JEV strain. JEV (P3 strain) was donated by Professor Cao Shengbo, the State Key Laboratory of Agricultural Microbiology, Huazhong Agricultural University. The JEV P3 strain was amplified in the brains of neonatal mice and virulence was determined by a plaque test.
Establishment of the autophagy-regulated JE mouse model. Animal experiments were performed in accordance with the provisions of the Hubei Provincial Regulations on the Management of Laboratory Animals. A total of 305 BALB/c female mice aged 6 weeks were purchased from the Animal Experimental Center of Huazhong Agricultural University. They were divided into 8 groups: DMEM (0.1 mL) control group; JEV (105 PFU, 0.1 mL) infection group; JEV (105 PFU, 0.1 mL) + rapamycin (Rapa, 5 mg/kg, 0.2 mL) group; JEV (105 PFU, 0.1 mL) + wortmannin (Wort, 1 mg/kg, 0.2 mL) group; JEV (105 PFU, 0.1 mL) + chloroquine (CQ, 50 mg/kg, 0.2 mL) group; Rapa (5 mg/kg, 0.2 mL) group; Wort (1 mg/kg, 0.2 mL) group; CQ (50 mg/kg, 0.2 mL) group. In particular, Rapa, Wort, and CQ were administered 2 h prior to JEV challenge, and then administered daily for 10 consecutive days. The mice were continuously fed for 20 d, with daily observation and recording of their clinical symptoms. Mouse symptoms were scored based on a reported clinical symptom scale for JEV-infected mice [31]. All experiments were conducted using the protocol recommended by the Research Ethics Committee of the College of Veterinary Medicine, Huazhong Agricultural University, Hubei Province, China.
Collection of mouse brain samples. The mice were sacrificed at 10 d or 20 d after drug administration and JEV challenge. The left brain was frozen. Portions of the right cerebral cortex were taken (about the size of a sesame seed) and fixed in 2.5% glutaraldehyde, with the remaining portions fixed in 4% formaldehyde.
Transmission electron microscopy. After the small pieces of tissue were completely fixed in 2.5% glutaraldehyde, the tissues were embedded using a pure embedding medium (anhydrous acetone mixed with an embedding agent in a volume ratio of 1:1). After the tissue boundaries were trimmed, the tissues were sliced into ultra-thin sections (80–100 nm), which were stained sequentially with 4% uranyl acetate and lead citrate. The samples were observed and photographed under a transmission electron microscope (TECNA110, Philips, Netherlands).
Paraffin sectioning. After the brain tissues were fixed with 4% formaldehyde for 48 h, they were dehydrated using an ethanol gradient, embedded in paraffin with the cut surface down, and serially sectioned at 5 µm, with the sections subjected to different staining methods.
Haematoxylin-eosin (HE) staining. The standard haematoxylin-eosin (HE) staining method was adopted to stain selected tissues: the nuclei were stained by haematoxylin and the cytosol and extracellular matrix (ECM) were stained by eosin, followed by mounting with neutral gum.
Immunohistochemical staining. Paraffin sections were dewaxed and placed in 3% H2O2 for 30 min to quench endogenous peroxidase. The sections were incubated in 96 °C citrate buffer for 30 minutes to complete antigen retrieval. After washing, the sections were blocked in 5% BSA for 1 h, and then incubated with a mouse anti-JEV primary antibody (1:100, provided by the State Key Laboratory of Agricultural Microbiology, Huazhong Agricultural University) overnight at 4 °C. After washing, a secondary antibody (HRP-labelled goat anti-mouse/rabbit IgG, Gene Tech Co., Ltd., Shanghai, China) was added dropwise, and then the sections were incubated for 45 min. Finally, colour development was performed with DAB, and haematoxylin was counterstained. All immunohistochemical stained sections were scanned using the Leica Apero CS2 section scanning system.
