Construction and evaluation of the SV40-LT and hTERT overexpression MDCK cell lines

doi:10.21203/rs.3.rs-2188996/v1

Research on establishing continuous cell line (CCL) has gained much attention recently, especially for its promising usage as an alternative substrate for vaccine production. In order to set up a ready-for-use protocol for potentially immortalizing animal originated cells, this study used MDCK as the pilot cells to explore the method using hTERT and SV40-LT genes transfected through liposome and lentivirus. Results showed that hTERT transfection with liposome and lentivirus, and SV40-LT with lentivirus could be successfully expressed in MDCK cells. Transfection efficiency of lentivirus was higher than liposome, and SV40-LT was easier to induce cell proliferation than hTERT. No mutation occurred during the passage and the original phenotype was maintained. The study provided a reference and potential method for the subsequent immortalization of primary cells.

overexpression

MDCK

hTERT

SV40-LT

Seasonal influenza is occurring with increasing frequency nowadays, and a growing threat has been posed by highly pathogenic disease, such as avian influenza^[1]. The faster and higher yielding vaccines is thus necessary to cope with the current dilemma with high demand of prepandemic vaccine^[2]. WHO proposed in 1995 to influenza vaccine manufacturers that cell culture can be used as a suitable substrate for the production of vaccines^[3]. Comparing to chicken embryo, vaccines produced based on cell matrix have many advantages in shorter production cycle, more flexible production process, and easier for scaling up, compensating for the deficiency of chicken embryo influenza vaccines^[4]. Furthermore, cell matrix based vaccines have a higher proximity to the immunogenic congenic virus and generate superior antibody titers after vaccination^[5].

Vaccine production greatly facilitated the development of animal cell technology^[6]. To overcome the limitation of primary culturing cells in vaccine production (e.g., limited lifespan and gradual loss of genetic characteristics during cell passage), the CCL was developed subsequently^[7]. For its unlimited passage feature, CCL is also called a passage cell line^[8]. Establishing various passage cell lines for vaccine production has therefore become a research priority in recent years.

MDCK cells, initially derived from kidney tissue of the female American Cocker Spaniel by Madin and Darby's in 1958^[9], synthesize and secrete tight junction proteins to the cell surface to form a single-cell layer with epithelial like morphological features. MDCK is usually adherent culture and enables serial passage^[10]. For the infectivity, ease of culture and rapid proliferation^[11], MDCK cells have now been frequently used to perform the propagation and isolation of a variety of viruses^[12] and are recognized as one of the important cell lines most suitable for the production of influenza vaccines^[13]. In addition, the use of MDCK cells for the production of veterinary vaccines has also been known for many years^[14].

In addition to spontaneously immortalized MDCK and VERO cells, several other methods have been used to immortalize primary cells, including the introduction of oncogenes such as p53 / PRB, the transfection of SV40 large-T antigen with E6 / E7 proteins of HPV, the overexpression of hTERT, and the immortalization of irradiated cells^[15]. The establishment and study of immortalized cell lines have gained much attention since Jerry et al (1978) proposed a molecular model of cell immortalization^[16]. Xia et al (2021) stably transfected a retrovirus containing hTERT into human vascular endothelial (HVFE) cells to establish an immortalized HVFE cell line that could last for more than 8 months^[17]. Li et al (2021) used viral transfection to immortalize normal human lung pericytes with a lentiviral vector carrying the SV40-LT antigen, and transfected cells showed robust SV40-LT expression, sustained proliferative capacity, and significant telomerase activity^[18]. These cell lines originated from different tissues help us to understand the molecular pathways controlling the cellular developmental cascades and to explore the mechanisms and nodal roles in the immortalization process^[19].

In the United States, cell lines such as MDCK are available from a variety of sources such as ATCC (American Type Culture Collection)^[20]. On the other hand, the cell lines used for vaccine production (e.g. MDCK, PER-C6, and VERO cells) are derived from introduced foreign institutes^[21].

In order to establish a protocol for immortalizing cells that has a potential broader-range of usage on other animal originated cells, we used MDCK as the pilot cells to explore the method due to its advantages such as faster cell proliferation, easier to access and observe. Specifically, we aimed to: 1) evaluate the proliferation effect of two immortalized genes (hTERT and SV40-LT); 2) examine the transfection efficiency of two transfection methods using lipofectamine and lentivirus.

2.1. MDCK cell resuscitation and subculture

Three tubes of frozen MDCK cells (from ATCC, cryopreserved in the lab from a MDCK sample, and denoted as F1 cell) were incubated at 37℃ while fast shaking for 90s, and replaced with medium and removed the floating dead cells after 24h-culture. Subculture was carried out in a ratio of 1:3 when the cells grew to more than 85%. The growth state was observed under microscope and photo recorded. F3 cells were cryopreserving in liquid nitrogen after freezing at 4℃ for 0.5h, -20℃ for 1h, and − 80℃ overnight for subsequent operations.

