimens were rinsed with PBS for 3 times, and then incubated with Ki67 primary antibody at 1:400 dilution (Cell Signaling Technology, Danvers, MA, USA) at 4°C overnight. Specimens were taken out to rinse with PBS and incubated with secondary antibody in a wet box at 37 °C for 30 min. After being rinsed with PBS, diaminobenzidine (DAB) was used followed by hematoxylin counterstaining.
Tumor xenograft models
Animal experiments were performed with the approval of the Research Ethics Committee of Nantong University according to Council on Animal Care Guidelines of Nantong University. The animal license number was SYXK (Su) 2017-0031. A total of 24 BALB/c male nude mice (5-week-old) were housed in a specific pathogen free (SPF) grade laboratory with a constant temperature (22-25 ℃) and humidity (55 ± 5%). The mice were divided into 4 groups (6 per group) randomly: Vector, Paclitaxel, GAS5 + Saline and GAS5 + Paclitaxel group. GAS5 or Vector transfected PC3-PR cells were injected subcutaneously into the flanks of the mice (1 × 106 cells/100 μL per flank). Then 7 days after the inoculation, mice (GAS5 + Saline group and GAS5 + Paclitaxel group) received either paclitaxel (20 mg/kg) or saline (100 µL) intraperitoneal injections every 2 days. Tumor size was measured using vernier calipers for the length (L) and width (W), and the tumor volume (V) was calculated with the formula: V = L × W2 × 0.5. All mice were sacrificed and the tumors were isolated and processed for further analysis after 5 weeks. Then tumor tissues were for IHC analysis of Ki67 protein expression and for RNA extraction to qPCR detection.
Statistical analysis
The SPSS 17.0 statistical package was used for statistical analysis in this study (Chicago, IL, USA). Quantitative data were indicated as the mean ± SD. The Student’s t test was used for statistical comparison of two groups, while one-way analysis of variance (ANOVA) was used followed by the Turkey’s test when comparing multiple groups. P < 0.05 was considered as different significantly.