Uncovering the molecular mechanisms of Salidroside against diabetic retinopathy using network pharmacology and experimental validation

doi:10.21203/rs.3.rs-2192469/v1

Download PDF

Research Article

Uncovering the molecular mechanisms of Salidroside against diabetic retinopathy using network pharmacology and experimental validation

https://doi.org/10.21203/rs.3.rs-2192469/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Objective

The present study was designed to explore the mechanism underlying the therapeutic effects of Salidroside in the treatment of diabetic retinopathy (DR) through network pharmacology analysis combined with in vivo experimental verification.

Methods

Diabetic rat models were established and treated with Salidroside. Optical coherence tomography (OCT) was employed to demonstrate the changes of retina with treatment or not. The drug targets of SAL and disease targets of DR were obtained from public databases. Venn diagrams were generated online to obtain the common targets of SAL and DR, which were then imported into String for protein-protein interaction (PPI) network generation Meanwhile, these common targets were analyzed using Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis to further elucidate their biological functions. Finally, gene-pathway networks were established to capture core pathways that common targets were enriched in. Molecular docking predicts the binding degree between drugs and proteins, and the expression levels of key genes are verified by real-time quantitative polymerase chain reaction (RT-qPCR) in vivo.

Results

OCT imaging demonstrated that Salidroside administration significantly increased retinal thickness and significantly reduce the number of new blood vessels in fundus images in diabetic rats. We obtained 87 common targets after intersecting the targets of Salidroside and DR, and PPI network screened out 7 core targets, including GAPDH, CASP3, VEGFA, HRAS, HIF1A, MTOR and MMP9. The functional annotation of target genes demonstrated they were enriched in such biological processes as cellular response to oxidative stress, epithelial cell proliferation, and response to reactive oxygen species, along with significantly enriched pathways like HIF-1 signaling pathway, AGE-RAGE signaling pathway in diabetic complications, Type II diabetes mellitus, and VEGF signaling pathway. Molecular docking prediction results indicated that Salidroside was stably bound to these core targets. Importantly, mRNA levels of core targets in diabetic rats were differentially expressed before and after Salidroside treatment.

Conclusions

Collectively, our work demonstrated Salidroside could protect the retina from diabetes-induced damage, and preliminarily uncovered that Salidroside might exert therapeutic efficacy in DR through a multi-target and multi-pathway approach.

Salidroside

Diabetic retinopathy

therapeutic efficacy

Core targets

multi-target and multi-pathway

As a global epidemic with a high incidence, diabetes mellitus leads to a range of complications, including macrovascular complications such as cardiovascular disease and stroke, and microvascular complications including renal and retinal disease. Diabetic retinopathy (DR) is the most frequent complication of diabetes and remains the leading cause of preventable blindness in the working-age population in developed countries(Wong, et al., 2016). Patients with severe DR experience endure low quality of life with vulnerable physical and emotional condition (Wong, et al., 2016). Since DR is the most common complication of diabetes and is estimated to increase from 415 million in 2015 to 642 million by 2040, it will become an even more serious problem in the future. Currently, the treatment of DR is also keeping a big challenge both biologically and clinically.

Traditional Chinese medicine (TCM) has been playing an important role in the improvement of life quality and curing disease. In recent years, much attention has been focused on the Chinese herb medicine for the treatment of diabetes and metabolic syndrome. Salidroside (SAL, molecular formula: C14H20O7, molecular weight: 300.12), derived from the dried roots and rhizomes of Rhodiola, prevents tumor growth, enhances immune function, and delays senescence with resistance to fatigue, antioxidation, and radiation (Tang, et al., 2016; Zhu, et al., 2016). In addition, SAL can exert hypoglycemic effects and has protective effects on vascular function in Diabetes mellitus (Ma, et al., 2017). Shi et al demonstrated that salidroside could protect retinal endothelial cells against hydrogen peroxide induced damage by regulating oxidative stress and apoptosis (Shi, et al., 2015).Wang et al found that SAL alleviated high glucose induced oxidative stress and extracellular matrix accumulation in rat mesangial cells (Wang, et al., 2017).However, to the best of our knowledge, the network mechanism of SAL on DR has not been well investigated.

Network pharmacology emphasizes the multichannel regulation of signal pathways, improves the therapeutic effect of drugs, reduces toxic side effects, thereby increasing the success rate of clinical trials of new drugs and saving drug development costs(Liu and Sun, 2012). In this paper, we used network pharmacology technology combined with animal experimental verification to understand the potential mechanism of SAL in diabetic retinopathy, so as to provide a basis knowledge for clinical use of SAL in the treatment of DR, The highlights and flow of this study are shown in Fig. 1.

Animals model

Thirty male SPF Sprague-Dawley (SD) rats (200–220 g, 8-week-old) were purchased from the Laboratory Animal Center of Kunming Medical University, license number: SCXK (Dian) k2020-0004. The rats were randomly divided into control group, DM group, Sal group, 10 in each group. The animals were housed in a constant temperature environment with a regular 12-h light/dark cycle and provided with standard chow and water ad libitum. DM model was induced in SD rats by a single intraperitoneal injection of streptozotocin (STZ) (65 mg/kg, Merck reagents, lot v900890) prepared in citrate buffer (pH 4.5). The control group was injected with equivalent volume of citrate buffer only. After 72 hours, the blood glucose of the tail vein of the STZ-injected rats was measured, and the rats with blood glucose values > 16.7 mmol/L were considered to have diabetes, and the rats with blood glucose values < 16.7 mmol/L were excluded and not considered into the following study. All the experimental procedures were carried out in accordance with the National Institutes of Health Guidelines for the Care and Use of Laboratory Animals.