2.2. Preparation of plasmid and virus for transfection

The hTERT virus liquid and SV40-LT virus liquid were obtained from Shanghai Genechem Co., LTD. The plasmid vector containing hTERT gene, the pcl-neo-CMV-EGFP-Linker-hTERT, was constructed by Wuhan Miaoling Biotechnology Co., LTD. The expression vector was transferred into DH5α susceptible strain and then inoculated on LB agar plate of ampicillin and incubated at 37℃ for 9–12 h. Single colonies of the resistant strain were selected and inoculated in LB liquid medium of ampicillin sodium. After shaking cultivation of 12–16 h, plasmids were extracted using the extraction kit (Tiangen Biocheh Co., LTD).

The extracted plasmid was diluted 1, 000 times and the concentration was measured with the OD values at 230 nm, 260 nm and 280 nm, respectively, using a Nucleic Acid UV Detection System^[22]. A double digestion of EcoR Ⅰ and NoT Ⅰ (Takara Biomedical Technology Co., LTD) was carried out and the fragments were sequenced after visualization on an agarose gel.

2.3. Screening of G418 and purinomycin in MDCK cells

For subsequent screening of positive recombinant cells, the minimum lethal concentration of G418 and puromycin should be determined^[23]. F3 MDCK cells were inoculated with a 1×10⁴ / well density in the culture plate after thawing. When cells grew to 50%-60% of the full plate, a set of mediums with gradient concentrations of G418 (from 0 ug / mL to 1, 000 ug / mL, setting every 100 ug / mL as a gradient) were added^[24]. Medium was changed every 2 days, and the growth status under microscope was observed and photo recorded. The concentration when cells all died around 10th–14th day was recorded as the lowest lethal concentration of G418.

Similarly, a set of mediums with different puromycin concentrations was added to the culture plate, with a gradient of 1 ug / mL from 0 ug / mL to 10 ug / mL. The medium was changed every 2 days and the concentration when cells all died around 4th–7th day was recorded as the lowest lethal concentration of puromycin^[25].

2.4. Transfection and positive cell screening

F3 MDCK cells were seeded in 12 culture plates with a density of 1×10⁴ cells / well after recovery. Three of the plates were used for liposome transfection when the cells grew to 85% confluence. The pcl-neo-CMV-EGFP-Linker-hTERT was then introduced into MDCK cells (hereafter the MZLT cells) following manufacture’s instruction (Lipo3000, Thermo Fisher Scientific), and non-transfected MDCK cells were used as blank control^[26].

Aother two sets of three F3 cell plates were used, when cells grew to 50% confluence, for lentivirus infection with hTERT virus (hTERT gene of 3,445 bp) and SV40-LT virus (SV40-LT gene of 2,173 bp), respectively, following manufacture’s instruction (Shanghai Genechem Co., LTD). Non-transfected MDCK cells were set as blank control. Cells transfected with hTERT virus were named as MBLT and cells transfected with SV40-LT virus were named as MBLS hereafter in the current paper.

In order to observe whether there was fluorescence in the transfected cells, MZLT, MBLT and MBLS cells were photographed under fluorescence microscope and analyzed by imageJ (V1.8.0-National Institutes of Health) after transfection of 72h. Cells confirmed with fluorescence were then screened using G418 (for MZLT) or puromycin (for MBLT and MBLS) medium. Cells obtained from overgrown culture bottles after the drug-resistance screening were denoted as F1 generation.

2.5. Morphological analysis

Sub-cultured transfected cells were seeded into six-well plates and the morphological characteristics were observed under an inverted microscope when the cell density reached about 70–80%.

2.6. Analyses of gene stability

Total RNA of the transfected cells was extracted and cDNAs were synthesized with the reverse transcription kit following the manufacture’s instruction (Annoron Biotechnology Co., LTD.). Amplifications of the transfected gene (hTERT and SV40-LT gene) were conducted with qPCR using the cDNA as template and Actin Beta (ACTB) as internal reference^[27]. Primers used in the amplification were shown in Table 1.

Total proteins of transfected cells were extracted and the protein concentration was determined using the BCA method (Dalian Meilun Biotechnology Co., LTD.). Protein expression was further detected by Western Blot. To visualize the status of gene expression, the immunofluorescence analysis was also conducted after 2 days of culture using transfected cells inoculated in 12-well plates with a density of 1×10⁴ cells/well^[28].

