Human tissue
Brain precentral gyrus samples from patients with AD and from controls were purchased from Netherlands brain bank. Information related to these patients and controls is shown in (Additional file 1: Table S1).
Mice
B6SJLF1/J (JAX#100012), and five familial AD mutation (5XFAD) transgenic mice (#MMRRC#034848) were purchased from The Jackson Laboratory (Bar Harbor, ME, USA). 5XFAD mice overexpress mutant human amyloid precursor protein (APP) with the Swedish (K670N, M671L), Florida (I716V), and London (V717I) mutations, along with mutant human presenilin 1 (PS1) that carries two FAD mutations (M146L and L286V). These transgenes are regulated by the Thy1 promoter in neurons. The genotype of 5XFAD mice was confirmed by PCR analysis of tail DNA following standard PCR conditions provided by The Jackson Laboratory. Mice of mixed genotypes were housed four to five per cage with a 12-hour light/12-hour dark cycle and food and water ad libitum. All animal procedures were performed according to the Konyang University guidelines for care and use of laboratory animals.
Next generation sequencing using mouse frontal cortex tissue
NGS was performed in a NovaSeq 6000 system (Illumina, https://www.illumina.com/) by the Theragen Etex Bio Institute (Seoul, Republic of Korea, www.theragenetex.com/kr/bio). TruSeq Stranded mRNA Library Kit (Illumina) was used to build the library. Afterwards, data was processed using 'Raw read' for mRNA sequencing. Raw reads were aligned to GRCm38.96 (NCBI) using STAR aligner v2.7.1 for calculation of ‘RSEM’ expression values [14]. We performed the STAR aligner as the default option. Since the total number of reads for each sample was different, normalization was performed by TMM method. Thirteen mouse samples were processed in the same way. All data is available in the GEO (Gene Expression Omnibus, https://www.ncbi.nlm.nih.gov/geo/) as GSE142633.
Public database usage, reanalysis and network analysis
We used results from Weinberg et al. to confirm miRNAs that are highly related to cognitive impairment [15]. The 100 genes shown in Figure S1 were extracted from Table 1 of Weinberg et al. We took log2 in Weinberg et al.’s results, ordered them, and marked the target miRNAs. The “miRDB” was used to search for miRNA targeting specific genes [16]. The "Genecard" database was used to search for genes related to disease or biological symptoms [17]. The results in Figure S2a show search results from using keywords, “Inflammation”, “Amyloid beta degradation” and “Alzheimer” in August 2019. We used “VennDiagram” package of R for analysis for Venn diagram. The “GeneMAINA” (version 3.5.1) package of Cytoscape (version 3.7.1) was used for protein to protein interaction analysis [18]. We used 265 common genes that included hsa-miR-485-3p target genes and Alzheimer-related genes as inputs for protein interaction analysis. Among them, 139 genes interacted without neighbor gene. In addition, 9 genes were highly associated with cerebral nervous system diseases (including AD) and at the same time, low expression was reported in the patient group or in a dementia mouse model [19–26]. Nine genes are indicated by red font in Figure S2b.
Intraventricular injection of the miR485-3p ASO
The miR485-3p ASO (AGAGAGGAGAGCCGUGUAUGAC) were synthesized by Integrated DNA Technologies (USA). Non-targeting ASO (negative control, Cat#AM17010) were purchased from ThermoFisher (USA). All animals were initially anesthetized with 3–5% isoflurane in oxygen and fixed on a stereotaxic frame (JeongDo). For intracerebroventricular (ICV) injection, miR485-3p ASO or non-targeting control oligonucleotides were formulated with in vivo jetPEI reagent (Polyplus). miR485-3p ASO (1.5 µg) or control oligonucleotide formulated with in vivo jetPEI reagent, was injected with a 10 ul Hamilton syringe (26-gauge blunt needle) at 1.5 ul/min. miR485-3p ASO were infused in a volume of 5 µl into 10 months old 5XFAD mice by intracerebroventricular (ICV). miR485-3p ASO or non‐targeting control oligonucleotides were given once a week for 2 weeks. Intracerebroventricular (ICV) position was identified using the coordinates from the bregma: AP = − 0.2 mm, L = ± 1.0 mm, ventral (V) = − 2.5 mm.