Drug Treatment

Streptozotocin was purchased from. Salidroside was purchased from Macklin reagent company (lot No. 201424), which was prepared into salidroside solution with normal saline, and the diabetic rats were treated by gavage at a dose of 100 mg/(kg•d). The rats in the control group and the diabetic group were given the same dose of normal saline. Three months later, the rats were anesthetized with isoflurane and then sacrificed. After perfusion with normal saline, scissors were inserted into the eye sockets to cut off the optic nerve, and the removed eyeballs were placed in the prepared normal saline, snap frozen in liquid nitrogen and stored at -80°C.

Obtaining Potential Targets Of Salidroside

The two-dimensional molecular structure of salidroside was obtained from PubChem (https://pubchem.ncbi.nlm.nih.gov/) (Liu X, et al., 2010), the largest free database of chemical information in the world. Firstly, the targets of salidroside were predicted in Genecards (https://www.genecards.org/). Meanwhile, the two-dimensional molecules of salidroside were uploaded into Swiss Target Prediction database (http://www.swisstargetprediction.ch/) as well as into TCMSP database (https://tcmsp-e.com/) respectively for target prediction, with species defined as "Homo sapiens". Additionally, Uniprot protein database (https://www.uniprot.org/) (UniProt C, 2021) was used to retrieve the predicted targets, and the protein targets and genes of salidroside were standardized and integrated.

Screening Of Potential Targets For DR

The target genes for DR in this study were collected from 2 databases. The first database is Gene Cards(https://www.genecards.org/), as a database that contains a lot of genes, such as genome, transcriptome, proteome and genetics, as well as clinical and functional information from 150 web sources. The other database is the Online Mendelian Inheritance in Man (OMIM) database (http://www.omim.org/).

Intersection Of Sal And DR Targets

Salidroside potential targets and diabetic retinopathy were put into the Venny 2.1 platform (https://bioinfogp.cnb.csic.es/tools/venny/).A Venn diagram was drawn to visualize the overlapping target genes associated with salidroside and diabetic retinopathy. Gene information, including the gene name and the gene ID, was confirmed by the BIOGRID-Human database (https://downloads.thebiogrid.org/BioGRID), and protein names by the Uniport database (https://www.uniprot.org).

Target Gene Ppi Protein Interaction Network Construction

The intersections of SAL–DR related genes were imported into the STRING database (https://string-db.org/) medium retrieval, which is a database that can predict known protein inter-actions. Set the protein species as " Homo sapiens ", and the minimum interaction threshold was 0.4. Set the confidence score as a threshold so that only relationships greater than this score are included in the protein network. The acquired target interaction network relationship data were imported into cytoscape3.8.2 software, and a protein interaction network diagram was drawn. Network topology analysis was performed using the "network analysis "plugin, an inbuilt tool of Cytoscape, to obtain network topological parameters of the targets, including degree of connectivity (degree). The median number of target genes with ≥ 3-fold connectivity was selected as the key target.

Salidroside-diabetic Retinopathy Gene Function And Pathway Enrichment Analysis

Biological function and main signaling pathway analysis of the common targets of salidroside diabetic retinopathy were performed by go function and KEGG pathway enrichment analysis of key target genes with P < 0.05, Q < 0.05 based on the Bioconductor bioinformatics package in R4.1.0, and the results were exported as bar or bubble plots.

Molecular Docking Validation

We entered salidroside into the PubChem database(https://pubchem.ncbi.nlm.nih.gov) with "salidroside " as the search term to obtain the 2D structure of salidroside, the core targets proteins were imported into the PDB database(https://www.rcsb.org), to select the appropriate protein 3D structure. The protein structures were dewatered with Pymol software (Version 2.5), and the ligands were separated to obtain pure protein. The 2D structure of salidroside was imported into Pymol software for "check totals on residues", "detect root", and "choose torsions". Active sites for molecular docking were determined by using the target protein as the receptor and the salidroside as the ligand according to the coordinates of the ligand in the complex of the target protein, the coordinates and size of Gridbox were set according to the active pocket of the target protein. Autodock software was used for molecular docking, and select "local search parameters" when setting the algorithm .When the free binding energy is less than 0 in the results, it indicates that the structure conformation is meaningful, and it be considered that salidroside can bind to protein macromolecules. The binding conformation with the lowest absolute value of free binding energy was selected and visualized with Pymol software.

Relative Mrna Expression Was Validated In Diabetic Rat Model

The diabetic model was established by intraperitoneal injection of streptozotocin, 3 months after each group of rats were perfused with saline to remove retinas, and total RNA was extracted with Trizol reagent (Thermo Fisher) and reverse transcribed using the one-step RT-PCR Kit (Thermo Fisher) according to instructions. Quantification of gene expression was performed using the ABI prism 7500 sequence detection system (Applied Biosystems, Foster City, CA) and SYBR Green (transgene Biotechnology Co., Ltd, China). mRNA levels from each independently prepared RNA were determined by RT-PCR in triplicate and normalized to expression levels of β-actin, and the relative quantification was calculated by using the 2^−ΔΔCt method. The sequences utilized in RT-qPCR were as followed:

