Constructs and viral vectors
Constructs used were: pMD2.G (Addgene, Cat# 12259, USA), psPAX2 (Addgene, Cat# 12260, USA), pHAGE-BRAFV600E plasmid (Addgene, Cat# 116204, USA), pHAGE-BRAFWT plasmid (Addgene, Cat# 116719, USA), pBabe-Puro-BRAFV600E plasmid (Addgene, Cat# 15269, USA) , gag/pol-Retroviral plasmid (Addgene, Cat# 14887, USA), Control siRNA (Cell Signaling Technology, Cat# 6568S, USA), SAPK/JNK siRNA (Cell Signaling Technology, Cat# 6232S, USA), ERK1 siRNA (Cell Signaling Technology, Cat# 6436S, USA), ERK2 siRNA (Cell Signaling Technology, Cat# 6578S, USA).
Lentiviral particles were produced by transducing HEK293T cells with MD2.G envelope plasmid (Addgene), psPAX2-LV package plasmid (Addgene) and Lipofectamine 2000 Transduction Reagent (Thermo Fisher Scientific, USA).
Retroviral particles were produced by transducing HEK293T cells with the pBabe-Puro-BRAF-V600E plasmid (Addgene), the packaging plasmid gag/pol-Retroviral (Addgene), and the envelope plasmid MD2.G using Lipofectamine 2000.
Microglial cell line BV2 cells
BV2 cells (ATCC, Cat# CRL-2467, USA) were cultured with high-glucose DMEM (Gibco) containing 10% FBS (Gibco) and high glucose DMEM/F-12 (Gibco) containing 10% FBS at 37°C in 5% CO2 under constant temperature and humidity. After transduction with BRAFV600E, BRAFWT, and vector lentivirus, respectively, for 24 h, cells were cultured for 24 h in DMEM/F12 without FBS, and then medium and cells were collected for subsequent experiments.
Human neuroblastoma cell line SH-SY5Y cells
SH-SY5Y cells (ATCC, Cat# CRL-2266, USA) were seeded at 80% density, the medium was changed to DMEM/F12 supplemented with 1% FBS and 10 mM retinoic acid (Sigma, USA) for differentiation for 3 days [17]. The medium was then replaced with conditioned medium from BV2 cells transduced with different vectors for 24 h. Cells were then collected at different time points for subsequent experiments.
Primary cortical mixed culture
Primary cortical mixed culture was prepared from C57BL/6J mice embryonic day 17. To obtain cortical culture, pregnant mice (the Jackson Laboratory) were anesthetized, embryos were dissected, and cortex was collected in PBS on ice. Tissue was incubated in 0.25% trypsin–EDTA (Gibco) at 37°C for 15 min. Trypsinized tissue was transferred into high-glucose DMEM/F12 medium supplemented with 10% FBS. After centrifugation (1000×g, 5 min), the pellet was resuspended [17,18]. Cells were plated onto poly(L-lysine)-coated 24-well plates at 106 cells per well and cultured in NB-A (Gibco). Cortical mixed cells were cultured for 5 days, then transduced with lentivirus (LV) vectors or retrovirus (RV) vectors for 24 h, and then cultured in NB-A medium for 96 h.
Primary cortical neuronal culture
Primary cortical neurons were prepared from C57BL/6J mice embryonic day 17. The dissected cortical tissue was digested, triturated and centrifuged as for cortical mixed culture. Cells were plated onto poly (L-lysine)-coated 24-well plates at 106 cells per well and cultured in NB-A with 2% B27 (Invitrogen, USA). After 24 h in culture, 5ug/ml cytarabine was added to inhibit the growth of glial cells in the medium, and then changed to the original medium 48 h later. Neurons were cultured for 5 days, and then transduced with BRAFV600E, or BRAFWT, or vector lentivirus plus 8 μg/ml polybrene (Sigma–Aldrich, USA) for 24 h. After transduction, cells were cultured in NB-A for 120 h and then collected for subsequent experiments.