Glial cell and cortical neuron culture and transfection
Mouse primary mixed glial cells were cultured from the cerebral cortices of 1- to 3-day-old C57BL/6 mice. The cerebral cortex was dissected and triturated into single-cell suspensions by pipetting. Then, single-cell suspensions were plated into 6 well plates pre‐coated with 0.05 mg/ml poly‐D‐lysine (PDL) and cultured in DMEM medium supplemented with 25 mM glucose, 10% (vol/vol) heat‐inactivated foetal bovine serum, 2 mM glutamine and 1,000 units/ml penicillin–streptomycin (P/S) for 2 weeks. Primary cortical neurons were cultured from embryonic day 17 mice. In brief, cortices were dissected and incubated in ice-cold HBSS (Welgene, LB003-02) solution and dissociated in accumax (sigma, Cat#A7089) for 15 min at 37 °C. The cultures were rinsed twice in HBSS. Mouse neurons were resuspended in neurobasal media (Gibco, Cat#21103049) containing 2% B27 (Gibco, Cat#17504), 1% sodium pyruvate, and 1% P/S. Cells were filtered through a 70um cell strainer (SPL, 93070), plated on culture plates and maintained at 37℃ in a humidified 5% CO2 incubator. The medium was changed every 3 days and then after 12–13 days in vitro, cells used for experiments. Primary glial cell or cortical neurons were transfected with 100 nM miR-control, 100 nM has-miR485-3p mimic or 100 nM miR485-3p ASO using TransIT-X2® Transfection Reagent (Mirus Bio).
Luciferase assays
Human SIRT1 3’-UTR containing the target site for miR-485-3p was amplified from cDNA by PCR amplification and inserted into the psiCHECK2 vector (Promega, Cat#C8021). HEK293T cells in a 96-well plate were co-transfected with psiCHECK2-Sirt1-3’UTR WT or psiCHECK2-Sirt1-3’UTR MT and miR-485-3p using Lipofectamine 2000 (Invitrogen, Cat#11668-027). Cells were harvested 48hr later, and the Dual Luciferase Assay System (Promega, Cat#E1910) was used to measure the luciferase reporter activities. Three independent experiment were performed in triplicate.
Human CD36 3’-UTR containing the target site for miR-485-3p was amplified from cDNA by PCR amplification and inserted into the pMir-Target vector (Addgene). HEK293T cells in 96-well plates were co-transfected with pMir-CD36-3’UTR WT or pMir-CD36-3’UTR MT and pRL-SV40 vector (Addgene) and miR-485-3p using Lipofectamine 2000 (Invitrogen, Cat#11668-027). Cells were harvested 24 ~ 48hr later, and the Dual Luciferase Assay System (Promega, Cat#E1910) was used to measure the luciferase reporter activities. Three independent experiment were performed in triplicate.
In vitro binding assay
Streptavidin magnetic beads (Invitrogen, Cat#11205D) were prepared for in vitro binding assay as follows. Beads (50 ul) were washed five times with 500 ul of 1X B&W buffer (5 mM Tris-HCl, pH 7.4; 0.5 mM EDTA; 1 M NaCl). After removing the supernatant, beads were incubated with 500 ul of 1X B&W buffer containing 100 ug of yeast tRNA (Invitrogen, Cat# AM7119) for 2 hours at 4℃. Beads were washed twice with 500 ul of 1X B&W buffer and incubated with 200 ul of 1X B&W buffer containing 400 pmol of biotin-miR485-3p for 10 minutes at room temperature. The supernatant was removed and beads were washed twice with 500 ul of 1X B&W buffer and collected with a magnetic stand. miRNA-coated beads were incubated with 500 ul of 1X B&W buffer containing 1 ug of in vitro transcribed target mRNA overnight at 4℃. The following day, beads were washed with 1 ml of 1X B&W buffer five times and then resuspended in 200 ul of RNase-free water. Bound RNA was extracted with QiaZol Lysis reagent (Qiagen, Cat#79306) under manufacturer’s instructions. Extracted RNA was quantified by StepOnePlus Real-time PCR system (Applied Biosystems, REF: 4376592).
Western blot
Brain tissue, primary glial cells or cortical neuron cells were homogenized in ice-cold RIPA buffer (iNtRON Biotechnology) containing protease/phosphatase inhibitor cocktail (Cell Signaling Technology, Cat#5872) on ice for 30 min. The lysates were centrifuged at 13,000 rpm for 15 min at 4 °C, and supernatants were collected. The samples were separated by SDS–polyacrylamide gel electrophoresis, transferred to PVDF membranes and incubated with the following primary antibodies: rabbit anti-PGC-1α (Abcam, Cat# ab54481, 1:1000), rabbit anti-APP (Cell Signaling Technology, Cat#2452, 1:1000), mouse anti-sAPPα (IBL, Cat#11088, 1:1000), mouse anti-sAPPβ (IBL, Cat#10321, 1:1000), rabbit anti-Adam10 (Abcam, Cat#ab1997, 1:100), mouse anti-CTFs (Biolegend, Cat#SIG-39152, 1:1000), rabbit anti-β-amyloid (1–42) (Cell Signaling Technology, Cat#14974, 1:1000), rabbit anti-BACE1 (Abcam, Cat# ab2077, 1:1000), mouse anti-NeuN (Millipore, #MAB377, 1:1000), rabbit anti-cleaved caspase 3 (Cell Signaling Technology, Cat#9664, 1:1000), mouse anti-GFAP (Merck, Cat#MAB360, 1:1000), rabbit anti-IL-1β (abcam, Cat#9722, 1:1000), rabbit anti-NF-kB(p65) (Cell Signaling Technology, Cat#8242, 1:1000), goat anti-Iba1 (Abcam, Cat#ab5076, 1:1000), rabbit anti-SIRT1 (Abcam, Cat#04-1557), mouse anti-TNF-α (Santa Cruz, Cat#sc-52746), anti-actin (Santa Cruz, Cat#sc-47778). The results were visualized using an enhanced chemiluminescence system, and quantified by densitometric analysis (Image J software, NIH). All experiments were performed independently at least three times.