Table 1

Core gene primer sequence
Gene symbol	sequence
GAPDH	Fw	5'-CAAGTTCAACGGCACAGTCAA − 3
GAPDH	Rv	5'-TCTCGCTCCTGGAAGATGGT-3'
MTOR	Fw	5'- CTGAACAGTGAGCACAAGGAG − 3
	Rv	5'- CGCTGATGAGGTGGATGGA − 3’
VEGFA	Fw	5'- TTACTGCTGTACCTCCACCAT − 3'
	Rv	5'- CGTCCATGAACTTCACCACTT − 3'
MMP9	Fw	5'- CGACTCCAGTAGACAATCCTTG − 3'
	Rv	5'- ATACCGACCGTCCTTGAAGAA-3'
HIF1A	Fw	5'- GCCACCACCACTGATGAATC-3'
	Rv	5'- CCACTGTATGCTGATGCCTTAG-3'
CASP3	Fw	5'- TGCGGTATTGAGACAGACAGT − 3'
	Rv	5'- GCGGTAGAGTAAGCATACAGGA-3'
HRAS	Fw	5'-CCATCAACAACACCAAGTCCTT − 3'
	Rv	5'- CAGCACCATTGGCACATCAT − 3'

Optical Coherence Tomography

The rats were anesthetized by intraperitoneal injection of phenobarbital (0.9 mg/kg), and the pupils were locally dilated with compound tropicamide eye drops. To protect the cornea during and after surgery, ofloxacin eye drops are used. OCT images were recorded using a retinal imaging camera system (Heidelberg) before and 4 weeks after salidroside gavage. We uniformly select the same area of the rat retina to take pictures. Finally, the retinal thickness of OCT images was measured by ImageJ software.

Statistical analysis

Statistical analysis was performed using SPSS for Windows version 26.0, and the measurement data were analyzed by one way ANOVA, and the data were expressed as mean ± standard deviation (in terms of‾x ± s), with P < 0.05 taken as statistical significance.

The protective effect of SAL on DR retina

We verified the effect of SAL treatment on the retinal status of rats with DR by establishing an animal model of diabetes and by performing OCT tests on diabetic model rats in control, diabetic, and treated groups. As shown in the representative images, detailed retinal layer and fundus photographs were observed in all groups, and no significant malformations were shown in any diabetic rats (Fig. 2). However, the total retinal thickness of the diabetic model rats was significantly reduced compared with that of the control group, and the fundus vascular images of the diabetic model rats were blurrier as a result of vitreous opacity and corneal whiteness of the diabetic rats (Fig. 2A). Meanwhile, a large number of neovascularization appeared disorderly in the fundus of the diabetic rats, which were prominently decreased in the diabetic rats treated with Sal (Fig. 2A). Additionally, the thinner retinas with different degrees of cavities and cell loss in diabetic rats became thicker after Sal treatment than those in the diabetic group (Fig. 2B, C, p < 0.01).

Effects Of Sal On Blood Glucose In Diabetic Rats

The effect of SAL on blood glucose in diabetic rats was confirmed by regular monitoring of blood glucose levels in diabetic rats and sal treated diabetic rats and comparison with the control group. As revealed, the fasting blood glucose levels of rats in DM group and treatment group were much higher (> 16.7 mmol/L) than that of control group at the 6th week prior to Sal treatment (Fig. 3, p < 0.01). There was no significant change in blood glucose of rats in control group along with the time of treatment. After Sal treatment, blood glucose levels decreased a lot within the later 4 weeks, which were significantly lower than that of DM group (Fig. 3, p < 0.01).

Targets Prediction Of Sal And Dr

A total of 16 potential targets corresponding to Sal were screened from GeneCards database, 7 corresponding Sal targets were identified from TCMSP, and 106 potential Sal targets were predicted by using Swiss Target Prediction. After data deduplication, 127 potential targets were retained (Suppl. Table 1). In addition, we integrated disease targets from GeneCards, OMIM databases, with 4079 genes identified in GeneCards, 230 genes predicted in OMIM. Together, 4296 disease targets of DR were determined after integration and de-duplication (Suppl. Table 2). We matched 127 potential targets of Sal with 4296 DR target databases, intersecting 87 shared targets (Fig. 4A).

Core Targets Of Sal And Dr

The protein-protein interaction network was obtained (Fig. 4B), and the protein interaction network was imported into Cytoscape3.8.2 to construct a PPI relationship network diagram (Fig. 4D). Based on the protein nodes value of degree (Suppl.Table S3), the median number of connections of the available PPI network was calculated to be 10, and targets with a degree of connectivity ≥ 30 (3-fold median) were selected for visualization, with a total of seven core targets (Fig. 4C) being GAPDH, VEGFA, CASP3, HIF1A, MTOR, HRAS, and MMP9. The 7 core therapeutic targets were imported into the String database, and their inter-action network was obtained (Fig. 4E).