Table 1

Primers used in qPCR amplification
Gene	Primer sequence
ACTB	F: GGCACCCAGCACAATGAAGA R: GTCAAGAAAGGGTGTAACGCAA
SV40-LT	F: ATTGCCTGGAACGCAGTGA R: GCAAACTCAGCCACAGGTCT
hTERT	F: TTGCGGAAGACAGTGGTGAA R: CTGGAGTAGTCGCTCTGCAC

2.7. Analyses of growth characteristics

Transfected cells were seeded in the culture plate with a density of 1×10⁴ cells/well, with daily replaced culture medium. Growth curve was then drawn based on results of cell counting.

Cell doubling time was calculated using the following formula:\(PDT=t\times {lg2}^{lgNt}-lgN0\)

In this equation, t represents the culture time, N0 represents the number of cells obtained by the first counting, and Nt represents number of cells after t time of culture.

Viability of the sub-cultured cells was analyzed by cell counter after cells being prepared into suspension. Additionally, cell cycle and cell apoptosis were analyzed with flow cytometry.

2.8. Analyses of genetic characteristics

In order to conduct karyotype analysis, transfected cells were first treated with colchicine for 6h, then digested with trypsin and fixed with a 3:1 solution of methanol and acetic acid. The suspension was dripped from a height of 50 cm to the slide for air drying. Karyotype analysis was performed after 10% Giemsa staining (Beijing solarbio science & technology Co., LTD.)^[29].

Following the procedures in 2.6, immunofluorescence analysis of cytokeratin-18 and vimentin expression in the transfected cells were conducted. ^[30].

3.1. Morphology and recovery rate of MDCK cells

In-vitro observation showed that F3 MDCK cells grew by static adherence and gradually covered the bottom of the bottle. Cells were arranged like paving stones (Fig. 1). Average activity of F3 cells was 97.06% before cryopreservation and 92.52% after one-month of cryopreservation.

3.2. Amplification and identification of pcl-neo-CMV-EGFP-Linker-hTERT plasmid

The pcl-neo-CMV-EGFP-Linker-hTERT plasmid was detected with an OD 260 / OD 280 ratio of 1.965 and concentration of 1,003 ng / uL. Electrophoresis results of double enzyme digestion showed that the fragment size was consistent with our expectation. Sequence of the amplified results was also consistent with the target fragment, showing that the plasmid was qualified for subsequent procedure (The sequencing results are in supplementary materials).

3.3. Determination of the minimum screening concentration of G418 and purinomycin

The G418 screening results showed that cells with concentration of 500 ug / mL and higher all died on the 14th day, suggesting that 500 ug / mL can be used as the minimum screening concentration of G418. Screening results of puromycin showed that all cells with concentration of 4 ug / mL and higher died on the 7th day, suggesting that 4 ug / mL can be used as the minimum screening concentration of puromycin (Fig. 2).

3.4. Screening of positive cells

No green fluorescence appeared in any of the cells after 72h transfection of pcl-neo-CMV-EGFP-Linker-hTERT (MZLT cells). However, 500 ug / ml G418 was still utilized for screening and subsequent identification of MZLT. In the other hand, cells transfected with hTERT and SV40-LT (MBLT and MBLS cells, respectively) showed positive green fluorescence after 72h-infection, suggesting successful transfection of the two genes with lentivirus. MBLT and MBLS cells were thus seeded onto the medium with puromycin of 4 ug / mL and positive cells were retained for further procedure (Table 2).

Table 2

Cell transfection rate and fluorescence intensity analysis
Cells	Fluorescence intensity (AU)	Fluorescence rate (%)
MZLT	26.737	21.875
MBLT	88.419	63.628
MBLS	96.562	74.315

3.5. Morphological Analysis

Three strains of MZLT, MBLT and MBLS cells were obtained after drug resistant selecting and were all able to sub-cultured to F30. The sub-cultured cells adhered to the wall and gradually covered the bottom of the bottle. Cells changed from single to multiple layers but remained in a paved stone-like arrangement (Fig. 1).

3.6. Analyses of gene stability

qPCR assay showed that positive results of hTERT were detected in both MZLT and MBLT and SV40-LT in MBLS cells (Fig. 3a, 3b). Immunofluorescence results showed that the cytoplasm was stained as red color and the nucleus as blue color, suggesting that proteins of hTERT and SV40-LT were expressed in cytoplasm instead of nucleus (Fig. 3c, 3d).

3.7. Analyses of growth characteristics

Results of cell viability and doubling time showed that the minimum survival rate of non-transfected MDCK cells was lower than 90%, and the doubling time was about 24h. The average viability of MZLT cells was lower than 90%. The average and minimum viability of MBLT cells and MBLS cells were all higher than 90% (Table 3).

Results of the growth curve showed that the growth rate of MZLT, MBLT, MBLS cells were generally slow from the 1st day to the 3rd day, then entered logarithmic growth phase from the 3rd day, reached the maximum value on the 6th day, and entered plateau phase and decreased on the 8th day. Non-transfected MDCK cells reached the maximum value on the 7th day (Fig. 4a).