Primary microglial culture
Mixed glial cells were obtained from C57BL/6 mice embryonic day 17. Cells were cultured in high-glucose DMEM/F12 supplemented with 10% FBS in humidified air containing 5% CO2 at 37°C. The culture medium was replaced with fresh medium 24 h after the initial preparation and every 3 days thereafter. After 1 week, microglial cells were obtained by mechanical shaking of the mixed glial cell cultures for 1 h. Cells were routinely monitored for purity by ionized calcium binding adaptor molecule 1 (Iba1) staining and the population of Iba1+ cells was >95% [19,20]. Microglial cells were seeded at 80% density, then transduced with BRAFV600E, or BRAFWT, or vector lentivirus plus 8 μg/ml polybrene for 24 h. After transduction, the cells were cultured for 120 h in high-glucose DMEM/F12 with or without FBS, and the medium as well as the cells were collected for subsequent experiments.
Primary astrocyte culture
Primary astrocytes were obtained from C57BL/6 mice embryonic day 17. The dissected cortical tissue was digested, triturated and centrifuged as for neuronal cultures. The cell pellet was resuspended in high-glucose DMEM/F12 supplemented with 10% FBS. Cells were seeded in poly-L-ornithine-coated Petri plates. Nonadherent cells were removed after 20 min [21]. Astrocytes were transduced with BRAFV600E, or BRAFWT, or vector lentivirus plus 8 μg/ml polybrene for 24 h. After transduction, the cells were cultured for 120 h in high-glucose DMEM/F12 with or without FBS, and the medium as well as the cells were collected for subsequent experiments. All experiments were performed in accordance with a protocol approved by Institutional Animal Care and Use Committee at Massachusetts General Hospital.
siRNA transfection
Primary neurons and microglial cells were seeded in 6-well plates and transfected with ERK1 siRNA (Cell Signaling Technology, USA), ERK2 siRNA (Cell Signaling Technology), SAPK/JNK siRNA (Cell Signaling Technology) at 80% cell confluence on day 4 in culture. ERK1 siRNA, ERK2 siRNA, JNK siRNA and Lipofectamine RNAiMAX Transfection Reagent (Thermo Fisher Scientific) were diluted in OPTI-MEM medium (Thermo Fisher Scientific), mixed gently, and incubated for 5 min to allow complex formation. The cells were transfected by adding the RNAi–Lipofectamine complex dropwise to medium to achieve a siRNA concentration of 100 nmol/l. The cells were collected 48 h after the transfection for subsequent experiments [22].
Cell cycle determination
Cells were seeded in 6-well plates at 70% confluence, followed by virus transduction and siRNA treatment for 3 days. The cells were collected, fixed in 70% ethanol overnight, and stained with Tali Cell Cycle Kit (Thermo Fisher Scientific). We used the Attune NxT Flow Cytometer (Thermo Fisher Scientific) to determine the percentage of cells in each cell cycle phase. Flowjo software was used to analyze the data.
NO and LDH and MTS assays
Griess Reagent Kit (Thermo Fisher Scientific) was used to assess NO according to the manufacturer’s instructions. Cells were seeded in 96-well plates. We mixed the following reagents in each well: 20 µl Griess Reagent, 150 µl nitrite-containing sample, and 130 µl deionized water. A photometric reference was prepared by mixing 20 µl Griess Reagent and 280 µl deionized water. Absorbance of the nitrite-containing samples relative to the reference was measured in Synergy 2 Multi-Mode Microplate Reader (Bio-Tek, USA) at 548 nm.
For LDH assay, Pierce LDH Cytotoxicity Assay Kit (Thermo Fisher Scientific) was used. 50 µl cell culture medium was transferred to a new 96-well plate, 50 µl reaction mixture was added to each well and incubated at room temperature for 30 min, then 50 µl stop solution was added. Absorbance at 490 and 680 nm was measured using Synergy 2 Multi-Mode Microplate Reader (Bio-Tek , USA).
For MTS assay, MTS Cell Proliferation Colorimetric Assay Kit (BioVision, USA) was used. Cells were seeded in 96-well plates and treated as indicated above. After the treatment, cell culture medium of each well was removed and 110 µl reagent containing 10 µl MTS and 100 µl medium was added to each well and incubated in humidified air containing 5% CO2 at 37°C for 1 h. Absorbance at 490 nm was measured using a microplate reader.