Go And Kegg Enrichment Analysis

GO results demonstrated a total of 1156 terms of biological processes, 45 ones of cellular components, and 87 ones of molecular function (Suppl.Table S4). The top 10 bio-logical processes mainly included response to oxidative stress, cellular response to chemical stress, cellular response to oxidative stress,epithelial cell prolifertion,response to reactive oxygen species,positive regulation of epithelial cell migration, cellular response to abiotic stimulus,cellular response to environmental stimulus, regulation of reactive oxygen species metabolic process,cellular response to reactive oxygen species.Cellular components enriched by common targets mainly involved cytoplasmic vesicle lumen, vesicle lumen, secretory granule lumen, vacuolar lumen, ficolin-1-rich granule lumen, ficolin-1-rich granule, region of cytosol, presynaptic cytosol, cyclin-dependent protein kinase holoenzyme complex, postsynaptic cytosol. Meanwhile, the significantly enriched molecular functions were mainly carbonate dehydratase activity, metallopeptidase activity, metalloendopeptidase activity, hydrolase activity, acting on glycosyl bonds, endopeptidase activity, hydro-lyase activity, carbon-oxygen lyase activity, hydrolase activity, hydrolyzing O-glycosyl compounds, protein kinase C activity, calcium-dependent protein kinase C activity (Fig. 5A, C). Our results suggest that salidroside may play a therapeutic role in diabetic retinopathy by participating in the regulation of multiple biological processes that are closely associated with the development and progression of diabetic retinopathy. KEGG pathway enrichment analysis common targets yielded 117 KEGG pathways (Suppl.Table S5). The top 20 ranked results were formed into a bubble plot of KEGG functional enrichment according to p value (Fig. 5B, D).

Molecular Docking Results

Salidroside was docked against seven core targets, receptors for GAPDH (PDB ID: 2PKR), VEGFA (PDB ID: 1VPF), CASP3 (PDB ID: 3H0E), HIF1A (PDB ID:5LAS), MTOR (PDB ID: 4JSP), HRAS (PDB ID: 4XVR), MMP9 (PDB ID: 5TH6), and the ligand is salidroside (PubChem CID:159278). The structural formula of salidroside is shown in Fig. 6H. The binding free energy can evaluate the binding ability between receptor and ligand, and when the binding energy is less than 0, it is considered that the ligand and receptor can bind freely, and the lower the binding free energy, the stronger the binding ability (Table 1). Our results showed that GAPDH, VEGFA, CASP3, HIF1A, MTOR, HRAS, and MMP9 could stably bind to salidroside (Fig. 6A-G), suggesting that the interaction between salidroside and the above targets may be one of the important mechanisms of salidroside treatment for DR, which deserves further experimental verification.

Table 1

Binding free energy of SAL docking with core targets
	Salidroside
Gene	GAPDH	VEGFA	CASP3	HIF1A	MMP9	HRAS	MTOR
free binding energy (kcal/mol)	-2.38	-0.68	-2.14	-3.11	-1.02	-1.77	-1.46

Validation On Salidroside Regulating Key Target Genes

RT-qPCR results showed that the expression levels of mTOR and HRAS in the DM group were higher than those in the normal group. In addition, the expressions of mTOR and HRAS in the retina of the rats in the salidroside treatment group were lower than those in the diabetic group, indicating that salidroside could significantly reduce the expressions of mTOR (P < 0.01) and HRAS (P < 0.05) in the diabetic group. The HIF1A gene expression in the retina of the diabetic rats was significantly higher than that of the normal group (p < 0.001), however, the HIF1A gene expression in the retina of the diabetic rats treated with salidroside was lower than that of the diabetic group (P < 0.001). The expression of MMP9 in the retina of the diabetic group was significantly higher than that of the normal group (p < 0.001), but the expression of MMP9 in the retina of the salidroside treatment group was significantly lower than that of the diabetic group (P < 0.001). The expression of VEGFA in the retina of the diabetic rats was significantly higher than that of the normal group (p < 0.001), but salidroside decreased the expression of VEGFA in the retina of the diabetic rats(P < 0.001). The expression of CASP3 in the retina of the diabetic rats was significantly higher than that of the normal group(p < 0.001), and the treatment with salidroside decreased the expression of CASP3 in the retina of the diabetic rats(p < 0.001). Surprisingly, there was no significant change in the expression of GAPDH in the retinas of rats in each group. (Fig. 7).

In this study, we built a diabetic animal model and confirmed the therapeutic effect of salidroside on diabetic rats by OCT. 87 overlapping genes between DR and SAL were screened by network pharmacology. We then constructed the PPI network of these genes and screened out the key genes in SAL for DR treatment. Through GO and KEGG enrichment analysis of 87 overlapping genes, the possible mechanism of SAL in treating DR was explored. Subsequently, the binding of SAL to key genes was predicted by mo-lecular docking and validated by in vivo experiments.

The Pharmacological Effects Of Salidroside

There is increasing evidence that salidroside has multiple pharmacological activities. For example, SAL protects TF-1 erythrocytes from H2O2 induced oxidative damage (Qian, et al., 2011), and protects from senescence in a D-galactose-induced senescence mouse model (Mao, et al., 2010). Furthermore, it has been suggested that salidroside protects the organism against oxidative stress and inhibits inflammatory responses, which is responsible, at least in part, for the anti-cancer effects of salidroside on cultured lung cancer A549 cells (Wang, et al., 2014), and to its protective effect on β-amyloid-induced cognitive deficits in rats (Zhang, et al., 2013).

In addition, salidroside has been suggested as a potential diabetes therapeutic because of its beneficial effects in rodent models of diabetes (Alameddine, et al., 2015; Wang, et al., 2017; Zheng, et al., 2015). Recently, we showed that salidroside treatment of hyperglycemia, hyperlipidemia, and diabetic proteinuria in diabetic db / db mice was through activation of AMPK related signaling pathways (Wang, et al., 2017; Wu, et al., 2016).Meanwhile, many researchers have suggested that the regulation of AMPK and its related signals by salidroside and salidroside may be responsible for their beneficial effects on glycolipid metabolism, oxidative stress response, and inflammatory response in diabetes and diabetic complications.