Insoluble Aβ extraction
Brain tissue samples were homogenized with RIPA buffer containing protease/phosphatase inhibitors on ice, followed by centrifugation at 12,000 rpm for 15 min. The supernatants were collected. To obtain the insoluble fraction from brain tissues, the pellet of brain lysates was lysed in insoluble extraction buffer [50 mM Tris-HCl (pH7.5) + 2% SDS] containing protease/phosphatase inhibitor cocktail on ice for 30 min. The lysates were centrifuged at 4 °C for 15 min at 13,000 rpm. Protein was quantified using bicinchoninic acid (BCA) assay kit (Bio-Rad Laboratories, Cat#5000116) and adjusted to the same final concentration. After denaturation, the lysates were processed for western blotting to measure insoluble Aβ.
Immunohistochemistry
For immunohistochemistry, oligonucleotide injected 5XFAD brains were removed, postfixed and embedded in paraffin. Coronal sections (10-µm thick) through the infarct were cut using a microtome and mounted on slides. The paraffin was removed, and the sections were washed with PBS-T and blocked in 10% bovine serum albumin for 2 h. Thereafter, the following primary antibodies were applied: Purified mouse anti-β-Amyloid, 1–16 (Biolegend, #803001, 1 µg/ml), rabbit anti-β-amyloid (1–42 (Cell Signaling Technology, #14974s, 1:100), rabbit anti-Iba-1 (Wako, #019-19741, 2 µg/ml), goat anti-Iba-1 (Abcam, #ab5076, 2 µg/ml), rabbit anti-CD68 (Abcam, #ab125212, 1 µg/ml), rabbit anti-GFAP (Abcam, #ab16997, 1:100), mouse anti-GFAP (Millipore, #MAB360, 1:500) rat anti-CD36 (Abcam, #ab80080, 1:100), mouse anti-TNF-α (Santa Cruz, #sc-52746, 1:100), rabbit anti-IL-1β (Abcam, #ab9722, 1 µg/ml), rabbit anti-cleaved caspase-3 (Cell Signaling Technology, #9662S, 1:300), mouse anti-NeuN (Millipore, #MAB377, 10 µg/ml). Images were obtained using a confocal microscope (Leica DMi8). Relative band intensity was normalized relative to actin using ImageJ software (NIH).
Thioflavin-S staining
For thioflavin-S(ThS) staining, the sliced brains were stained with filtered 1% aqueous Thioflavin-S solution for 8 min. The sections were then rinsed with 80%, 95% ethanol and three washes with distilled water. Afterward, brain slices were mounted and slides allowed to dry in the dark overnight. Images were taken on a Leica fluorescence microscope.
Preparation of Aβ1−42 fibrils
Aβ1−42 Hexafluoroisopropanal (HFIP) peptide (#AS-64129) was obtained from AnaSpec (Fremont, Ca, USA). Aβ 1 − 42 fibrils (fAβ) was prepared as described previously [27]. To form fAβ synthetic human Aβ1−42, Aβ1−42. HFIP peptide was dissolved in DMSO to a stock concentration of 5 mM. Stocks were then diluted to 100µM in serum free DMEM and incubated at 37℃ for 24 h. Fibrillar Aβ (fAβ) were confirmed by SDS-PAGE.
In vitro phagocytosis assays (ELISA and immunocytochemistry)
BV2 microglial cells (2 × 105) were plated in 6-well plates overnight. Cells were transfected using a TransIT-X2® Transfection Reagent (Mirus Bio, Cat#MIR6000) according to the manufacturer`s instructions and treated with fAβ for 4 h at a final concentration of 1µM. In some case anti-CD36 was applied to the media with fAβ. After 4 h, media was collected from BV2 microglia. Levels of human Aβ (1–42) in supernatant were measured by the human Aβ42 ELISA kit (Invitrogen, Cat#KHB3441), according to the manufacturer`s instructions.