Immunostaining and quantitative analysis
Cells were seeded in 24-well plates. After treatment, the medium was removed and the plates were washed with PBS three times, the slides were fixed with 4% paraformaldehyde for 15 min and washed with PBS three times, and permeabilized with 0.5% Triton X-100 at room temperature for 20 min. Plates were washed with PBS. 5% goat serum was added and incubated at room temperature for 30 min. Primary antibodies were added and incubated at 4°C overnight. Primary antibodies used were microtubule-associated protein 2 (MAP2) (1:500, Thermo Fisher Scientific), Iba1 (1:500, Abcam, USA), Ki-67 (1:100, Thermo Fisher Scientific), and glial fibrillary acidic protein (GFAP) (1:1000, Sigma–Aldrich,) Plates were washed with PBS and incubated with secondary antibody: goat anti-rabbit IgG-Alexa Fluor 488 (1:500, Molecular Probes, USA) or donkey anti-mouse IgG-Alexa Fluor 546 (1:500, Thermo Fisher Scientific) for 45 min in the dark at room temperature, washed with PBS, and stained with DAPI (Vector Laboratories, USA). For analysis of fluorescence intensity, images were captured under an Olympus BX51 microscope (Olympus Optical Co., Tokyo, Japan) with Olympus CAST stereology software and a DP 70 digital camera system using the same camera gain, exposure time and pixel setting for all samples. Integrated optical density (IOD) of staining in the images was analyzed by Image J.
RNA extraction and real-time quantitative PCR analysis
RNA was isolated using the TRIzol LS Reagent (Thermo Fisher Scientific). SuperScript III First-Strand Synthesis System (Thermo Fisher Scientific) was used for cDNA synthesis. All primers were obtained from Massachusetts General Hospital DNA Core and are listed in Table 1. StepOnePlus Real-Time PCR System (Thermo Fisher Scientific) was used. Relative gene expression levels were analyzed using the 2-ΔΔCt method. GAPDH was used as internal control.
Table 1
The sequences of primers.
Gene
|
Forward
|
Reverse
|
Nrf2
|
ACTCCCTGCAGCAAACAAGAG
|
TTTTTCTTAACATCTGGTTCTTACTTTT
|
HO-1
|
GCCCTGCCCTTCAGCAT
|
AGCTGCCACATTAGGGTGTCTT
|
GCLC
|
GATGCTGTCTTGCAGGGAATG
|
AGCGAGCTCCGTGCTGTT
|
GCLM
|
ACAGGTAAAACCAAATAGTAACCAAGTTAA
|
TGTTTAGCAAATGCAGTCAAATCTG
|
GDNF
|
TCTTTCGATATTGCAGCGGTT
|
GCTACGACGTGGGCTACAG
|
NQO1
|
TGGCCGAACACAAGAAGCTG
|
GCTACGAGCACTCTCTCAAACC
|
TNF-α
|
CCCTCACACTCAGATCATCTTCT
|
GCTACGACGTGGGCTACAG
|
IL-1α
|
GACAGGGAACTTAGGGAGCA
|
TTGGCCATCTTGATTTCAGAGT
|
IL-1β
|
TTCAGGCAGGCAGTATCACTC
|
GAAGGTCCACGGGAAAGACAC
|
IL-6
|
TAGTCCTTCCTACCCCAATTTCC
|
TTGGTCCTTAGCCACTCCTTC
|
IL-10
|
GCTGGACAACATACTGCTAACC
|
ATTTCCGATAAGGCTTGGCAA
|
iNOS
|
CCCTTCCGAAGTTTCTGGCAGCAGC
|
GGCTGTCAGAGAGCCTCGTGGCTTTGG
|
COX2
|
GGAGAGACTATCAAGATAGTGATC
|
ATGGTCAGTAGACTTTTACAGCTC
|
c-Jun
|
ACTCGGACCTTCTCACGTC
|
GGTCGGTGTAGTGGTGATGT
|
Bax
|
AGACAGGGGCCTTTTTGCTAC
|
AATTCGCCGGAGACACTCG
|
Bcl-2
|
GCTACCGTCGTGACTTCGC
|
CCCCACCGAACTCAAAGAAGG
|
p53
|
CCCCTGTCATCTTTTGTCCCT
|
AGCTGGCAGAATAGCTTATTGAG
|
Fasl
|
CAGCCCATGAATTACCCATGT
|
ATTTGTGTTGTGGTCCTTCTTCT
|
Western blotting