The results of the OCT experiment found that a large number of new blood vessels appeared in the fundus of the diabetic rats, and the retina was significantly thinner(Lai and Lo, 2013). The number of new blood vessels in the fundus of the diabetic rats treated with salidroside was significantly reduced, and the retinal thickness was significantly increased compared with the retina of the diabetic rats. These results suggest that salidroside can reduce the formation of new blood vessels in the fundus of diabetic rats and increase retinal thickness to protect retinal damage.

3.2 Core Target And Related Pathway Analysis

In this study, we show that the key core targets of salidroside involved in the treatment of diabetic retinopathy are GAPDH, CASP3, VEGFA, HRAS, HIF1A, MTOR, and MMP9. miR-27a is a noncoding RNA, and studies have shown that miR-27a upregulates the activation of PI3K / Akt signaling and glucose transporter 4 (GLUT4) expression at both protein and mRNA levels. MiR-27a is thought to be involved in PPAR-γ-PI3K / AKT-glut4 signaling axis, thereby leading to increased glucose uptake and decreased insulin resistance in high-fat diet fed mice and 3T3-L1 adipocytes. Therefore, miR-27a is a novel target for the treatment of insulin resistance in obesity and diabetes(Chen, et al., 2019).

A related study showed that arbutin alleviated the apoptosis and autophagy of high glucose treated HK-2 cells by regulating the miR-27a / JNK / mTOR axis (Lv, et al., 2019). Our results found that the level of Caspase-3 in the retina of diabetic rats was significantly higher than that of control rats, while the level of Caspase-3 in the retina of diabetic rats treated with salidroside was significantly lower than that of diabetic rats. CASP3 encodes a cysteine aspartic acid protease, and related studies have found that caspase-3 is abnormally expressed in the retinal tissue of patients with diabetic retinopathy and plays a key regulatory role in apoptosis, and the abnormally high expression of Caspase-3 is positively correlated with the severity of diabetic retinopathy, that is, the abnormally high expression level of Caspase-3 in diabetic retinopathy tissue increases the glucose the more severe the retinopathy of urinary disease(Tian, et al., 2019). This finding and the results we derived are consistent. Therefore, salidroside can inhibit retinal apoptosis in diabetic rats by reducing the level of Caspase-3, thereby achieving the purpose of protecting the retina. VEGF is a member of the PDGF/VEGF growth factor family. It encodes heparin-binding protein and exists as a homodimer connected by disulfide bonds. It is an effective mitogenic factor that can stimulate endothelial cell proliferation and migration and blood vessel formation during angiogenesis, embryonic development and angiogenesis. In-depth research on the mechanisms of diabetic retinopathy and other hypoxic retinal diseases shows that VEGF plays a major role in vascular leakage and retinal neovascularization in these diseases (Du, et al., 2003; Le, 2017). Our research results showed that the expression of VEGF in the retina of diabetic rats was abnormally increased, while the expression of VEGF in diabetic rats was significantly reduced after salidroside treatment, which was close to that of the control group. Therefore, salidroside may inhibit the expression of VEGF, prevent retinal vascular leakage and neovascularization in diabetic rats, thereby delaying the progression of retinopathy in diabetic rats. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is believed to provide a common link between hyperglycemia and the activation of some major pathways related to the onset of diabetic complications. In addition to inhibiting GAPDH, which plays a key role in glycolysis, it also helps to transfer upstream glycolysis intermediates to other pathways, leading to the formation of AGEs, the activation of protein kinase C (PKC), and hexose and poly Induction of the Alcohol Pathway (Brownlee, 2005). Related research results confirmed that the invasion of high glucose reduced the activity and abundance of GAPDH in retinal capillary cells, which is consistent with our research results. The translocation of this enzyme from the cytoplasm to the nucleus is easy, thereby increasing cell apoptosis. However, when GAPDH is overexpressed in retinal endothelial cells, the inhibition of GAPDH expression by high glucose, the translocation of GAPDH to the nucleus and apoptosis are all improved, and the activation of PKC and hexamine pathway upstream of GAPDH is also inhibited (Madsen-Bouterse, et al., 2010).

H-Ras, a member of small molecular weight GTPases, cycles between a guanosine triphosphate-bound active and a guanosine diphosphate-bound inactive state(Schubbert, et al., 2007). It acts as a ‘‘molecular switch,” converting signals from cell membrane to the nucleus(Esteban, et al., 2001). Post-translational modification of H-Ras activates it by increasing its hydrophobicity and translocating it from cytosol to the membrane(Stephens, et al., 2001). Previous research have shown that H-Ras activation is one of the important steps involved in the apoptosis of retinal endothelial cells and ultimately in the development of diabetic retinopathy. Further, H-Ras mediated apoptosis of retinal capillary cells is via its key effector protein, Raf-1, which is predominantly cytosolic(Kowluru, et al., 2004; Kowluru, et al., 2007). In our study, the results of protein network interaction analysis indicated that HRAS was a key gene for the treatment of diabetic retinopathy with salidroside. The results of QPCR showed that the expression level of gene HRAS in the retina of the diabetic rats was significantly higher than that of the normal group. However, the expression level of HRAS in the retina of the diabetic rats treated with salidroside was significantly decreased. We can think that salidroside can protect H-Ras mediated apoptosis of retinal capillary cells.