Results of cell cycle showed that percentage of cells in the S phase for the non-transfected MDCK was around 22.35%, and that in the G2 phase was 11.72%. Percentage of cells in the G1 phase for MZLT, MBLT, MBLS was all lower than 60%, and cells in the S phase were more than 25% (Table 3, Fig. 4b).

Results showed that the apoptosis rate in the non-transfected cells was higher than 15%, rate of living cells was lower than 80%. For the MZLT, MBLT, MBLS cells, the apoptosis rate is lower than 11%, rate of living cells was higher than 80% (Table 3, Fig. 4c).

Table 3 Results of cell viability, multiplication time, cell cycle and apoptosis

Cells	Minimum survival rate	Average survival rate	Doubling time
MDCK	89.12%	92.14%	24.89h
MZLT	86.17%	89.44%	21.74h
MBLT	90.14%	93.12%	21.34h
MBLT	92.12%	93.28%	20.97h

Cells	G1 phase	S phase	G2 phase
MDCK	65.92%	22.35%	11.72%
MZLT	55.69%	29.92%	14.39%
MBLT	55.83%	30.28%	13.89%
MBLT	54.08%	31.34%	14.58%

Cells	Dead cells	Apoptotic cells	Living cells
MDCK	7.2%	17.7%	74.5%
MZLT	8.5%	10.6%	80.4%
MBLT	0.6%	9.9%	89.0%
MBLT	0.4%	8.6%	90.0%

3.8. Analysis of genetic traits

Results of karyotype analysis of MZLT, MBLT and MBLS cells all showed that the number of chromosomes were about 2n = 78, which was the same as that of the non-transfected cells (Fig. 5a). Immunofluorescence results of vimentin and cytokeratin-18 showed that the cytoplasm was stained as red and the nucleus was stained as blue (Fig. 5b, 5c).

In this study, the transfection efficiency between different methods of cell immortalization (hTERT and SV40-LT genes transfected using liposome and lentivirus) was evaluated on MDCK. The results showed that hTERT transfection with liposome and lentivirus, and SV40-LT with lentivirus could be successfully expressed in MDCK cells. Transfection efficiency of lentivirus was higher than liposome (based on results of cell transfection rate and fluorescence intensity analysis). Results from qPCR and Western blot also suggested that SV40-LT was easier to induce cell proliferation than hTERT. Liposome-transfected hTERT cells (MZLT), lentivirus-transfected hTERT cells (MBLT), lentivirus-transfected SV40-LT cells (MBLS) all had normal karyotype and were relatively stable during passage in cell morphology.

Immortalizing infection can be achieved by transfection of exogenous genes into the recipient cells and transfection method is an important factor affecting the success of immortalization^[31]. At present, transfection vectors mainly consists of viral and non-viral vectors^[32]. Among non-viral vectors, liposome mediated transfection is the most used method due to many advantages such as simple transfection condition, higher survival rate of cells and better repeatability^[33]. On the other hand, the transfection efficiency and fluorescence expression abundance of lipofectamine are relatively low comparing to viral vectors^[34]. Lentiviral vectors, therefore, are an alternative to compensate these drawbacks. Additionally, transfection with lentivirus can maintain continuous gene expression^[35]. However, shinkage of cell volume, nuclear and cytoplasmic condensation after transfection may also occur^[36]. The difference of transfection efficiency between lipofectamine and lentivirus was also found in this study, with evident fluorescent results only presented in cells transfected with lentivirus. Positive results of hTERT remained detectable, though, in subsequent qPCR and immunofluorescence analyses. The weak fluorescence in MZLT (cells transfected with liposome) possibly resulted from the low transfection rate or poor fluorescent able on the vector itself.

Telomeres are a specialized structure located at the ends of chromosomes^[37]. Cells in vitro undergo progressive telomere shortening at each division, and cell senescence occurs due to the loss of division ability when telomeres are shortened to a certain extent^[38]. TERT (telomerase reverse tranase), a ribonucleoproteinase that elongates telomeric ends, utilizes its own RNA as template to extend telomeres from 3' to 5' ends or to synthesize new telomeric DNA, compensating for the shortening of chromosome ends to avoid apoptosis due to telomere depletion^[39]. In normal somatic cells, telomerase activity is strictly regulated and undetectable^[40]. As the catalytic subunit and rate limiting enzyme of telomerase, TERT therefore plays a key role in the maintenance of telomerase activity, and can be used for cell immortalization in vitro for maintaining telomere length^[41]. TERT of human origin (hTERT, human telomerase reverse transcriptase) is commonly used to obtain immortalized cells. hTERT increases cell migration upon expression, and promotes cell invasion and metastasis^[42]. Additionally, hTERT indirectly regulates p53 / pRB gene expression which facilitates cell adhesion^[39]. However, the effect of cell immortalization of hTERT is not absolute. Reconstitution of telomerase activity after stable expression of the hTERT gene can extend the lifespan of primary adipocytes at some extent, but immortalization cannot be achieved^[43].