Western blotting was applied to detect BRAF, ERK, JNK, nuclear factor kappa-B (NF-κB), and other proteins associated with the pathways. Primary antibodies included BRAF (1:100, Thermo Fisher Scientific), MEK1/2 antibody (1:1000, Cell Signaling Technology), phospho-MEK1/2 antibody (1:1000, Cell Signaling Technology), ERK1/2 (1:1000, Cell Signaling Technology), phospho-ERK1/2 (1:1000, Cell Signaling Technology), JNK (1:1000, Cell Signaling Technology), phospho-JNK (1:1000, Cell Signaling Technology), NF-κB p65 (1:1000, Cell Signaling Technology), phospho-NF-κB p65 (1:1000, Cell Signaling Technology). GAPDH (1:5000, Proteintech, China) was used as internal control. RIPA lysis buffer containing PMSF Protease Inhibitor (Thermo Fisher Scientific) and Pierce Phosphatase Inhibitor (Thermo Fisher Scientific) were used to extract cell total protein. Protein concentration was determined by Pierce BCA Protein Assay Kit (Thermo Fisher Scientific). Equal amounts of protein (30 mg) were loaded onto SDS-PAGE. Following separation, proteins were transferred from the gels to methanol-activated polyvinylidene fluoride (PVDF; Sigma–Aldrich) transfer membranes, blocked with 5% BSA for 1 h at 37°C. The membranes were incubated with primary antibodies overnight at 4°C. Subsequently, the membranes were incubated with an appropriate horseradish-peroxidase-labeled secondary antibody for 1 h at room temperature. Proteins were visualized using an ECL system (Thermo Fisher Scientific). The expression levels of phosphorylated proteins were quantified by normalizing to their respective total proteins. Data was analyzed using ImageJ software.
ELISA
The release of Interleukin 1β (IL‑1β), Interleukin 6 (IL‑6) and tumor necrosis factor α (TNF‑α) in mouse primary microglial cell culture medium was measured with commercial ELISA kits-Mouse IL-1β (R&D Systems, USA), mouse IL-6 (R&D Systems), and mouse TNF-α (R&D Systems). Cells were seeded in 6-well plates and cultured with DMEM/F12 supplemented with 10% FBS. After virus transduction, the cells were cultured for 24 h in DMEM/F12 without FBS, and the medium was collected, centrifuged at 3000 rpm for 10 min, and the supernatant was subjected to ELISA. Absorbance at 450 nm was measured using Synergy 2 Multi-Mode Microplate Reader (Bio-Tek). IL-1β, IL-6 and TNF-α concentrations were calculated based on the standards and normalized with total protein concentration of the same sample.
Statistical analysis
All experiments were repeated at least three times with at least three replicates within each condition. Investigators who performed assays were blind to treatment groups. All values are presented as the mean ± SEM. Group comparisons were performed using ANOVA and Tukey's post hoc test. P < 0.05 was considered statistically significant. Postmortem SN (substantia nigra) gene expression profile from patients with Parkinson’s disease and function enrichment analysis of BRAF-related genes GDS2821 gene expression data from 16 Parkinson’s disease patients was obtained from the National Center for Biotechnology Information’s (NCBI) Gene Expression Omnibus (GEO: https://www.ncbi.nlm.nih.gov/geo). Raw data were normalized and processed by R software (version 3.3.3) with the limma package [23] and the normalized gene expression levels were presented as log2-transformed values. The Spearman coefficients of expression of genes and BRAF were calculated, whilst the expression genes with P < 0.05 were defined as BRAF-related genes. The Database for Annotation, Visualization, and Integrated Discovery (DAVID, http://david.ncifcrf.gov), an online functional annotation tool were applied for gene ontology (GO) enrichment analyses including biological process (BP), cellular component (CC) and molecular function (MF), and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis [24]. GO terms or KEGG pathways with P < 0.01 were considered statistically significant.