Diabetic environment activates several matrix metalloproteinases (MMPs) that are considered to participate in many of its complications, including retinopathy, nephropathy, and cardiomyopathy(Thrailkill, et al., 2009; Tyagi, et al., 2005). Diabetes-induced activation of MMP9 in the retina and its capillary cells is suggested to play a role in the pathogenesis of diabetic retinopathy (Das, et al., 1999; Giebel, et al., 2005). Relevant studies have shown that the activation of MMP9 in retinal capillary cells in hyperglycemic conditions is downstream of H-Ras, a small molecular weight guanine nucleotide-binding protein(Kowluru, 2010). H-Ras is normally activated in response to the binding of extracellular signals and transduces signals from cell surface receptors into the nucleus via activation of the Raf-1/ Mitogen-Activated Protein Kinase Kinase (MEK)/extracellular signal-regulated kinase (ERK)(Cox and Der, 2002; Schubbert, et al., 2007). Raf-1/MEK/ERK pathway is activated in the retina and its endothelial cells in diabetes, and this cascade acts as a pro-apoptotic stimulus in the pathogenesis of diabetic retinopathy(Kanwar and Kowluru, 2008; Kowluru and Kanwar, 2009; Kowluru and Odenbach, 2004). Relevant studies have shown that diabetes activates H-Ras and MMP9 in the retina and its capillary cells, and the activation is associated with the accelerated capillary cell apoptosis(Kowluru and Odenbach, 2004; Kowluru and Kowluru, 2007). In our study, MMP9 was a key regulatory gene of salidroside in the treatment of diabetic retinopathy. The results of QPCR showed that the level of MMP9 in the retina of the diabetic retinopathy group was significantly higher than that of the normal group, which was consistent with previous studies. The level of MMP9 in the retina of diabetic retinopathy rats treated with salidroside returned to normal, which was significantly lower than that of the diabetic group and close to that of the normal group. Therefore, salidroside inhibits the activation of Raf-1/MEK/ERK pathway and protects retinal cell apoptosis by reducing the level of MMP9 in the retina of patients with diabetic retinopathy. MTOR signaling plays diverse roles in the pathogenesis of diabetes and its complications, including retinopathy. Sustained hyperactivation of mTORC1 leads to pancreatic β Cell failure and peripheral insulin resistance, contributing to the progression of type 2 diabetes mellitus (T2 DM) pathology (Laplante and Sabatini, 2012).The role of MTOR in the pathological process of DR is likely multifactorial and may include its role in immune function, endothelial cell proliferation, VEGF signaling, and autophagy regulation. Our findings showed that the expression level of mTOR in the retina of diabetic rats was significantly higher than that of the normal group, which also validated the previous findings. However, the expression level of MTOR in the retina of diabetic rats treated with salidroside decreased, compared with the diabetic rats. Therefore, salidroside may protect retinal cells by regulating autophagy.

Hypoxia inducible factor-1 (HIF-1) as an important endogenous signaling protein contributes to physiologic changes of homoeostasis under conditions of oxygen deprivation(Wang, et al., 1995). Additionally, one of the important protein molecules responsible for the neovascularization is vascular endothelial growth factor (VEGF), which resulted from increased HIF-1aformation due to ischaemic hypoxia in the retina of diabetic animals and humans(Catrina, 2014; Ling, et al., 2013; Wang, et al., 2009). A recent study further suggests a strong correlation between the serum levels of HIF-1ain patients and development of DR(Sayed and Mahmoud, 2016). Our study shows that HIF1A is a key gene for the treatment of diabetic retinopathy with salidroside, and the occurrence of diabetic retinopathy is closely related to the increase of HIF1A expression level, and this change is reversed by salidroside treatment. And we can also think that the regulation of VEGFA by salidroside is achieved by affecting HIF1A.

In conclusion, this study investigated the complex network relationship of salidroside in the multi-target and multi-pathway treatment of DR by applying several network pharmacology-based bioinformatics tools. Based on these findings, we speculate that salidroside may treat DR mainly through biological processes such as autophagy that counteract oxidative stress, inflammatory response and apoptosis, and the pathways involved mainly include PI3K Akt signaling pathway, MAPK signaling pathway, HIF − 1 signaling path-way, Ras signaling pathway, which may provide further basis for subsequent experimental studies to reveal the molecular mechanism of salidroside in the treatment of diabetic retinopathy.

In conclusion, by using network pharmacology analysis and animal experiments, we confirmed that salidroside can effectively treat diabetic retinopathy, and predicted the molecular mechanism of salidroside in the treatment of diabetic retinopathy. The mechanism of salidroside in the treatment of diabetic retinopathy provides another strategy.

Ethics approval and consent to participate

All animal experiments were approved by the Ethical Review Committee on animal experimentation of Kunming Medical University with approval number: kmmu20220889, and all animal experiments were performed under the guidance of professional laboratory animal practitioners. The methods used in the animal experiments we present are all in accordance with the arrive guidelines standards.

Availability of data and materials

All data generated or analyzed during this study are included in this published article and are available on request to the corresponding authors.

The data used in this study are available at the following links: TCMSP: https://tcmsp-e.com/; Genecard: https://www.genecards.org/; SwissTargetPrediction:

http://www.swisstargetprediction.ch/; OMIM: https://omim.org/; STRING database: https://string-db.org/; Venny2.1: https://bioinfogp.cnb.csic.es/tools/venny/index.html;

PubChem: https://pubchem.ncbi.nlm.nih.gov; PDB: https://www.rcsb.org

Consent for publication

Not applicable.

Conflicts of Interest

The authors declare that they have no conflicts of interest.