Cell transformation caused by the SV40 virus is a complex process, on the other hand. The transforming protein encoded by the SV40 virus acts on the plasma membrane of the cell to cause changes in cell growth and on the nucleus to regulate DNA replication and gene expression^[44]. The function of LT to extend cell lifespan and immortalize cells relies on multiple ways, including the interaction with the growth suppressors pRB and p53, the binding to the RB-E2F signalling pathway pocket site complex to activate E2F mediated transcription, and / or the integration with Rb protein via binding to the lxcxe motif and j domain in an ATP dependent manner^[45]. SV40-LT not only immortalizes cells but also promotes cell proliferation^[46]. Research showed that immortalized liver porcine cells via transfected SV-LT maintained the characteristics of primary porcine hepatocytes, with higher cell viability and injury resistance while were not tumorigenic^[47]. However, transfection with SV40-LT may induce some detrimental effects to cells. A study of immortalized sheep embryonic kidney cells showed lacking of LT-antigen expression and exhibiting heterogeneous polyploidy during early passages^[48]. Other studies also found that cells were malignant or tumorigenic after immortalization, or lost the original cellular phenotype^[49]. In this study, transfected cells showed enhanced viability, and the number of chromosomes did not change during passaging and had stably expressed cytokeratin-18 protein. In addition, chromosomal aberration was not detected in our hTERT and SV40-LT transfected cells.

Comparing to chicken embryos, the utilization of animal passage cells in influenza vaccines production not only has more reliable immune effects, is also capable of coping with epidemic outbreak with large-scale multiplication sufficient vaccine product. Development of newly established CCL has promising application prospects in vaccine production. Our study demonstrated the effect of cell proliferation of transfected hTERT and SV40 genes and provided a reference method for subsequent immortalization of primary cells.

Ethics approval and consent to participate

Not applicable

Consent for publication

Not applicable.

Availability of data and materials

The authors confirm that all the raw data supporting the findings of this study either are presented in the article or can be found in the supplementary materials.

Competing interests

The authors declare that they have no competing interests.

Funding

This research was supported by the Technology Project of Gansu Province (No. 21YF1FA222), and the Fundamental Research Funds for the Central Universities of Northwest Minzu University (No. 3192021002，3192020004，31920210053).

Authors' contributions

WKL: Formal analysis; Writing-Original Draft & Editing; JMW: Conceptualization; Investigation; Methodology; Validation; ZBL: Conceptualization; GlM: Data curation; ZLQ: Resources; ZRM: Resources; YL: Conceptualization; Supervision; MMW: Writing-Review & Editing. All authors read and approved the final manuscript.

Acknowledgements

The authors are grateful to Ling Tian, Shuwu Chen, Jiachen Shi, and Shouqin Guo for their assistance in the laboratory.