In addition, glial phagocytosis was verified by fluorescence microscope. Coverslips were coated with poly-l-lysine before plating 8 × 104 primary glial cells per coverslip resting in wells of a 24-well plate overnight. Primary glial cells were transfected using TransIT-X2® Transfection Reagent (Mirus Bio) according to the manufacturer`s instructions and incubated in unlabeled fAβ for 4 h at a final concentration of 1µM. After 4 h, the cells were washed with cold PBS. For Aβ uptake measurement, primary glial cells were then fixed with 100% methanol for 1 h at -20℃, washed with PBS-T and incubated at 4 °C with mouse anti-β-Amyloid 1–16, rabbit anti-GFAP (abcam, #ab16997, 1:100) and rabbit anti-Iba-1 (Wako, #019-19741, 2 µg/ml).
FACS analysis
All staining steps were performed in the dark and blocked with BD Fc Block. Primary glial cells were stained using the following antibodies: Alexa 488-conjugated anti-mouse CD36 (Biolegend, Cat#102607, 5 µg/ml) or isotype control Ab (Biolegend, Cat#400923, 5 µg/ml) for 30 min at 4 °C. After 30 min, cells were washed with FACS buffer (PBS + 1%). Data were analysed with CellQuest (BD Bioscience) and FlowJo software (Treestar) packages.
Real time PCR
Total RNA was isolated using the Isolation of small and large RNA kit (Macherey Nagel, Dfiren). cDNA was synthesized using miScript II RT Kit (Qiagen, Hilden, Germany). For analysis the expression of miR-485-3p was performed by TaqMan miRNA analysis using TOPreal™ qPCR 2X PreMIX (Enzynomics, Korea) on CFX connect system (Bio-Rad). The real-time PCR measurement of individual cDNAs was performed using SYBR green and Taq man probe to measure duplex DNA formation with the Bio-Rad real-time PCR system. Primers were as follows: Probe: FAM-CGAGGTCGACTTCCTAGA-NFQ. miR-485-3p forward: 5’-CATACACGGCTCTCCTCTCTAAA-3’; Mouse primer: Actin forward: 5`-TCCTGTGGCATCCATGAAAC-3′, reverse: 5′-CAATGCCTGGGTACATGGTG-3′; TNF forward: 5′-CCAAGTGGAGGAGCAGCT-3′, reverse: 5′-GACAAGGTACAACCCATCGG-3′; IL-1β forward: 5′-TTCGACACATGGGATAACGAGG-3′, reverse: 5′-TTTTTGCTGTGAGTCCCGGAG-3′; miR-16 forward: 5’-CAGCCTAGCAGCACGTAAAT-3’; reverse: 5’-GAATCGAGCACCAGTTACG-3’; miR-16 level was used for normalization. The relative gene expression was analyzed by the 2-∆∆ct method.
Behaviour tests (Y-maze and passive avoidance)
The Y-maze consisted of three black, opaque, plastic arms (30 cm × 8 cm × 15 cm) 120° from each other. The 5XFAD mice were placed in the center and were allowed to explore all three arms. The number of arm entries and number of trials (a shift is 10 cm from the center, entries into three separate arms) were recorded to calculate the percentage of alternation. An entry was defined as all three appendages entering a Y-maze arm. Alternation behavior was defined as the number of triads divided by the number of arm entries minus 2 and multiplied by 100. The passive avoidance chamber was divided into a white (light) and a black (dark) compartment (41 cm × 21 cm × 30 cm). The light compartment contained a 60W electric lamp. The floor (of the dark) department contained a number of (2-mm) stainless steel rods spaced 5 mm apart. The test was done for 3 days. The first day adapts the mouse for 5 minutes in a bright zone. The second day is the training phase. The study consists of two steps. The first step places each mouse in the light zone which is then moved to the dark zone twice. One hour after the first step, each mouse is placed in the light compartment. The door separating the two compartments was opened 30 seconds later and after mice enter the dark compartment, the door was closed and an electrical foot shock (0.3 mA/10 g) was delivered through the grid floor for 3 seconds. If the mouse does not go into the dark zone for more than 5 minutes, it is considered to have learned avoidance, and the training was done up to 5 times. Twenty-four hours after the training trial, mice were placed in the light chamber for testing. Latency was defined as the time it took for a mouse to enter the dark chamber after the door separating the two compartments opened. The time taken for the mouse to enter the dark zone and exit to the bright zone was defined as TDC (time spent in the dark compartment).
Data analysis
All data are presented as the mean ± SD. NGS data were analyzed using R (version 3.5.2). Statistical significance in the values obtained for two different groups were determined using unpaired t-test. Statistical tests were performed using GraphPad Prism 5 (GraphPad Software, La Jolla, CA). Behavior tests were assessed by nonparametric statistical procedures.