Authors ' Contributions

Xuezheng Liu and Zhongfu, Zuo proposed the idea and designed this study. Cong Fu and Ying Huang carried out all experiments required in the study. Wen-qiang Liu and Yufei Wang participated in data analysis, and Pan Lv and Lipan Zhao wrote and improved the manuscript. Yang Hou and Lu Meng carried out literature survey. Ting-Hua Wang supervise experiment execution. All authors read and ap-proved the final manuscript.

Funding

This work was supported by Natural Science Foundations of Liaoning Province (No. 2019-ZD-0807, 20180550197).

Acknowledgments

Not applicable

Alameddine, A., et al. The cardiovascular effects of salidroside in the Goto-Kakizaki diabetic rat model. Journal of physiology and pharmacology : an official journal of the Polish Physiological Society 2015;66(2):249-257.
Brownlee, M. The pathobiology of diabetic complications: a unifying mechanism. Diabetes 2005;54(6):1615-1625.
Catrina, S.B. Impaired hypoxia-inducible factor (HIF) regulation by hyperglycemia. Journal of molecular medicine (Berlin, Germany) 2014;92(10):1025-1034.
Chen, T., et al. MiR-27a promotes insulin resistance and mediates glucose metabolism by targeting PPAR-γ-mediated PI3K/AKT signaling. Aging 2019;11(18):7510-7524.
Cox, A.D. and Der, C.J. Ras family signaling: therapeutic targeting. Cancer biology & therapy 2002;1(6):599-606.
Das, A., et al. Retinal neovascularization is suppressed with a matrix metalloproteinase inhibitor. Archives of ophthalmology (Chicago, Ill. : 1960) 1999;117(4):498-503.
Du, X., et al. Inhibition of GAPDH activity by poly(ADP-ribose) polymerase activates three major pathways of hyperglycemic damage in endothelial cells. The Journal of clinical investigation 2003;112(7):1049-1057.
Esteban, L.M., et al. Targeted genomic disruption of H-ras and N-ras, individually or in combination, reveals the dispensability of both loci for mouse growth and development. Molecular and cellular biology 2001;21(5):1444-1452.
Giebel, S.J., et al. Matrix metalloproteinases in early diabetic retinopathy and their role in alteration of the blood-retinal barrier. Laboratory investigation; a journal of technical methods and pathology 2005;85(5):597-607.
Kanwar, M. and Kowluru, R.A. Diabetes regulates small molecular weight G-protein, H-Ras, in the microvasculature of the retina: implication in the development of retinopathy. Microvascular research 2008;76(3):189-193.
Kowluru, R.A. Role of matrix metalloproteinase-9 in the development of diabetic retinopathy and its regulation by H-Ras. Investigative ophthalmology & visual science 2010;51(8):4320-4326.
Kowluru, R.A. and Kanwar, M. Translocation of H-Ras and its implications in the development of diabetic retinopathy. Biochemical and biophysical research communications 2009;387(3):461-466.
Kowluru, R.A., et al. Potential contributory role of H-Ras, a small G-protein, in the development of retinopathy in diabetic rats. Diabetes 2004;53(3):775-783.
Kowluru, R.A., Kowluru, A. and Kanwar, M. Small molecular weight G-protein, H-Ras, and retinal endothelial cell apoptosis in diabetes. Molecular and cellular biochemistry 2007;296(1-2):69-76.
Kowluru, R.A. and Odenbach, S. Role of interleukin-1beta in the pathogenesis of diabetic retinopathy. The British journal of ophthalmology 2004;88(10):1343-1347.
Kowluru, V. and Kowluru, R.A. Increased oxidative stress in diabetes regulates activation of a small molecular weight G-protein, H-Ras, in the retina. Molecular vision 2007;13:602-610.
Lai, A.K. and Lo, A.C. Animal models of diabetic retinopathy: summary and comparison. Journal of diabetes research 2013;2013:106594.
Laplante, M. and Sabatini, D.M. mTOR signaling in growth control and disease. Cell 2012;149(2):274-293.
Le, Y.Z. VEGF production and signaling in Müller glia are critical to modulating vascular function and neuronal integrity in diabetic retinopathy and hypoxic retinal vascular diseases. Vision research 2017;139:108-114.
Ling, S., et al. MicroRNA-dependent cross-talk between VEGF and HIF1α in the diabetic retina. Cellular signalling 2013;25(12):2840-2847.
Liu, Z.H. and Sun, X.B. [Network pharmacology: new opportunity for the modernization of traditional Chinese medicine]. Yao xue xue bao = Acta pharmaceutica Sinica 2012;47(6):696-703.
Lv, L., et al. Arbutin protects HK-2 cells against high glucose-induced apoptosis and autophagy by up-regulating microRNA-27a. Artificial cells, nanomedicine, and biotechnology 2019;47(1):2940-2947.
Ma, Y.G., et al. Salidroside improved cerebrovascular vasodilation in streptozotocin-induced diabetic rats through restoring the function of BK(Ca) channel in smooth muscle cells. Cell and tissue research 2017;370(3):365-377.
Madsen-Bouterse, S., Mohammad, G. and Kowluru, R.A. Glyceraldehyde-3-phosphate dehydrogenase in retinal microvasculature: implications for the development and progression of diabetic retinopathy. Investigative ophthalmology & visual science 2010;51(3):1765-1772.
Mao, G.X., et al. Protective role of salidroside against aging in a mouse model induced by D-galactose. Biomedical and environmental sciences : BES 2010;23(2):161-166.
Qian, E.W., Ge, D.T. and Kong, S.K. Salidroside promotes erythropoiesis and protects erythroblasts against oxidative stress by up-regulating glutathione peroxidase and thioredoxin. Journal of ethnopharmacology 2011;133(2):308-314.
Sayed, K.M. and Mahmoud, A.A. Heat shock protein-70 and hypoxia inducible factor-1α in type 2 diabetes mellitus patients complicated with retinopathy. Acta ophthalmologica 2016;94(5):e361-366.
Schubbert, S., Bollag, G. and Shannon, K. Deregulated Ras signaling in developmental disorders: new tricks for an old dog. Current opinion in genetics & development 2007;17(1):15-22.
Shi, K., et al. Salidroside protects retinal endothelial cells against hydrogen peroxide-induced injury via modulating oxidative status and apoptosis. Bioscience, biotechnology, and biochemistry 2015;79(9):1406-1413.
Stephens, E., et al. Fetal hyperinsulinemia increases farnesylation of p21 Ras in fetal tissues. American journal of physiology. Endocrinology and metabolism 2001;281(2):E217-223.
Tang, H., et al. Salidroside protects against bleomycin-induced pulmonary fibrosis: activation of Nrf2-antioxidant signaling, and inhibition of NF-κB and TGF-β1/Smad-2/-3 pathways. Cell stress & chaperones 2016;21(2):239-249.
Thrailkill, K.M., Clay Bunn, R. and Fowlkes, J.L. Matrix metalloproteinases: their potential role in the pathogenesis of diabetic nephropathy. Endocrine 2009;35(1):1-10.
Tian, M., et al. Correlations of the severity of diabetic retinopathy with EPO, Caspase-3 expression and oxidative stress. European review for medical and pharmacological sciences 2019;23(22):9707-9713.
Tyagi, S.C., et al. Hyperhomocysteinemic diabetic cardiomyopathy: oxidative stress, remodeling, and endothelial-myocyte uncoupling. Journal of cardiovascular pharmacology and therapeutics 2005;10(1):1-10.
Wang, G.L., et al. Hypoxia-inducible factor 1 is a basic-helix-loop-helix-PAS heterodimer regulated by cellular O2 tension. Proceedings of the National Academy of Sciences of the United States of America 1995;92(12):5510-5514.
Wang, J., et al. Anticancer effect of salidroside on A549 lung cancer cells through inhibition of oxidative stress and phospho-p38 expression. Oncology letters 2014;7(4):1159-1164.
Wang, S., et al. Salidroside alleviates high glucose-induced oxidative stress and extracellular matrix accumulation in rat glomerular mesangial cells by the TXNIP-NLRP3 inflammasome pathway. Chemico-biological interactions 2017;278:48-53.
Wang, X., Wang, G. and Wang, Y. Intravitreous vascular endothelial growth factor and hypoxia-inducible factor 1a in patients with proliferative diabetic retinopathy. American journal of ophthalmology 2009;148(6):883-889.
Wong, T.Y., et al. Diabetic retinopathy. Nature reviews. Disease primers 2016;2:16012.
Wu, D., et al. A novel mechanism of action for salidroside to alleviate diabetic albuminuria: effects on albumin transcytosis across glomerular endothelial cells. American journal of physiology. Endocrinology and metabolism 2016;310(3):E225-237.
Zhang, J., et al. Salidroside attenuates beta amyloid-induced cognitive deficits via modulating oxidative stress and inflammatory mediators in rat hippocampus. Behavioural brain research 2013;244:70-81.
Zheng, T., et al. Salidroside ameliorates insulin resistance through activation of a mitochondria-associated AMPK/PI3K/Akt/GSK3β pathway. British journal of pharmacology 2015;172(13):3284-3301.
Zhu, L., et al. Salidroside ameliorates arthritis-induced brain cognition deficits by regulating Rho/ROCK/NF-κB pathway. Neuropharmacology 2016;103:134-142.