Pallikkuth, S., De, Armas, L.R., Pahwa, R., Rinaldi, S., George, V.K., Sanchez, C.M., Pan, L., Dickinson, G., Rodriguez, A., Fischl, M., Alcaide, M., Pahwa S., 2018. Impact of aging and HIV infection on serologic response to seasonal influenza vaccination. AIDS. 32, 1085-1094. https://doi: 10.1097/QAD.0000000000001774.
Moleirinho, M.G., Silva, R.J.S., Alves, P.M., Carrondo, M.J.T., Peixoto, C., 2020. Current challenges in biotherapeutic particles manufacturing. Expert Opin Biol Ther. 20, 451-465. https://doi: 10.1080/14712598.2020.1693541.
Pérez, Rubio, A., Eiros, J.M., 2018. Cell culture-derived flu vaccine: Present and future. Hum Vaccin Immunother. 14, 1874-1882. https://doi: 10.1080/21645515.2018.1460297.
Kaurav, M., Madan, J., Sudheesh, M.S., Pandey, R.S., 2018. Combined adjuvant-delivery system for new generation vaccine antigens: alliance has its own advantage. Artif Cells Nanomed Biotechnol. 46, S818-S831. https://doi: 10.1080/21691401.2018.1513941.
Bonam, S.R., Partidos, C.D., Halmuthur, S.K.M., Muller, S., 2017. An Overview of Novel Adjuvants Designed for Improving Vaccine Efficacy. Trends Pharmacol Sci. 38, 771-793. https://doi: 10.1016/j.tips.2017.06.002.
Yao, T., Asayama, Y., 2017. Animal-cell culture media: History, characteristics, and current issues. Reprod Med Biol. 16, 99-117. https://doi: 10.1002/rmb2.12024.
Yuk, I.H., Nishihara, J., Walker, D. J.r., Huang, E., Gunawan, F., Subramanian, J., Pynn, A.F., Yu, X.C., Zhu-Shimoni, J., Vanderlaan, M., Krawitz, D.C., 2015. More similar than different: Host cell protein production using three null CHO cell lines. Biotechnol Bioeng. 112, 2068-2083. https://doi: 10.1002/bit.25615.
Fantauzzo, K.A., Soriano, P., 2017. Generation of an immortalized mouse embryonic palatal mesenchyme cell line. PLoS One. 5, e0179078. https://doi: 10.1371/journal.pone.0179078.
Rajaram, S., Boikos, C., Gelone, D.K., Gandhi, A., 2020. Influenza vaccines: the potential benefits of cell-culture isolation and manufacturing. Ther Adv Vaccines Immunother. 22, 2515135520908121. https://doi: 10.1177/2515135520908121.
Takada, K., Kawakami, C., Fan, S., Chiba, S., Zhong, G., Gu, C., Shimizu, K., Takasaki, S., Sakai-Tagawa, Y., Lopes, T.J.S., Dutta, J., Khan, Z., Kriti, D., van, Bakel, H., Yamada, S., Watanabe, T., Imai, M., Kawaoka, Y., 2019. A humanized MDCK cell line for the efficient isolation and propagation of human influenza viruses. Nat Microbiol. 4, 1268-1273. https://doi: 10.1038/s41564-019-0433-6.
Ye, X., Wang, J., Qiao, Z., Yang, D., Wang, J., Abudureyimu, A., Yang, K., Feng, Y., Ma, Z., Liu, Z., 2021. Quantitative proteomic analysis of MDCK cell adhesion. Mol Omics. 17, 121-129. https://doi: 10.1039/d0mo00055h.
Nakamura, K., Harada, Y., Takahashi, H., Trusheim, H., Bernhard, R., Hamamoto, I., Hirata-Saito, A., Ogane, T., Mizuta, K., Konomi, N., Konomi, Y., Asanuma, H., Odagiri, T., Tashiro, M., Yamamoto, N., 2019. Systematic evaluation of suspension MDCK cells, adherent MDCK cells, and LLC-MK2 cells for preparing influenza vaccine seed virus. Vaccine. 37, 6526-6534. https://doi: 10.1016/j.vaccine.2019.08.064.
Shin, D., Park, K.J., Lee, H., Cho, E.Y., Kim, M.S., Hwang, M.H., Kim, S.I., Ahn, D.H., 2015. Comparison of immunogenicity of cell-and egg-passaged viruses for manufacturing MDCK cell culture-based influenza vaccines. Virus Res. 204, 40-46. https://doi: 10.1016/j.virusres..04.005.
Genzel, Y., 2015. Designing cell lines for viral vaccine production: Where do we stand? Biotechnol J. 10, 728-740. https://doi: 10.1002/biot.201400388.
Seridi, N., Hamidouche, M., Belmessabih, N., E.l. Kennani, S., Gagnon, J., Martinez, G., Coutton, C., Marchal, T., Chebloune, Y., 2021. Immortalization of primary sheep embryo kidney cells. In Vitro Cell Dev Biol Anim. 57, 76-85. https://doi: 10.1007/s11626-020-00520-y.
Shay, J.W., 2016. Role of Telomeres and Telomerase in Aging and Cancer. Cancer Discov. 6, 584-593. https://doi: 10.1158/2159-8290.