RNAScope staining. RNAScope staining was performed according to the instructions of the RNAScope staining kit as follows. The sections were dewaxed and completely dried, after which RNAscope hydrogen peroxide was added dropwise. After incubation at room temperature, the slides were placed in a boiling RNAscope target retrieval reagent for antigen retrieval. RNAscope® Protease Plus was added dropwise, and the mixture was incubated at 40 °C in a hybridization oven, followed by the addition of an appropriate probe for continual incubation at 40 °C. Next, the mixture was washed in turn by Amp1−Amp6, coloured with a RED working solution, counterstained with haematoxylin, and mounted in glycerogelatin. All immunohistochemical stained sections were scanned using a Leica Apero CS2 scanner.
Tissue immunofluorescence. Paraffin sections were dewaxed to water and placed in 3% H2O2 for 30 min to quench endogenous peroxidase. Antigen retrieval was performed by incubating the sections in citrate buffer at 96 °C for 30 min. After washing, the sections were blocked in 5% BSA for 1 h and then incubated with primary antibodies (mouse anti-JEV-E antibody, 1:100, State Key Laboratory of Agricultural Microbiology, Huazhong Agricultural University; rabbit anti-LC3A/B antibody, 1:100, Seville Biotech Co., Ltd.) overnight at 4 °C. After washing, secondary antibodies (FITC Goat Anti-Mouse IgG; Cy3 Goat Anti-Rabbit IgG) were added dropwise and were incubated for 2 h, followed by washing, DAPI staining, and mounting with an anti-fluorescence quencher. Fluorescence signals were detected using a fluorescence confocal microscope.
Quantitative Real-time PCR (Q-PCR). The total RNA of brain tissue was extracted with Trizol by following the manufacturer's instructions and then reverse transcribed into cDNA using a TAKARA reverse transcription kit. Then, the Q-PCR reaction was carried out using a TAKARA Q-PCR kit. The primer sequences for the Q-PCR reaction are shown in Table 1. The reaction conditions of Q-PCR were as follows: pre-denaturation at 95 °C for 30 s, followed by 40 cycles of 95 °C for 5 s and 60 °C for 30 s, and melting curve analysis at 95 °C for 15 s, 60 °C for 30 s, and 95 °C for 15 s. The relative expression levels of target genes in each sample were calculated using the 2−ΔΔCt analysis method.
Table 1
Genename | Forward primer(5’-3’) | Reverse primer(5’-3’) |
β-actin | cactgccgcatcctcttcctccc | caatagtgatgacctggccgt |
IL-6 | agacttccatccagttgcct | tctcctctccggacttgtgaa |
IL-1β | atgaaagacggcacacccac | gcttgtgctctgcttgtgag |
TNF-α | tggcctccctctcatcagtt | ttgagatccatgccgttggc |
Western blotting. Total tissue protein was extracted using RIPA lysate, and protein quantitation was performed using the BCA method, with each sample adjusted to have the same protein content. After a prepared gel of a suitable concentration was fixed in an electrophoresis tank, protein samples and a marker were added to the sample wells using a micropipette for electrophoresis. Each excised protein band (gel slice) was transferred to a PVDF membrane, and blocked with 5% skim milk at 37 °C, followed by incubation with TBST-diluted primary antibodies overnight at 4 °C. The primary antibodies were: MAP LC3β (Santa Cruz Biotechnology), P62 (Servicebio), PI3 Kinase P85 alpha (ABclonal), Phospho-AKT (BOSTER), Phospho-JNK1/2 (ABclonal), Phospho-ERK1 (ABclonal), NF-kB (ABclonal), and GAPDH (Servicebio). Next, TBST-diluted secondary antibodies were added for incubation at 37 °C, followed by using a colour-developing solution to produce coloured bands, whose grey values were analysed using Image J software. The relative expression levels of LC3, P62, PI3K, P-AKT, P-ERK, P-JNK, and P65 proteins in brain tissues were detected using GAPDH as an internal reference. Quantitative statistics of the grey values of related proteins were performed using Image J software.
Statistical analysis. Data are expressed as the mean ± SD, and inter-group differences were analysed using One-way ANOVA, with P < 0.05* and P < 0.01** indicating significance and extreme significance, respectively.