No competing interests reported.

TableS1.xlsx
Table S1:127 related targets were obtained and screened from TCMSP, SwissTargetPrediction, Genecard.
TableS2.xlsx
Table S2:4296 diabetic retinopathy related targets were obtained from Genecard, OMIM database.
TableS3.xlsx
Table S3: Degree value of each node in PPI network.
TableS4.xlsx
Table S4: the results of Go functional enrichment.
TableS5.xlsx
Table S5: the results of KEGG pathway Enrichment.

Download PDF

Version 1

posted

You are reading this latest preprint version

Uncovering the molecular mechanisms of Salidroside against diabetic retinopathy using network pharmacology and experimental validation

Status:

Version 1

Abstract

Objective

Methods

Results

Conclusions

Figures

Background

Methods

Animals model

Drug Treatment

Obtaining Potential Targets Of Salidroside

Screening Of Potential Targets For DR

Intersection Of Sal And DR Targets

Target Gene Ppi Protein Interaction Network Construction

Salidroside-diabetic Retinopathy Gene Function And Pathway Enrichment Analysis

Molecular Docking Validation

Relative Mrna Expression Was Validated In Diabetic Rat Model

Optical Coherence Tomography

Statistical analysis

Results

The protective effect of SAL on DR retina

Effects Of Sal On Blood Glucose In Diabetic Rats

Targets Prediction Of Sal And Dr

Core Targets Of Sal And Dr

Go And Kegg Enrichment Analysis

Molecular Docking Results

Validation On Salidroside Regulating Key Target Genes

Discussion

The Pharmacological Effects Of Salidroside

3.2 Core Target And Related Pathway Analysis

Conclusions

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1