Chen, X., Lungova, V., Zhang, H., Mohanty, C., Kendziorski, C., Thibeault, S.L., 2021. Novel immortalized human vocal fold epithelial cell line: In vitro tool for mucosal biology. FASEB J. 35, e21243. https://doi: 10.1096/fj.202001423R.
Li, P., Wu, Y., Goodwin, A.J., Halushka, P.V., Wilson, C.L., Schnapp, L.M., Fan, H., 2021. Generation of a new immortalized human lung pericyte cell line: a promising tool for human lung pericyte studies. Lab Invest. 101, 625-635. https://doi: 10.1038/s41374-020-00524-y.
Méndez-López, L.F., Davila-Velderrain, J., Domínguez-Hüttinger, E., Enríquez-Olguín, C., Martínez-García, J.C., Alvarez-Buylla, E.R., 2017. Gene regulatory network underlying the immortalization of epithelial cells. BMC Syst Biol. 11, 24. https://doi: 10.1186/s12918-017-0393-5.
Phelan, K., May, K.M., 2016. Basic Techniques in Mammalian Cell Tissue Culture. Curr Protoc Toxicol. 70, A.3B.1-A.3B.22. https://doi: 10.1002/cptx.13.
Lin, S.C., Kappes, M.A., Chen, M.C., Lin, C.C., Wang, T.T., 2017. Distinct susceptibility and applicability of MDCK derivatives for influenza virus research. PLoS One. 12, e0172299. https://doi: 10.1371/journal.pone.0172299.
Smalla, K., Jechalke, S., Top, E.M., 2015. Plasmid Detection, Characterization, and Ecology. Microbiol Spectr. 3, PLAS-0038-2014. https://doi: 10.1128/microbiolspec.
He, Z.Q., Xia, B.L., Wang, Y.K., Li, J., Feng, G.H., Zhang, L.L., Li, Y.H., Wan, H.F., Li, T.D., Xu, K., Yuan, X.W., Li, Y.F., Zhang, X.X., Zhang, Y., Wang, L., Li, W., Zhou, Q., 2017. Generation of Mouse Haploid Somatic Cells by Small Molecules for Genome-wide Genetic Screening. Cell Rep. 20, 2227-2237. https://doi: 10.1016/j.celrep.2017.07.081.
Yörük, E., Albayrak, G., 2015. Geneticin (G418) resistance and electroporation-mediated transformation of Fusarium graminearum and F. culmorum. Biotechnol Biotechnol Equip. 29, 268-273. https://doi: 10.1080/13102818.2014.996978.
Lou, G., Chen, L., Xia, C., Wang, W., Qi, J., Li, A., Zhao, L., Chen, Z., Zheng, M., Liu, Y., 2020. MiR-199a-modified exosomes from adipose tissue-derived mesenchymal stem cells improve hepatocellular carcinoma chemosensitivity through mTOR pathway. J Exp Clin Cancer Res. 39, 4. https://doi: 10.1186/s13046-019-1512-5.
Wang, T., Larcher, L.M., Ma, L., Veedu, R.N., 2018. Systematic Screening of Commonly Used Commercial Transfection Reagents towards Efficient Transfection of Single-Stranded Oligonucleotides. Molecules. 23, 2564. https://doi: 10.3390/molecules23102564.
Aviv, A., Hunt, S.C., Lin, J., Cao, X., Kimura, M., Blackburn, E., 2011. Impartial comparative analysis of measurement of leukocyte telomere length/DNA content by Southern blots and qPCR. Nucleic Acids Res. 39, e134. https://doi: 10.1093/nar/gkr634.
Vogin, G., Bastogne, T., Bodgi, L., Gillet-Daubin, J., Canet, A., Pereira, S., Foray, N., 2018. The Phosphorylated ATM Immunofluorescence Assay: A High-performance Radiosensitivity Assay to Predict Postradiation Therapy Overreactions. Int J Radiat Oncol Biol Phys. 101, 690-693. https://doi: 10.1016/j.ijrobp.2018.03.047.
Yuan, S.M., Liao, C., Li, D.Z., Huang, J.Z., Hu, S.Y., Ke, M., Zhong, H.Z., Yi, C.X., 2017. [Chorionic villus cell culture and karyotype analysis in 1983 cases of spontaneous miscarriage]. Zhonghua Fu Chan Ke Za Zhi. 52, 461-466. Chinese. https://doi: 10.3760/cma.j.issn.0529-567X.2017.07.006.
Battaglia, R.A., Delic, S., Herrmann, H., Snider, N.T., 2018. Vimentin on the move: new developments in cell migration. F1000Res. 15F, 1000 Faculty Rev-1796. https://doi: 10.12688/f1000research.15967.1.
Suarez, C.E., McElwain, T.F., 2010. Transfection systems for Babesia bovis: a review of methods for the transient and stable expression of exogenous genes. Vet Parasitol. 167, 205-215. https://doi: 10.1016/j.vetpar.2009.09.022.
Caffery, B., Lee, J.S., Alexander-Bryant, A.A., 2019. Vectors for Glioblastoma Gene Therapy: Viral & Non-Viral Delivery Strategies. Nanomaterials (Basel). 9, 105. https://doi: 10.3390/nano9010105.
Sainz-Ramos, M., Villate-Beitia, I., Gallego, I., A. L. Qtaish, N., Lopez-Mendez, T.B., Eritja, R., Grijalvo, S., Puras, G., Pedraz, J.L., 2020. Non-viral mediated gene therapy in human cystic fibrosis airway epithelial cells recovers chloride channel functionality. Int J Pharm. 588, 119757. https://doi: 10.1016/j.ijpharm.2020.119757.
Hosseinpour, S., Xu, C., Walsh, L.J., 2021. Impact of photobiomodulation using four diode laser wavelengths of on cationic liposome gene transfection into pre-osteoblast cells. J Photochem Photobiol B. 215, 112108. https://doi: 10.1016/j.jphotobiol.2020.112108.
Bonci, D., Cittadini, A., Latronico, M.V., Borello, U., Aycock, J.K., Drusco, A., Innocenzi, A., Follenzi, A., Lavitrano, M., Monti, M.G., Ross, J. J.r., Naldini, L., Peschle, C., Cossu, G., Condorelli, G., 2003. 'Advanced' generation lentiviruses as efficient vectors for cardiomyocyte gene transduction in vitro and in vivo. Gene Ther. 10, 630-636. https://doi: 10.1038/sj.gt.3301936.
Zhivotovsky, B., Orrenius, S., 2011. Calcium and cell death mechanisms: a perspective from the cell death community. Cell Calcium. 50, 211-221. https://doi: 10.1016/j.ceca.2011.03.003.
Jafri, M.A., Ansari, S.A., Alqahtani, M.H., Shay, J.W., 2016. Roles of telomeres and telomerase in cancer, and advances in telomerase-targeted therapies. Genome Med. 8, 69. https://doi: 10.1186/s13073-016-0324-x.
Flanary, B.E., Streit, W.J., 2004. Progressive telomere shortening occurs in cultured rat microglia, but not astrocytes. Glia. 45, 75-88. https://doi: 10.1002/glia.10301.
Liu, H., Liu, Q., Ge, Y., Zhao, Q., Zheng, X., Zhao, Y., 2016. hTERT promotes cell adhesion and migration independent of telomerase activity. Sci Rep. 14, 22886. https://doi: 10.1038/srep22886.
Mizukoshi, E., Kaneko, S., 2019. Telomerase-Targeted Cancer Immunotherapy. Int J Mol Sci. 20, 1823. https://doi: 10.3390/ijms20081823.
Park, Y.P., Choi, S.C., Cho, M.Y., Song, E.Y., Kim, J.W., Paik, S.G., Kim, Y.K., Kim, J.W., Lee, H.G., 2006. Modulation of telomerase activity and human telomerase reverse transcriptase expression by caspases and bcl-2 family proteins in Cisplatin-induced cell death. Korean J Lab Med. 26, 287-293. https://doi: 10.3343/kjlm.2006.26.4.287.
Parulekar, A., Choksi, A., Taye, N., Totakura, K.V.S., Firmal, P., Kundu, G.C., Chattopadhyay, S., 2021. SMAR1 suppresses the cancer stem cell population via hTERT repression in colorectal cancer cells. Int J Biochem Cell Biol. 141, 106085. https://doi: 10.1016/j.biocel.2021.106085.
Darimont, C., Macé, K., 2003. Immortalization of human preadipocytes. Biochimie. 85, 1231-1233. https://doi: 10.1016/j.biochi.2003.10.015.
Xie, H.Q., Yang, Z.M., Qu, Y., 2000. [SV40 and cell immortalization]. Zhongguo Xiu Fu Chong Jian Wai Ke Za Zhi. 14, 170-174. Chinese.
Bryan, T.M., Reddel, R.R., 1994. SV40-induced immortalization of human cells. Crit Rev Oncog. 5, 331-357. https://doi: 10.1615/critrevoncog.v5.i4.10.
Maugein, A., Diedisheim, M., Bailly, K., Scharfmann, R., Albagli, O., 2020. The RB gene family controls the maturation state of the EndoC-βH2 human pancreatic β-cells. Differentiation. 113, 1-9. https://doi: 10.1016/j.diff.2020.02.001.
Boukamp, P., Petrussevska, R.T., Breitkreutz, D., Hornung, J., Markham, A., Fusenig, N.E., 1988. Normal keratinization in a spontaneously immortalized aneuploid human keratinocyte cell line. J Cell Biol. 106, 761-771. https://doi: 10.1083/jcb.106.3.761.
Seridi, N., Hamidouche, M., Belmessabih, N., E.l. Kennani, S., Gagnon, J., Martinez, G., Coutton, C., Marchal, T., Chebloune, Y., 2021. Immortalization of primary sheep embryo kidney cells. In Vitro Cell Dev Biol Anim. 57, 76-85. https://doi: 10.1007/s11626-020-00520-y.
Reddel, R.R., De, Silva, R., Duncan, E.L., Rogan, E.M., Whitaker, N.J., Zahra, D.G., Ke, Y., McMenamin, M.G., Gerwin, B.I., Harris, C.C., 1995. SV40-induced immortalization and ras-transformation of human bronchial epithelial cells. Int J Cancer. 61, 199-205. https://doi: 10.1002/ijc.2910610210.

No competing interests reported.

Construction and evaluation of the SV40-LT and hTERT overexpression MDCK cell lines

Status:

Version 1

Abstract

Figures

1. Introduction

2. Materials And Methods